Application of TRIM5 as tumor prognosis marker

Abstract

The invention relates to the field of preparation of medical biological reagents, in particular to related application of TRIM5 as a tumor prognostic marker. The invention discloses application of TRIM5 serving as a prognosis marker and a grading marker of pancreatic cancer, gastric cancer and other tumors and application of the TRIM5 in preparation of related detection kits. Compared with the prior art, the method has the advantages that the TRIM5 is taken as a target spot, the correlation of the TRIM5 in multiple dimensions such as expression profile, clinical significance, prognosis value and immune infiltration is analyzed through network big data to obtain a result, and through in-vitro experiment verification, the TRIM5 has high feasibility and accuracy when being taken as a prognosis and grading marker of tumors such as pancreatic cancer and gastric cancer. And a new way is provided for effectively and accurately predicting the treatment response and the disease progress of a related tumor patient, realizing a personalized treatment scheme and developing a new treatment strategy.

Description

Technical Field

[0001] The present invention relates to the field of preparation of pharmaceutical biological reagents, and in particular to the use of TRIM5 as a tumor prognosis marker. Background Art

[0002] The tripartite motif (TRIM) family of proteins was first discovered in Xenopus nuclear factor 7 in 1991. It has a highly conserved RBCC domain and is a class of proteins that play an important role in organisms. At present, more than 80 TRIM proteins have been identified in the human genome, which are involved in regulating multiple physiological and pathological processes such as cell signaling, apoptosis, immune response, inflammation and tumor regulation. TRIM proteins help hosts defend against pathogen infection and respond to immune-related diseases by regulating the activity of nuclear factor NF-κB and IRF family transcription factors. In the TRIM family, TRIM5 is well known as a retroviral restriction factor. For example, TRIM5 can bind to human immunodeficiency virus (HIV) protease NS2B / 3, promote ubiquitination and proteasomal degradation of NS2B / 3 K48, thereby inhibiting viral replication. It can also act as a pattern recognition receptor to promote type I interferon secretion and protect the host from viral infection. TRIM5 can act as a selective autophagy receptor to recognize and target HIV-1 capsid protein p24 for autophagic destruction. Previous studies have mainly focused on the role of antiviral immune response, and research on cancer is relatively lacking. Summary of the invention

[0003] The present invention uses TRIM5 as a target, and analyzes the expression spectrum, clinical significance, prognostic value and immune infiltration correlation of TRIM5 in pan-cancer through network big data. The results show that TRIM5 is significantly upregulated in various tumors such as GBM (glioma multiforme), KIPAN (mixed renal carcinoma), PAAD (pancreatic cancer); it is highly expressed in PAAD (pancreatic cancer), STAD (gastric cancer), LGG (low-grade glioma of the brain), LAML (acute myeloid leukemia), LUSC (lung squamous cell carcinoma), GBMLGG (glioma) and LIHC (liver cancer) and is significantly associated with the poor prognosis of patients. In addition, the expression level of TRIM5 in PAAD (pancreatic cancer), STAD (gastric cancer), LGG (low-grade glioma of the brain) and GBMLGG (glioma) increases with the increase of tumor malignancy.

[0004] Thus, the present invention discloses the use of TRIM5 as a prognostic marker for pancreatic cancer, gastric cancer, brain low-grade glioma, acute myeloid leukemia, lung squamous cell carcinoma, glioma and liver cancer, and its use in preparing the above-mentioned tumor prognosis detection kit.

[0005] The invention further discloses the use of TRIM5 as a tumor grading marker for pancreatic cancer, gastric cancer, or low-grade glioma of the brain or glioma; and its use in preparing the above-mentioned tumor grading detection kit.

[0006] The kit includes substances for qualitative and quantitative detection of TRIM5.

[0007] The detection method for the use is to perform qualitative and quantitative detection of TRIM5 expression in the patient's blood or tumor tissue.

[0008] Compared with the prior art, the present invention uses TRIM5 as a target to analyze the correlation of TRIM5 in multiple dimensions such as expression spectrum, clinical significance, prognostic value and immune infiltration through network big data, and verifies through in vitro experiments that TRIM5 has high feasibility and accuracy as a prognosis and grading marker for pancreatic cancer, gastric cancer, low-grade glioma of the brain, acute myeloid leukemia, squamous cell carcinoma of the lung, glioma and liver cancer, providing a new approach for effectively and accurately predicting the treatment response and disease progression of related tumor patients, realizing personalized treatment plans, and developing new treatment strategies. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] Figure 1 This is a graphic representation of the expression of TRIM5 in pan-cancer and its relationship with tumor grade.

[0010] Figure 2 This is a forest analysis diagram of TRIM5 expression and survival risk of cancer patients.

[0011] Figure 3 This is the Kaplan-Meier survival curve of TRIM5 associated with OS in different cancers.

[0012] Figure 4 The Kaplan-Meier survival curves of TRIM5 associated with DFS in different cancer types are shown in Figure 2.

[0013] Figure 5 This is a correlation analysis chart between TRIM5 expression and immune infiltration.

[0014] Figure 6 This is a correlation analysis chart between TRIM5 expression and immune regulatory genes.

[0015] Figure 7 is a graphic representation of the relationship between TRIM5 expression and genomic heterogeneity.

[0016] Figure 8 This is a graphic representation of the experimental analysis results of TRIM5 as a prognostic marker for pancreatic cancer.

[0017] Fig. 9 This is a graphic representation of the results related to TRIM5 and pancreatic cancer proliferation and migration.

[0018] Note: Some figures include multiple sub-figures numbered with English letters. DETAILED DESCRIPTION

[0019] The present invention will be further described below in conjunction with specific implementation modes.

[0020] This paper uses TCGA, TARGET and GTEx database resources to perform pan-cancer analysis of TRIM5, evaluates the expression spectrum, clinical pathological characteristics correlation and prognostic value of TRIM5 in pan-cancer, and deeply explores the relationship between TRIM5 and tumor immunity; through gene enrichment analysis, the potential biological function and molecular mechanism of TRIM5 are clarified, and then verified by in vitro experiments, the clinical value of TRIM5 as a tumor treatment target and prognostic biomarker is explored. The specific method is:

[0021] 1. Materials and Methods

[0022] 1.1 Pan-cancer expression data collection

[0023] The mRNA sequencing data of tumor tissues and corresponding normal tissues from TCGA, TARGET and GTEx databases were downloaded and batch processed and log2(x+0.001) transformed to obtain TRIM5 mRNA sequencing data of 34 different types of tumor tissues and corresponding normal tissues as well as clinical related data (including survival status, clinical pathological characteristics, etc.).

[0024] 1.2 Analysis of TRIM5 expression differences and clinical relevance

[0025] The Wilcoxon rank sum test was used to analyze the differential expression of TRIM5 in 34 tumor cells using the "limma" package in R software. Clinical information data were extracted, and the "ggpubr" package in R software was used to perform correlation analysis of clinical pathological characteristics.

[0026] 1.3 Correlation analysis between TRIM5 expression and prognosis of pan-cancer patients

[0027] Incomplete survival information and survival status samples were removed from pan-cancer expression data and clinical information to obtain high-quality prognostic expression data. The R software package survival was used to establish a Cox hazard proportional regression model and draw the Kaplan-Meier curve of patients. The Log-rank test was used for statistical testing to obtain prognostic significance. The prognostic value of TRIM5 in different cancer types was evaluated using two clinical models: Overall survival (OS) and disease-free survival (DFS).

[0028] 1.4 Correlation analysis between TRIM5 expression and pan-cancer tumor immune cell infiltration

[0029] The R package "ESTIMATE" was used to calculate the StromalScore, ImmuneScore, and ESTIMATEScore of 10,180 tumor samples in 44 tumor types. Combined with the collated gene expression data, the infiltration scores of immune cells such as B cells, T cells, and macrophages were calculated for each patient in each tumor using the R package "IOBR" and the "deconvo_epic" algorithm. The Pearson correlation between TRIM5 expression and immune infiltration scores in tumors was then evaluated using the corr.test function of the R package psych. Finally, the R package "limma" was used to evaluate the Pearson correlation between TRIM5 and marker genes of five immune pathways (chemokine, receptor, MHC, Immunoinhibitor, and Immunostimulator).

[0030] 1.5 Correlation analysis between TRIM5 expression and genomic heterogeneity

[0031] The tumor mutation burden (TMB), microsatellite instability (MSI), homologous recombination deficiency (HRD), and neoantigen (NEO) of each tumor sample were calculated using the tmb function of the R package “maftools”, and the correlation between TRIM5 expression and genomic heterogeneity was analyzed using Pearson correlation.

[0032] 1.6 Analysis of TRIM5 protein expression in pancreatic cancer

[0033] The expression map of TRIM5 protein in pancreas was retrieved from the human protein atlas (HPA) database (https: / / www.proteinatlas.org), and the immunohistochemical comparison map of pancreatic cancer tissue and normal pancreatic tissue was obtained.

[0034] 1.7 Functional enrichment analysis of TRIM5 in pancreatic cancer

[0035] The GEPIA online database (http: / / gepia.cancer-pku.cn / ) was searched to obtain genes related to TRIM5. Gene ontology (GO) functional annotation and Kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment analysis were performed on TRIM5-related genes using R language limma, org.Hs.eg.db, cluster Profiler and enrichplot packages.

[0036] 1.8 Tumor cell culture, cell transfection and real-time fluorescence quantitative PCR

[0037] PANC-1 pancreatic cancer cells were placed in a humidified incubator at 37°C and 5% CO2, and cultured in DMEM containing 15% FBS and 1% double antibodies (streptomycin and penicillin). The cells were seeded in a 6-well plate, and when the cells reached an appropriate density, Lipofectamine was used. TMThe PANC-1 cells were transfected with the 3000 kit, and the sequence was shown in the sequence listing SEQ ID NO: 1 (siTRIM5: 5′GCUCAGGGAGGUCAAGUUGdTdT3′), which was designed and synthesized by Guangzhou Aiki Biotechnology Co., Ltd. 48 h after transfection, total cell RNA was extracted using an RNA extraction kit (RC112-01), and the purified RNA was reverse transcribed into a cDNA template using a reverse transcription kit (R323-01). Real-time fluorescence quantitative PCR was performed using a fluorescence quantitative PCR kit (11141ES10) (mRNA primers were designed and synthesized by Guangzhou Aiki Biotechnology Co., Ltd., the TRIM5 primer sequence is as shown in SEQ ID NO: 2 in the forward direction (5′CTGGAGATGCTGAGGCAGAAGC3′), and as shown in SEQ ID NO: 3 in the reverse direction (5′GTCCAGGATGTCTCTCAGTTGC3′), the GAPDH primer sequence is as shown in SEQ ID NO: 4 in the forward direction (5′GTCTCCTCTGACTTCAACAGCG3′), and as shown in SEQ ID NO: 5 in the reverse direction (5′ACCACCCTGTTGCTGTAGCCAA3′), the mRNA expression level of TRIM5 was calculated and analyzed by the 2-ΔΔCt method.

[0038] 1.9 Cell proliferation and scratch assay

[0039] Cell proliferation experiment: The transfected PANC-1 cells were digested and resuspended in complete culture medium by centrifugation, and then seeded in a 96-well plate at about 6,000 cells / well. After culturing for 24 hours, 10% CCK-8 (cell counting kit-8) reagent (purchased from APEx BIO) was added and cultured for 1.5 hours. After the culture was completed, the absorbance at 450 nm was measured using a microplate reader.

[0040] Cell scratch test: The transfected PANC-1 cells were digested, centrifuged and resuspended, and inoculated into a 6-well plate (about 500,000 cells / well). After the cells were fully grown, scratches were made with a sterile 200μl pipette tip, and the count was 0h, and the cells were marked. After washing the scratched cells with sterile PBS, the migration of cells was observed and photographed at 0h and 24h, and the cell migration rate was analyzed using ImageJ software.

[0041] 2. Results

[0042] 2.1 Analysis of TRIM5 expression differences in pan-cancer and correlation with tumor grade

[0043] Based on the TCGA and GTEx databases, the expression differences of TRIM5 between tumor tissues and corresponding normal tissues were analyzed, and the expression data of 34 cancer types were obtained. The results are as follows Figure 1 As shown in sub-figures A and B, the expression of TRIM5 in 27 malignant tumors was significantly different from that in normal tissues (p < 0.05). Among them, TRIM5 expression showed a down-regulated trend in 11 malignant tumors, including BRCA (invasive breast cancer), CESC (cervical squamous cell carcinoma and adenocarcinoma), LUAD (lung adenocarcinoma), PRAD (prostate cancer), LUSC (lung squamous cell carcinoma), TH CA (thyroid cancer), OV (ovarian serous cystadenocarcinoma), UCS (uterine sarcoma), PCPG (pheochromocytoma and paraganglioma), ACC (adrenal cortical carcinoma), and KICH (renal chromophobe cell carcinoma). It is upregulated in another 16 malignant tumors, including GBM (glioblastoma multiforme), GBMLGG (glioma), LGG (low-grade glioma of the brain), ESCA (esophageal cancer), STES (gastric and esophageal cancer), KIPAN (mixed renal cancer), COAD (colon cancer), COADREAD (colorectal cancer), STAD (gastric cancer), HNSC (head and neck squamous cell carcinoma), KIRC (renal clear cell carcinoma), PAAD (pancreatic cancer), TGCT (testicular cancer), ALL (leukemia), LAML (acute myeloid leukemia), and CHOL (cholangiocarcinoma).

[0044] The correlation analysis between TRIM5 levels and clinical pathological characteristics of tumor patients was performed based on TCGA and GETx databases. The expression levels of TRIM5 in different WHO grades (G1, G2, G3 and G4) were analyzed. Figure 1 As shown in sub-figure C, it was found that the increased expression of TRIM5 was significantly correlated with the tumor grade of certain cancers. In the tumor tissues of STAD, PAAD, GBMLGG, and LGG, the expression level of TRIM5 was significantly upregulated as the malignancy of the tumor increased. However, in KIPAN and KIRC, its expression level showed a downward trend as the tumor progressed.

[0045] TRIM5 expression is associated with pan-cancer patient prognosis

[0046] The correlation between TRIM5 expression level and prognosis of tumor patients was analyzed by univariate Cox regression analysis. Figure 2 As shown in Figure 2, TRIM5 is associated with the prognosis of patients with various tumors, such as GBMLGG, LGG, LAML, LUSC, LIHC, PAAD, KIRC, SKCM (melanoma), SKCM-M, MESO (mesothelioma), READ (rectal adenocarcinoma), OV, COAD, and PCPG. The Kaplan-Meier curve results are shown in Figure 2. Figure 3 and Figure 4As shown, high expression of TRIM5 is a risk factor for overall survival (OS) in patients with GBMLGG, LGG, LAML, LUSC, LIHC (hepatocellular carcinoma) and PAAD, and a protective factor for OS in patients with KIRC, SKCM, SKCM-M, MESO, READ and OV. High expression of TRIM5 is a risk factor for disease-free survival (DFS) in patients with COAD, PAAD and PCPG.

[0047] TRIM5 expression is closely associated with pan-cancer tumor immune cell infiltration

[0048] The relationship between TRIM5 and pan-cancer immune infiltration levels was analyzed. First, the R software package ESTIMATE was used to obtain the ImmuneScore, StromalScore, and ESTIMATEScore of each patient in each tumor based on TRIM5 expression, and then the correlation between TRIM5 expression and immune infiltration score in tumors was evaluated. The results are shown in Figure 2. Figure 5 As shown. ImmuneScore displays (as Figure 5 As shown in Figure A), TRIM5 expression was positively correlated with immune infiltration in 21 cancer types, among which the three with the highest correlation coefficients were GBMLGG, LGG, and NB (neuroblastoma); and negatively correlated with immune infiltration in LAML, SARC (sarcoma), KIRP (renal papillary cell carcinoma), WT (Nephroblastoma), and THCA. StromalScore shows (as shown in Figure A). Figure 5 As shown in sub-figure B), TRIM5 expression was significantly correlated with stromal cells in 23 cancer types, of which 22 were significantly positively correlated, and the three with the highest correlation coefficients were GBMLGG, KIPAN, and PCPG. Figure 5 (As shown in Figure C), TRIM5 expression was significantly correlated with the immune microenvironment in 27 cancer types, of which 22 were significantly positively correlated, and the three with the highest correlation coefficients were GBMLGG, KIPAN and LGG; 5 were significantly negatively correlated, including LAML, SARC, KIRP, WT and THCA, indicating that TRIM5 is involved in the regulation of the tumor immune microenvironment in the above-mentioned malignant tumors.

[0049] 2.4 TRIM5 interacts with immune cells

[0050] To further clarify the relationship between TRIM5 and immune cells in the tumor microenvironment, this example used the deconvo_epic method of the R software package IOBR to re-evaluate the infiltration scores of B cells, cancer-associated fibroblasts (CAFs), CD4+T cells, CD8+T cells, endothelial cells, macrophages, NK cells, and other cells in each patient in each tumor based on gene expression. Based on the immune infiltration analysis, the corr.test function of the R software package psych was used to evaluate the correlation between TRIM5 expression and the above 8 immune cell infiltration scores. The results are shown in Figure 2. Figure 5 As shown in Figure D, RIM5 expression was positively correlated with the infiltration of various immune cells. TRIM5 expression was significantly positively correlated with the content of T cells in UVM (uveal melanoma), KICH, PRAD, and NB. TRIM5 expression was significantly positively correlated with the content of CAFs in PAAD, TGCT, and READ, and was significantly positively correlated with the level of macrophage infiltration in PCPG, NB, LGG, COAD, COADREAD, and GBMLGG.

[0051] 2.5TRIM5 is associated with immune regulatory genes

[0052] The above studies suggest that TRIM5 expression is involved in the infiltration of immune cells in the tumor microenvironment. Further analysis of the potential correlation between TRIM5 expression and chemokine genes, chemokine receptor genes, major histocompatibility complex (MHC) genes, and immune checkpoint pathway genes in pan-cancer revealed the following results: Figure 6 As shown. TRIM5 has a significant correlation with pan-cancer immune regulatory genes, and most of them are positively correlated. For example, in malignant tumors such as NB, PAAD, UVM, PCPG, READ, COAD, COADREAD, OV, KICH, KIPAN, KIRC, and GBM, the overall correlation is positive. Among them, the expression level of TRIM5 is positively correlated with most MHC genes and chemokine receptor genes in the six malignant tumors of NB, PAAD, KIPAN, KIRC, OV, and BRAC. In ACC, MESO, LAML, SARC, TGCT, and THYM (thymic carcinoma) tumors, the expression level of TRIM5 is only positively correlated with a few immune regulatory genes, such as CCR4 and CCR9 in chemokine receptor genes and B2M, TAP1, and TAP2 in MHC genes.

[0053] 2.6 TRIM5 is associated with tumor genome heterogeneity

[0054] Intratumor Heterogeneity (ITH) affects tumor growth and development, and may change the immune microenvironment and promote immune escape. The correlation analysis between TRIM5 and tumor heterogeneity, including MSI, HRD, NEO and TMB analysis, showed that Figure 7 As shown. The MSI analysis results show (as Figure 7 Sub-figure A), the expression level of TRIM5 is correlated with microsatellite instability in 6 types of tumors, of which it is significantly positively correlated in 2 types of tumors, such as COAD and COADREAD (p<0.05), and significantly negatively correlated in 4 types of tumors, such as GBMLGG, KIPAN, PRAD, and DLBC (diffuse large B-cell lymphoma) (p<0.05). HRD level is an important indicator for guiding tumor treatment and prognosis. Clinical research results show that HRD-positive tumor patients are highly sensitive to platinum chemotherapy drugs and poly(ADP-ribose) polymerase inhibitors. The results of the correlation analysis between TRIM5 and HRD show (such as Figure 7 In the sub-figure B), TRIM5 was significantly correlated with HRD in 18 tumors, and was significantly positively correlated with THCA and PAAD (p<0.05), and was significantly negatively correlated with LUAD, COADREAD, BRCA, LUSC, etc. (p<0.05) in 16 tumors. Tumor neoantigens are generated by non-synonymous mutations and are potential targets for tumor immunotherapy. The analysis results of the effect of TRIM5 on NEO showed (e.g. Figure 7 Sub-figure C), TRIM5 was significantly positively correlated with NEO in COAD and COADREAD (p<0.05). TMB is highly correlated with the efficacy of PD-1 / PD-L1 inhibitors in patients, and TMB can be used to predict the efficacy of immunotherapy to a certain extent. The results of the analysis of the effect of TRIM5 on TMB showed (e.g. Figure 7 Subfigure D) shows that TRIM5 was significantly correlated with TMB in 6 tumor types, among which it was significantly positively correlated in COAD, COADREAD, BRCA and KIPAN (p<0.05), and significantly negatively correlated with LUAD and PRAD (p<0.05).

[0055] 2.7 TRIM5 can be used as a prognostic marker for pancreatic cancer

[0056] The above study found that TRIM5 expression was significantly upregulated in pancreatic cancer. Survival analysis showed that TRIM5 expression level was closely related to OS (p = 0.001) and DFS (p = 0.01) of pancreatic patients. In patients with high TRIM5 expression, the total survival period and disease-free survival period were significantly shortened, and TRIM5 expression was positively correlated with the tumor grade of the patient. In order to further explore the feasibility of TRIM5 as a prognostic marker for pancreatic cancer, this example further studied the possible biological function and mechanism of TRIM5 in pancreatic cancer. The results are as follows: Figure 8 The correlation between TRIM5 expression and clinical stage was analyzed, and the results showed that the expression level of TRIM5 in patients with advanced pancreatic cancer was higher than that in patients with early stage (such as Figure 8 The expression of TRIM5 protein in the pancreas was obtained from the human protein atlas (HPA) database. Immunohistochemistry results showed that TRIM5 was significantly upregulated in pancreatic cancer tissues (see Figure 2). Figure 8 The differential gene analysis was performed on the TRIM5 high expression and low expression groups, and the GO and KEGG pathway enrichment analysis was performed on the differential genes (the results are shown in Figure 8 GO functional enrichment analysis showed that TRIM5 was significantly associated with cell adhesion, cytoplasm, cadherin binding and other pathways. KEGG signaling pathway enrichment analysis showed that TRIM5 was significantly associated with cancer-related signaling pathways, focal adhesion, proteoglycans in cancer, and human papillomavirus infection-related signaling pathways.

[0057] 2.8 TRIM5 is associated with pancreatic cancer proliferation and migration

[0058] In order to verify the effect of TRIM5 on the proliferation and migration of pancreatic cancer cells, this example selected PANC-1 cells with high TRIM5 expression for subsequent experiments. Fig. 9 As shown. TRIM5-siRNA was transfected into PANC-1 cells, and then the transfection efficiency was verified by Q-PCR. The knockdown efficiency of TRIM5-siRNA reached about 66.8% (as shown Fig. 9 The CCK8 experiment showed that downregulation of the TRIM5 gene reduced the proliferation ability of PANC-1 cells (as shown in sub-figure A). Fig. 9 The cell scratch results showed that when TRIM5 expression was downregulated in PANC-1, the migration ability of tumor cells was weakened (as shown in sub-figure B). Fig. 9 (as shown in sub-figures C and D of FIG).

[0059] The above research results show that TRIM5 is abnormally expressed in a variety of tumor tissues, and its expression is closely related to patient prognosis, clinical pathological characteristics, tumor immune infiltration, genomic heterogeneity, etc. The above results suggest that TRIM5 will be a new and promising tumor treatment target and prognostic biomarker. The present invention also preliminarily verified through in vitro experiments that knocking down the TRIM5 gene can significantly reduce the proliferation and migration ability of pancreatic cancer PANC-1 cells, further verifying the feasibility and accuracy of TRIM5 as a prognostic biomarker for pancreatic cancer.

Claims

1. Use of TRIM5 as a prognostic marker for pancreatic cancer, gastric cancer, brain low-grade glioma, acute myeloid leukemia, lung squamous cell carcinoma, glioma or liver cancer.

2. Use of TRIM5 as a tumor grading marker for pancreatic cancer, gastric cancer, or brain low-grade glioma or glioma.

3. Use of TRIM5 in the preparation of a prognosis detection kit for pancreatic cancer, gastric cancer, brain low-grade glioma, acute myeloid leukemia, lung squamous cell carcinoma, glioma or liver cancer.

4. Use of TRIM5 in the preparation of a tumor grading detection kit for pancreatic cancer, gastric cancer, or low-grade glioma of the brain or glioma.

5. The use according to claim 3 or 4, characterized in that: The kit includes substances for qualitative and quantitative detection of TRIM5.

6. The use according to claim 3 or 4, characterized in that: The detection method for the use is to perform qualitative and quantitative detection of TRIM5 expression in the patient's blood or tumor tissue.

Images