Method for detecting dengue virus based on RPA / RAA / ERA / MIRRA-CRISPR / Cas12a

Abstract

The invention discloses a method for detecting dengue virus based on RPA / RAA / ERA / MIRA-CRISPR / Cas12a, which comprises the following steps: extracting nucleic acid to obtain a sample to be detected, putting the extracted sample in a sterile and disinfected sample container, contacting the sample to be detected with a composition, a product combination, a reagent, a kit, a system or a system, determining the signal change after the sample to be detected is contacted with different substances, and determining the detection result of the dengue virus based on RPA / RAA / ERA / MIRA-CRISPR / Cas12a. In the same container, a to-be-detected sample is in contact with a composition, a product combination, a reagent, a kit, a system or a part used for RPA / RAA / ERA / MIRA nucleic acid amplification in the system, and then is in contact with a part used for CRISPR nucleic acid detection, the RPA / RAA / ERA / MIRA and CRISPR / Cas12a detection methods are combined, a rapid, simple, sensitive and specific dengue virus detection method is realized, the detection sensitivity is high, and the detection time is short. The reaction conditions of virus detection are further optimized.

Description

Technical Field

[0001] The present invention relates to the technical field of dengue virus detection, and specifically to a method for detecting dengue virus based on RPA / RAA / ERA / MIRA-CRISPR / Cas12a. Background Art

[0002] Dengue virus (DENV) is a well-known mosquito-borne virus that is widely spread in tropical and subtropical regions of the world. The clinical manifestations of DENV range from mild dengue fever (DF) to severe and fatal dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS). DENV is a positive-sense single-stranded RNA virus with a nucleic acid length of about 11 kb, belonging to the genus Flavivirus in the family Flaviviridae. Generally, there are four known genetically distinct serotypes, including DENV-1, DENV-2, DENV-3, and DENV-4, based on plaque reduction neutralization assays. More than 390 million human infections and 25,000 deaths are caused by DENV each year. However, no existing vaccines or specific therapies have been approved to prevent its rapid emergence and global spread. Therefore, early detection of DENV is crucial for implementing preventive measures for DENV infection.

[0003] Generally, traditional DENV detection methods, including virus isolation, serology, enzyme-linked immunosorbent assay (ELISA), reverse transcription polymerase chain reaction (RT-PCR), and real-time quantitative RT-PCR (qRT-PCR), have been developed and widely used for the diagnosis of dengue infection. However, these methods are highly dependent on specific DENV antibodies, complex equipment, and trained staff. Therefore, these methods cannot be implemented in resource-poor areas. Isothermal amplification technology is a molecular-based method that can be performed under constant temperature conditions without a specific thermal heater, such as recombinase polymerase amplification (RPA) and loop-mediated isothermal amplification (LAMP). In addition, several related DENV detection methods have been established. However, the high rate of nonspecific products during amplification remains to be solved. Therefore, an improved technology is urgently needed to solve this problem in the existing technology. Summary of the invention

[0004] The object of the present invention is to provide a method for detecting dengue virus based on RPA / RAA / ERA / MIRA-CRISPR / Cas12a to solve the problems raised in the above background technology.

[0005] To achieve the above object, the present invention provides the following technical solution: a method for detecting dengue virus based on RPA / RAA / ERA / MIRA-CRISPR / Cas12a, wherein

[0006] After nucleic acid extraction, the sample to be tested is obtained, and the extracted sample is placed in a sterile and disinfected sample container;

[0007] contacting a sample to be tested with a composition, product combination, reagent, kit, system or system;

[0008] Determine the signal change after the test sample comes into contact with different substances;

[0009] In the same container, the sample to be tested comes into contact with the part of the composition, product combination, reagent, kit, system or system used for RPA / RAA / ERA / MIRA nucleic acid amplification, and then comes into contact with the part used for CRISPR nucleic acid detection.

[0010] Preferably, the container is a reaction tube;

[0011] The sample to be tested and the part used for RPA / RAA / ERA / MIRA nucleic acid amplification in the composition, product combination, reagent, kit, system or system are arranged in the tube body of the reaction tube;

[0012] The CRISPR nucleic acid detection part is arranged on the tube cover of the reaction tube and is located on a side of the tube body facing the reaction tube;

[0013] After the sample to be tested contacts the part for RPA / RAA / ERA / MIRA nucleic acid amplification, the part for CRISPR nucleic acid detection is made to fall into the tube body of the reaction tube by centrifugation, inversion and / or shaking, so that the sample to be tested contacts the part for CRISPR nucleic acid detection.

[0014] Preferably, the composition, product combination, reagent, kit, system further comprises a part for RPA / RAA / ERA / MIRA nucleic acid amplification, and the part for RPA / RAA / ERA / MIRA nucleic acid amplification comprises RPA / RAA / ERA / MIRA primers;

[0015] The RPA / RAA / ERA / MIRA primers include an F primer, a first R primer, and a second R primer, and the quantity ratio of the first R primer to the second R primer is 1:1.

[0016] The composition, product combination, reagent, kit, and system include a portion for CRISPR nucleic acid detection, and the portion for CRISPR nucleic acid detection includes: VA type Cas protein, guide RNA;

[0017] The guide RNA includes a direct repeat sequence capable of binding to a VA type Cas protein, a guide sequence capable of targeting SED IDNO.1, and a trans-cleavage reporter molecule, wherein the trans-cleavage reporter molecule does not hybridize with the guide sequence of the guide RNA.

[0018] Preferably, the RPA / RAA / ERA / MIRA nucleic acid amplification part is contacted using the RNA constant temperature rapid amplification kit of Amp Future, basic type-II, to form the following system:

[0019] The amount of freeze-dried reagent of RNA constant temperature rapid amplification kit is 1 / 5 of the reaction unit;

[0020] Buffer A, 5.88 μL;

[0021] Buffer B, 0.5 μL;

[0022] Nuclease-free water, 1.82 μL;

[0023] Sample to be tested, 1 μL;

[0024] F primer, 10 μM, 0.4 μL;

[0025] R primer, ratio 1:1, 10 μM, 0.4 μL;

[0026] The part used for CRISPR nucleic acid detection uses reagents from Tolo Biotechnology to form the following system:

[0027] 10× HOLMES buffer, 2 μL;

[0028] LbCas12a, 10 μM, 1 μL;

[0029] HOLMES ssDNA reporter, FAM, 10 μM, 2 μL;

[0030] Guide RNA, 10 μM, 2 μL;

[0031] Nuclease-free water, 3 μL.

[0032] Preferably, the VA type Cas protein is Cas12a, preferably LbCas12a, and the final concentration of LbCas12a is 100-1100nM;

[0033] The final concentration of the guide RNA is 100-2200 nM;

[0034] The trans-cleavage reporter molecule is FAM-CCCCCCCC-BHQI, with a final concentration of 0.5-2.5 μM.

[0035] Preferably, the temperature range of the nucleic acid amplification reaction is 36-45°C, and the temperature range of the CRISPR nucleic acid detection is 42-56°C.

[0036] Compared with the prior art, the present invention has the following beneficial effects:

[0037] (1) The use of RNA is as a guide RNA for a nucleic acid detection method using the trans-cleavage activity of a VA-type Cas protein, or for preparing a composition, product combination, reagent, kit, system or system for nucleic acid detection using the trans-cleavage activity of a VA-type Cas protein, wherein the nucleic acid detection is a CRISPR nucleic acid detection of dengue virus;

[0038] (2) The dengue virus detection established a one-tube two-step CRISPR nucleic acid detection system for dengue virus, which has the characteristics of rapid detection and convenient operation, and also has high detection sensitivity. The use of the CRISPR one-tube detection system does not require secondary opening of the lid for sample addition, which can not only avoid aerosol contamination, but also use CRISPR technology to improve the specificity of isothermal amplification detection and avoid the risk of false positive results. In the dengue virus RNA template concentration gradient detection, more than 100 copies / Test can ensure a high detection rate. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 The present invention is a schematic diagram of the present invention;

[0040] Figure 2 It is the main amplification primer of the present invention, T7 template transcription primer and crRNA and other nucleic acid sequences display.

[0041] Figure 3 is a result diagram of dengue virus RT-RPA primer screening in Example 1;

[0042] Figure 4 This is a result diagram of crRNA screening of the dengue virus one-tube two-step CRISPR nucleic acid detection system in Example 1;

[0043] Figure 5 This is a result diagram of DENV detection and screening using crRNA2 and different primer combinations in Example 1;

[0044] Figure 6 This is a diagram showing the optimization results of the dosage of Cas protein and crRNA for dengue virus one-tube two-step CRISPR nucleic acid detection in Example 1;

[0045] Figure 7 This is a graph showing the results of the one-tube two-step RT-RPA incubation temperature gradient analysis of dengue virus in Example 1;

[0046] Figure 8 This is a graph of the concentration gradient detection results of the dengue virus one-tube two-step CRISPR nucleic acid detection template in Example 1, showing the final fluorescence signal intensity during detection at different copy number concentrations. DETAILED DESCRIPTION

[0047] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0048] See also Figure 1-8 The present invention provides a technical solution: a method for detecting dengue virus based on RPA / RAA / ERA / MIRA-CRISPR / Cas12a, wherein the sample to be detected is obtained by nucleic acid extraction, and the extracted sample is placed in a sterile and disinfected sample container, the sample to be detected is contacted with a composition, a product combination, a reagent, a kit, a system or a system, and the signal change after the detection sample is in contact with different substances is measured. In the same container, the sample to be detected is contacted with a part of the composition, product combination, reagent, kit, system or system used for RPA / RAA / ERA / MIRA nucleic acid amplification, and then contacted with a part used for CRISPR nucleic acid detection.

[0049] The container is a reaction tube, the sample to be tested and the part for RPA / RAA / ERA / MIRA nucleic acid amplification in the composition, product combination, reagent, kit, system or system are arranged in the tube body of the reaction tube, the part for CRISPR nucleic acid detection is arranged on the tube cover of the reaction tube and is located on the side facing the tube body of the reaction tube, after the sample to be tested contacts the part for RPA / RAA / ERA / MIRA nucleic acid amplification, the part for CRISPR nucleic acid detection falls into the tube body of the reaction tube by centrifugation, inversion and / or shaking, so that the sample to be tested contacts the part for CRISPR nucleic acid detection.

[0050] The composition, product combination, reagent, kit, and system also include a part for RPA / RAA / ERA / MIRA nucleic acid amplification, wherein the RPA / RAA / ERA / MIRA nucleic acid amplification part includes RPA / RAA / ERA / MIRA primers, and the RPA / RAA / ERA / MIRA primers include an F primer, a first R primer, and a second R primer, and the quantity ratio of the first R primer to the second R primer is 1:1.

[0051] The composition, product combination, reagent, kit, and system include a part for CRISPR nucleic acid detection, which includes a VA type Cas protein and a guide RNA, wherein the guide RNA includes a direct repeat sequence capable of binding to the VA type Cas protein and a guide sequence capable of targeting SED ID NO.1 and a trans-cleavage reporter molecule, wherein the trans-cleavage reporter molecule does not hybridize with the guide sequence of the guide RNA, wherein the Cas protein refers to the CRISPR-associated protein, which is a related protein in the CRISPR system.

[0052] The purpose of RNA is to serve as a guide RNA for a nucleic acid detection method utilizing the trans-cleavage activity of a VA-type Cas protein, or for preparing a composition, product combination, reagent, kit, system or system for nucleic acid detection utilizing the trans-cleavage activity of a VA-type Cas protein, wherein the nucleic acid detection is a CRISPR nucleic acid detection of dengue virus.

[0053] Partial contact of RPA / RAA / ERA / MIRA nucleic acid amplification uses the RNA constant temperature rapid amplification kit of Amp Future, basic type-II, to form the following system:

[0054] The amount of freeze-dried reagent of RNA constant temperature rapid amplification kit is 1 / 5 of the reaction unit;

[0055] Buffer A, 5.88 μL;

[0056] Buffer B, 0.5 μL;

[0057] Nuclease-free water, 1.82 μL;

[0058] Sample to be tested, 1 μL;

[0059] F primer, 10 μM, 0.4 μL;

[0060] R primer, ratio 1:1, 10 μM, 0.4 μL;

[0061] The part used for CRISPR nucleic acid detection uses reagents from Tolo Biotechnology to form the following system:

[0062] 10× HOLMES buffer, 2 μL;

[0063] LbCas12a, 10 μM, 1 μL;

[0064] HOLMES ssDNA reporter, FAM, 10 μM, 2 μL;

[0065] Guide RNA, 10 μM, 2 μL;

[0066] Nuclease-free water, 3 μL.

[0067] The VA-type Cas protein is Cas12a, (formerly known as "Cpf1") refers to the crRNA-dependent endonuclease, which is the VA-type enzyme in the CRISPR system classification. Cas12b" and "C2c1" can be used interchangeably and refer to the sgRNA-dependent endonuclease, which is the VB-type enzyme in the CRISPR system classification.

[0068] LbCas12a is preferred, wherein the final concentration of LbCas12a is 100-1100 nM, the final concentration of the guide RNA is 100-2200 nM, and the trans-cleavage reporter molecule is FAM-CCCCCCCC-BHQI, with a final concentration of 0.5-2.5 μM.

[0069] The temperature range of the nucleic acid amplification reaction is 36-45°C, and the temperature range of the CRISPR nucleic acid detection is 42-56°C.

[0070] A method for detecting dengue virus is a method for detecting dengue virus based on RPA / RAA / ERA / MIRA-CRISPR / Cas12a, wherein a sample to be tested is contacted with a composition, product combination, reagent, kit, system or system substance, and a signal change is measured. The sample to be tested is obtained by nucleic acid extraction. In the same container, the sample to be tested is contacted with a part of the composition, product combination, reagent, kit, system or system used for RPA / RAA / ERA / MIRA nucleic acid amplification, and then contacted with a part used for CRISPR nucleic acid detection.

[0071] The container is a reaction tube, and the part for RPA / RAA / ERA / MIRA nucleic acid amplification in the sample to be tested and the composition, product combination, reagent, kit, system or system is arranged in the tube body of the reaction tube, and the part for CRISPR nucleic acid detection is arranged on the tube cover of the reaction tube and is located on the side facing the tube body of the reaction tube. After the sample to be tested contacts the part for RPA / RAA / ERA / MIRA nucleic acid amplification, the part for CRISPR nucleic acid detection falls into the tube body of the reaction tube by centrifugation, inversion and / or shaking, so that the sample to be tested contacts the part for CRISPR nucleic acid detection.

[0072] The part used for RPA / RAA / ERA / MIRA nucleic acid amplification uses the RNA constant temperature rapid amplification kit of Amp Future, basic type-II, to form the following system:

[0073] The amount of freeze-dried reagent of RNA constant temperature rapid amplification kit is 1 / 5 of the reaction unit;

[0074] Buffer A, 5.88 μL;

[0075] Buffer B, 0.5 μL;

[0076] Nuclease-free water, 1.82 μL;

[0077] Sample to be tested, 1 μL;

[0078] F primer, 10 μM, 0.4 μL;

[0079] R primer, ratio 1:1, 10 μM, 0.4 μL;

[0080] The part used for CRISPR nucleic acid detection uses reagents from Tolo Biotechnology to form the following system:

[0081] 10x HOLMES buffer, 2 μL;

[0082] LbCas12a, 10 μM, 1 μL;

[0083] HOLMES ssDNA reporter, FAM, 10 μM, 2 μL;

[0084] Guide RNA, 10 μM, 2 μL;

[0085] Nuclease-free water, 3 μL.

[0086] The VA type Cas protein is Cas12a, preferably LbCas12a, more preferably, the concentration of LbCas12a is 100-1100nM, the concentration of the guide RNA is 100-2200nM, the trans-cleavage reporter molecule is FAM-CCCCCCCC-BHQI, and the final concentration is 0.5-2.5μM.

[0087] The temperature for nucleic acid amplification reaction is 36-45°C, and the temperature for CRISPR nucleic acid detection is 42-56°C.

[0088] In another preferred embodiment, Cas12a is selected from FnCas12a, LbCas12a, ErCas12a, Evcas12a, Lb5Cas12a, HkCas12a, OsCas12a, TsCas12a, BbCas12a, BoCas12a, Lb4Cas12a, CeCas12a, PrCas12a, CsbCas12a, BhCas12a, SsCas12a, Lb3Cas12a, BpCas12a, PdCas12a, BfCas12a, PcCas12a, cMtCas12a, PeCas12a, LiCas12a, Lb2Cas12a, PmCas12a, MbCas12a, EeCas12a, CsbCas12a, ArCas12a, BsCas12a, AbCas12a, AsCas12a, or a combination thereof.

[0089] The source of Cas12a is selected from the group consisting of Leptotrichia, Listeria, Corynebacterium, Sutterella, Legionella, Treponema, Linebacterium, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacterium, Azospirillum, Sphaerochaeta, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, Mycoplasma, Campylobacter, Lachnospira, or a combination thereof.

[0090] In another preferred embodiment, the source of Cas12a is selected from Francisella tularensis (FnCas12a), Acidaminococcus sp. BV3L6 (AsCas12a), Lachnospiraceae bacterium ND2006 (LbCas12a), Lachnospiraceae bacterium NC2008 (Lb5Cas12a), Helcococcus spkunzii (HkCas12a), Oribacterium sp. NK2B42 (OsCas12a), Thiomicrospira sp. XS5 (TsCas12a), Bacteroides KA00251 (Bacteroidales bacterium KA00251) (BbCas12a), Bacteroidetes oral taxon 274)(BoCas12a), Lachnospiraceaebacterium MC2017(Lb4Cas12a), Coprococcus eutactus(CeCas12a), Prevotella ruminicola strain BPI-34(PrCas12a), CandidatusSaccharibacteria bacterium(CsbCas12a), Butyrivibrio hungateistrain MB2003(BhCas12a), Smithella sp.SC_K08D17)(SsCas12a), Lachnospiraceae bacterium MC2017(Lb3Cas12a), Bytyrivibrio proteoclasticus(BpCas12a), Prevotelladisens(PdCas12a), Butyrivibrio fibrisolvens MD2001(BfCas12a), Porphyromonas crevioricanis(PcCas12a), CandidatusMethanoplasma termitum(CMtCas12a), Peregrinibacteria bacterium(PeCas12a), Leptospira inadaiserovar Lyme(LiCas12a), Lachnospiraceae bacterium MA2020(Lachnospiraceae bacterium MA2020)(Lb2Cas12a), Porphyromonas macaca(PmCas12a), Moraxella bovoculi 237(MbCas12a), Eubacterium eligens(EeCas12a), Candidatus Saccharibacteria bacterium(CsbCas12a), Eubacterium rectal(ErCas12a), Agathobacter rectalis strain(ArCas12a), Butyrivibrio sp. NC3005(BsCas12a), Arcobacter butzleri(AbCas12a), or a combination thereof. .

[0091] Example 1

[0092] 1. Experimental Materials and Methods

[0093] 1.1 Experimental instruments

[0094] Table 1 Experimental instruments

[0095]

[0096] 1.2 Experimental Reagents

[0097] Table 2 Experimental reagents

[0098]

[0099] The specific HOLMES ssDNA reporter molecule is: FAM-CCCCCCCC-BHQI.

[0100] Experimental methods

[0101] Dengue virus detection target selection and RNA template transcription

[0102] The conserved region of dengue virus (type I-IV) was selected as the amplification and detection target. According to the sequence comparison results, the specific conserved sequence region was selected as the detection region (SEQ ID NO.1), and the plasmid pUC57-DENV_3'UTR containing the dengue virus gene sequence was constructed. The plasmid pUC57-DENV_3'UTR containing the dengue virus gene sequence was constructed. The selected gene sequence is as follows (SEQ ID NO.1):

[0103] TAATACGACTCACTATAGGGAAGCTGTACGCATGGCGTAGCAGACTAGCGGTTAGAGGAGACCCCTCCCATGACAAAACGCAGCAAGCGGGGCCCGAACACGAGAGGAAGCTGTACCCTCGTGGGAAGGACTAGAGGTTAGAGGAGACCCCCCGCAAAACAAAAACAGCATATTGACGCTGGGAGAGACCAGAGATCCTGCTGTCTCTTCAGCATCATTCCAGGCACAGAACGCCAGAAAATGGAATGGTGCTGTTGAATCAACAGGTTCT The total length of the plasmid is 2710 bp+271 bp=2981 bp. The primer sequence containing the T7 promoter was designed, and PCR was performed on the plasmid template.

[0104] Table 3 T7 primer sequences designed for RNA transcription templates (underlined portion is T7 promoter)

[0105]

[0106] The primers were used to perform PCR amplification on the plasmid, and the amplified product was used for in vitro transcription (transcription and purification reagents in the Tolo Bio 31903Cas12a High-Efficiency crRNA Synthesis and Purification Kit) to obtain the target RNA sequence template, purify the RNA template, and use the PoraBio fluorescence photometer to detect the concentration of the product, and the copy number was calculated by the molar mass of the RNA template sequence.

[0107] RT-RPA primer design

[0108] RPA primers were designed based on the selected dengue virus conserved sequence region. The length of RPA primers is generally 30-35 bp. Other design requirements are similar to those of PCR primers. For primer design sequences, see Table 4 and Figure 2 .

[0109] Table 4 Dengue virus RPA primers

[0110]

[0111]

[0112] Since some sequences have multiple mutations, two R1 primers, a and b, are designed and need to be mixed in a 1:1 ratio when used.

[0113] Dengue virus RT-RPA primer screening

[0114] Dengue virus RT-RPA reaction system Prepare the reaction system according to Table 5 below. Use the Amp Future RNA Constant Temperature Rapid Amplification Kit, manually flick the above reaction system to mix, and briefly centrifuge to gather the reagents at the bottom of the tube, then add it to the basic reaction unit, gently flick the basic reaction unit to allow the lyophilized powder to fully and evenly dissolve, then briefly centrifuge to collect the liquid to the bottom of the tube, finally open the reaction unit, add 2.5 μL B buffer to the inside of the tube cap of each reaction unit, then add 5 ul template to the reaction unit, centrifuge the test tube to mix the reaction system, place it on an ice box, and then set the amplification program on the PCR instrument.

[0115] Table 5 Dengue virus RT-RPA nucleic acid amplification system

[0116]

[0117]

[0118] The reaction procedure was: constant temperature at 40°C and reaction time of 30 min.

[0119] The amplification results of each primer group were obtained by electrophoresis at 150V for 15 min using 1% (m / V) agarose gel. Figure 3 ,according to Figure 3 It can be seen that from the analysis of product quantity, the F1 primer is significantly better than F2, among which the F1 combinations R4, R5 and R6 can produce more products. Considering the sequence length and coverage, tuberculosis crRNA screening is needed to determine the final template of the primer.

[0120] Dengue virus crRNA design

[0121] According to the RPA primers with better performance screened by dengue virus, the corresponding Cas12a crRNA was designed within the amplified fragment. The sequences are shown in Table 6 and Figure 2 shown.

[0122] Table 6 Dengue virus crRNA sequence (the underlined sequence is the target sequence)

[0123]

[0124] Establishment of a one-tube two-step CRISPR nucleic acid detection system for dengue virus

[0125] Dengue virus Cas12a crRNA in vitro transcription and purification The Cas12a High Yield crRNA Synthesis and Purification Kit (Cas12a High Yield crRNA Synthesis and Purification Kit, Catalog No. 31903, ToloBio) kit was used to perform in vitro transcription and purification of Cas12a crRNA. The specific process is as follows: Cas12a Sense Oligo, Anneal Buffer, Transcript Max Reaction Buffer, NTP premix, Transcript Max Enzyme premix, DNaseⅠBuffer, and DNaseⅠare all provided by Tolo Bio's Cas12a High Efficiency crRNA Synthesis and Purification Kit.

[0126] DNA transcription template preparation

[0127] After completing the annealing and extension reaction between Cas12a Sense Oligo and TargetAntisense Oligo series primers in the Cas12a High-efficiency crRNA Synthesis and Purification Kit, it can be used as a transcription template.

[0128] Table 7 Target Antisense Oligo sequences used for dengue virus crRNA transcription

[0129]

[0130] a. Annealing and extension system preparation

[0131] Table 8 Annealing and extension system preparation

[0132]

[0133] b. PCR annealing extension program settings

[0134] Table 9 PCR annealing extension program settings

[0135]

[0136] ②Cas12a crRNA in vitro transcription

[0137] a. Prepare the reaction system according to the order of reagents in the table below.

[0138] Table 10 Reaction system

[0139]

[0140] b. Mix the above reagents thoroughly, then centrifuge briefly to centrifuge the reagent components to the bottom of the PCR tube, and incubate at 37°C for 2-4 hours for in vitro transcription. Prolonging the transcription time can increase the transcription yield. If the transcription product is used for CRISPR one-tube detection, overnight transcription for 12-16 hours is recommended.

[0141] c. After the 37°C incubation, prepare 30 μL of DNase I reaction solution according to the table below and add it to 20 μL of in vitro transcription product to remove the DNA template in the transcription system.

[0142] Table 11 DNase I reaction solution

[0143]

[0144] DNaseⅠ reaction conditions: 37℃, 30min.

[0145] ③ Magnetic bead purification of Cas12a crRNA transcription products

[0146] a. First, take the magnetic beads out of the 4°C refrigerator and place them at room temperature for about 30 minutes to allow the temperature to equilibrate to room temperature. Invert or vortex to mix the magnetic beads thoroughly, pipette 25 μL of magnetic beads and 50 μL of isopropanol into 50 μL of the crRNA sample to be purified, and mix thoroughly by pipetting.

[0147] b. Incubate at room temperature for 5 minutes to allow the RNA to bind to the magnetic beads.

[0148] c. Place the sample on the magnetic rack for 5 minutes. After the solution becomes clear, carefully remove the supernatant.

[0149] d. Keep the sample on the magnetic rack, add 200 μL of freshly prepared 80% (v / v) ethanol, rinse the magnetic beads, incubate at room temperature for 30 seconds, and carefully remove the supernatant. The 80% (v / v) ethanol used for rinsing needs to be freshly prepared using nuclease-free water. During the preparation process, measure 8 mL of anhydrous ethanol and 2 mL of nuclease-free water respectively, and mix them to obtain 10 mL of 80% (v / v) ethanol.

[0150] e. Repeat step 4 and rinse 2 times in total.

[0151] f. Keep the sample on the magnetic rack at all times and open the lid to air-dry the magnetic beads for 5 minutes.

[0152] Note: Avoid over-drying when opening the magnetic beads to dry. If the magnetic beads crack, it indicates that the magnetic beads are over-dried, and the RNA elution efficiency will be reduced.

[0153] g. Remove the sample from the magnetic rack, add 50 μL of nuclease-free water, pipette to mix thoroughly, and let stand at room temperature for 5 minutes.

[0154] h. Place the sample on a magnetic stand for 5 minutes. After the solution is clarified, carefully transfer the supernatant to a new nuclease-free PCR tube to obtain the purified Cas12a crRNA.

[0155] (2) Screening of a one-tube two-step CRISPR nucleic acid detection system for dengue virus

[0156] Based on the RT-RPA nucleic acid amplification system in Table 5, one-fifth of the volume of the RT-RPA nucleic acid amplification system was used to screen crRNA for the dengue virus one-tube two-step CRISPR nucleic acid detection system. For details, see Table 12 below. The RNA constant temperature rapid amplification kit lyophilized reagent, A buffer (A Buffer), and B buffer (B Buffer) are provided by Amp Future RNA Constant Temperature Rapid Amplification Kit (Basic Type)-II, and the subsequent experiments are the same. The HOLMES buffer (HOLMES Buffer) is provided by Tolo Harbor Biological's LbCas12a enzyme, and the subsequent experiments are the same.

[0157] Table 12 Dengue virus CRISPR one-tube system crRNA screening

[0158]

[0159]

[0160] Add the RT-RPA system to the bottom of the PCR tube and the CRISPR nucleic acid detection system to the lid of the PCR tube. Close the hot lid, incubate at 40°C for 30 minutes, separate the sample instantly, mix the CRISPR nucleic acid detection system and the RT-RPA system (put on ice before detection to reduce the CRISPR reaction rate), incubate at 48°C for 10 minutes, and collect the FAM fluorescence channel signal every 30 seconds.

[0161] Since the amplification product of the F1R1 combination can include all crRNAs, the amplification product of the F1R1 primer combination was used for crRNA screening.

[0162] according to Figure 4 It can be seen that dengue virus DENV_3'UTR_crRNA2 and DENV_3'UTR_crRNA3 have the best effect. However, since the PAM sequence of DENV_3'UTR_crRNA3 contains a degenerate base, it may cause the CRISPR recognition efficiency to decrease in some dengue viruses, so the CRISPR detection system finally selected DENV_3'UTR_crRNA2.

[0163] Figure 5 The corresponding experiment used crRNA2 and different primer combinations for DENV detection and screening. Since crRNA2 overlaps with R2 / R3 / R4 / R5 / R6, it can bind to primers in the absence of products to generate CRISPR trans-cutting signals. Therefore, the primers selected can only use DENV_3UTR-F1 in combination with DENV_3UTR-R1a / b.

[0164] Optimization of one-tube two-step CRISPR nucleic acid detection system for dengue virus

[0165] Optimization of Cas protein and crRNA dosage for one-tube two-step CRISPR nucleic acid detection

[0166] According to the dengue virus crRNA screened in Table 12, the dosage of Cas protein and crRNA in the one-tube two-step CRISPR nucleic acid detection system was further optimized.

[0167] Table 13 Optimization of Cas protein and crRNA dosage in one-tube two-step CRISPR nucleic acid detection of dengue virus

[0168]

[0169] Since the Cas enzyme requires crRNA activation, the default crRNA concentration is not lower than the Cas enzyme concentration when designing the experiment.

[0170] After configuring the two-part system according to the table above, add the RT-RPA detection system to the bottom of the PCR tube. Add the CRISPR detection system to the lid of the PCR tube and close the hot lid. Incubate at 40°C for 30 minutes, remove the sample instantly, mix the CRISPR detection system and RT-RPA amplification system (put on ice before detection to reduce the CRISPR reaction rate) and incubate at 48°C for 10 minutes, during which the FAM fluorescence channel signal is collected every 30 seconds.

[0171] according to Figure 6 The optimization results of the Cas protein and crRNA dosage in the dengue virus CRISPR one-tube method showed that the signal was better when the crRNA and LbCas12a concentrations in the DENV_3'UTR-crRNA2 system were 500nM and 1000nM.

[0172] Optimization of reaction temperature for one-tube two-step CRISPR nucleic acid detection of dengue virus.

[0173] The dengue virus one-tube two-step CRISPR reaction system was prepared according to the best results screened in Table 13. The optimal reaction temperature was screened at 38°C, 40°C and 42°C.

[0174] according to Figure 7 It can be seen that when the temperature is 38 degrees Celsius, the detection signal value of the amplified product is relatively the highest. Therefore, 38°C is selected as the RT-RPA temperature.

[0175] Analysis of the detection limit of dengue virus using one-tube two-step CRISPR nucleic acid assay

[0176] According to the above results, a reaction system was set up.

[0177] The dengue virus template concentration gradient was set to 100 copies / Test, 50 copies / Test, and 25 copies / Test, and each concentration gradient was repeated 8 times.

[0178] Table 14 Analysis of dengue virus one-tube two-step CRISPR nucleic acid detection limit

[0179]

[0180] Reaction conditions: RT-RPA system was added to the bottom of the PCR tube, CRISPR nucleic acid detection system was added to the lid of the PCR tube, the hot lid was closed, incubated at 38°C for 30 min, the sample was instantly centrifuged, the RT-RPA system and CRISPR nucleic acid detection system were mixed, incubated at 48°C for 10 min, and the FAM fluorescence signal was collected every 30 s. The results are shown in Figure 8 .

[0181] According to the rising amplitude of the fluorescence signal, the detection rate under each concentration gradient was analyzed to obtain the following table.

[0182] Table 15 Analysis of the detection rate of dengue virus one-tube two-step CRISPR nucleic acid detection

[0183] Copies / Test 25 50 100 Checkout 4 5 8 Total number of samples 8 8 8 Detection rate 50％ 63％ 100％

[0184] At a concentration of 100 copies / Test, the sample guaranteed a detection rate of 8 / 8 (100%). At 50 copies / Test, the detection rate dropped to 5 / 8 (63%). Therefore, this experiment proves that the dengue virus CRISPR one-tube method has a higher detection rate at a template concentration of more than 100 copies.

[0185] The dengue virus test establishes a one-tube, two-step CRISPR nucleic acid detection system for dengue virus, which has the characteristics of rapid detection and convenient operation, as well as high detection sensitivity. The use of the CRISPR one-tube detection system does not require secondary opening of the lid for sample addition, which not only avoids aerosol contamination, but also uses CRISPR technology to improve the specificity of isothermal amplification detection and avoid the risk of false positive results. In the dengue virus RNA template concentration gradient detection, more than 100 copies / Test can guarantee a high detection rate.

[0186] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A method for detecting dengue virus based on RPA / RAA / ERA / MIRA-CRISPR / Cas12a, characterized in that: Said After nucleic acid extraction, the sample to be tested is obtained, and the extracted sample is placed in a sterile and disinfected sample container; contacting a sample to be tested with a composition, product combination, reagent, kit, system or system; Determine the signal change after the test sample comes into contact with different substances; In the same container, the sample to be tested comes into contact with the part of the composition, product combination, reagent, kit, system or system used for RPA / RAA / ERA / MIRA nucleic acid amplification, and then comes into contact with the part used for CRISPR nucleic acid detection.

2. A method for detecting dengue virus based on RPA / RAA / ERA / MIRA-CRISPR / Cas12a according to claim 1, characterized in that: The container is a reaction tube; The sample to be tested and the part used for RPA / RAA / ERA / MIRA nucleic acid amplification in the composition, product combination, reagent, kit, system or system are arranged in the tube body of the reaction tube; The CRISPR nucleic acid detection part is arranged on the tube cover of the reaction tube and is located on a side of the tube body facing the reaction tube; After the sample to be tested contacts the part for RPA / RAA / ERA / MIRA nucleic acid amplification, the part for CRISPR nucleic acid detection is made to fall into the tube body of the reaction tube by centrifugation, inversion and / or shaking, so that the sample to be tested contacts the part for CRISPR nucleic acid detection.

3. A method for detecting dengue virus based on RPA / RAA / ERA / MIRA-CRISPR / Cas12a according to claim 1, characterized in that: The composition, product combination, reagent, kit, and system also include a portion for RPA / RAA / ERA / MIRA nucleic acid amplification, and the portion for RPA / RAA / ERA / MIRA nucleic acid amplification includes RPA / RAA / ERA / MIRA primers; The RPA / RAA / ERA / MIRA primers include an F primer, a first R primer, and a second R primer, and the quantity ratio of the first R primer to the second R primer is 1:

1. The composition, product combination, reagent, kit, and system include a portion for CRISPR nucleic acid detection, and the portion for CRISPR nucleic acid detection includes: VA type Cas protein, guide RNA; The guide RNA includes a direct repeat sequence capable of binding to a VA type Cas protein, a guide sequence capable of targeting SED ID NO.1, and a trans-cleavage reporter molecule, wherein the trans-cleavage reporter molecule does not hybridize with the guide sequence of the guide RNA.

4. A method for detecting dengue virus based on RPA / RAA / ERA / MIRA-CRISPR / Cas12a according to claim 1, characterized in that: The RPA / RAA / ERA / MIRA nucleic acid amplification part uses the RNA constant temperature rapid amplification kit of Amp Future, basic type-II, to form the following system: The amount of lyophilized reagent of RNA constant temperature rapid amplification kit is 1 / 5 of the reaction unit; Buffer A, 5.88 μL; Buffer B, 0.5 μL; Nuclease-free water, 1.82 μL; Sample to be tested, 1 μL; F primer, 10 μM, 0.4 μL; R primer, ratio 1:1, 10 μM, 0.4 μL; The part used for CRISPR nucleic acid detection uses reagents from Tolo Biotechnology to form the following system: 10× HOLMES buffer, 2 μL; LbCas12a, 10 μM, 1 μL; HOLMES ssDNA reporter, FAM, 10 μM, 2 μL; Guide RNA, 10 μM, 2 μL; Nuclease-free water, 3 μL.

5. A method for detecting dengue virus based on RPA / RAA / ERA / MIRA-CRISPR / Cas12a according to claim 3, characterized in that: The VA type Cas protein is Cas12a, preferably LbCas12a, and the final concentration of LbCas12a is 100-1100nM; The final concentration of the guide RNA is 100-2200 nM; The trans-cleavage reporter molecule is FAM-CCCCCCCC-BHQI, with a final concentration of 0.5-2.5 μM.

6. A method for detecting dengue virus based on RPA / RAA / ERA / MIRA-CRISPR / Cas12a according to claim 1, characterized in that: The temperature range of the nucleic acid amplification reaction is 36-45°C, and the temperature range of the CRISPR nucleic acid detection is 42-56°C.

Images