Preparation method and application of adult leaf beetles containing single bacteria

Abstract

The invention belongs to the technical field of biology, and discloses a single-bacterium-containing adult leaf beetle preparation method which comprises the following steps: 1, obtaining sterile leaf beetles: collecting fertilized eggs of the leaf beetles, and soaking, sterilizing and disinfecting; then leaching, airing, transferring into a container with sterile tissue culture plants, and sealing by using a sterile breathable sealing film; placing the container with the sterile tissue culture plant in an artificial climate chamber, and feeding with the sterile tissue culture plant after hatching; 2, obtaining of single mycorticotyledon beetles: selecting proper single bacteria, and culturing to a logarithmic phase; feeding the sterile leaf beetles with the tissue culture plants coated with the single bacteria; then putting the insect into a sterile culture dish, carrying out subsequent feeding by using a sterile tissue culture plant, observing and recording the development condition of the insect, and keeping a sterile environment in the experiment process. According to the invention, a stable model animal material which is not interfered by artificial compound feed is provided for researching the influence of specific intestinal microorganisms on the growth and development of insects, and leaf beetle adults meeting research requirements are obtained.

Description

Technical Field

[0001] The present application relates to a method for preparing leaf beetle adults containing only a single microorganism in their bodies and application thereof, and belongs to the field of biotechnology. Background Art

[0002] Insects are an important part of the ecological chain, and their species are rich and diverse. Insects in nature are inhabited by a large number of microorganisms, which have formed a mutually dependent symbiotic relationship with their host insects in the long-term co-evolution process. The intestinal flora plays an important role in many physiological functions of insects, such as nutrition, metabolism, immunity and reproduction.

[0003] In order to study and explore the molecular biological mechanism of the interaction between insects and their intestinal flora, it is first necessary to establish an animal model to obtain insects with sterile intestines, and then carry out other studies on this basis. Therefore, it is particularly important to obtain insects with sterile intestines that can grow and develop stably. At present, the methods for obtaining insects with sterile intestines include: antibiotic treatment, sterile artificial compound feed, etc. However, the method of feeding antibiotics to remove insect intestinal flora cannot completely remove insect intestinal flora due to the limitations of the efficacy of antibiotics themselves and the influence of insect intestinal environmental factors. In addition, antibiotics also have a certain effect on the insects themselves and it is impossible to return bacteria to verify the experimental phenotype. Although the production process of sterile artificial compound feed has low requirements for environmental sterility, the physical structure of the food is irreversibly changed due to crushing, mixing, sterilization, etc., and some nutrients are lost. Since the growth period of insect larvae is short, the impact of using sterile artificial compound feed is small or too late to appear, but the growth period of adults is longer. Feeding insects with sterile artificial compound feed changes the insect food and the living habitat provided by the host plant to the insect, which will affect the establishment of the sterile insect adult model. Summary of the invention

[0004] The purpose of the present invention is to solve the above-mentioned deficiencies in the prior art and to propose a method for preparing leaf beetle adults containing a single bacterium, so as to provide a stable model animal material that is not interfered by artificially formulated feed for studying the effects of specific intestinal microorganisms on insect growth and development.

[0005] The present invention provides a method for preparing leaf beetle adults containing a single bacterium, comprising:

[0006] The sterile fertilized eggs are collected, transferred into a container with sterile tissue culture plants, and sealed with a sterile breathable sealing film. The above operations are all performed in a sterile environment; the container with the sterile tissue culture plants is placed in an artificial climate chamber, and the conditions of the artificial climate are: temperature of 22-26° C.; humidity of 60-85%; light time / dark time=(14-18) h / (6-10) h, and the air in the climate chamber is kept clean. After the eggs are hatched, the intestinal sterile leaf beetle larvae are obtained; a single type of bacteria is selected and cultured to the logarithmic growth phase, and the target concentration is determined according to the actual carrying capacity of the single type of bacteria in the leaf beetle in the natural environment;

[0007] A certain amount of sterile larvae obtained in the previous step are collected; before feeding, a suspension containing the single type of bacteria is applied to sterile tissue culture plant leaves, and then the sterile larvae are fed with the tissue culture plant leaves; the leaf beetles obtained in the previous step are placed in a sterile culture dish and subsequently raised with sterile tissue culture plants to obtain leaf beetle adults containing a single type of bacteria.

[0008] Furthermore, the steps for obtaining the sterile tissue culture plants are as follows: taking plant callus tissue for rapid propagation through tissue culture, and when the plant seedlings grow to 2 / 3 of the height of the culture bottle, placing the culture bottle in a sterile clean bench; sterilizing scissors and tweezers at high temperature, cooling to room temperature, using the scissors to cut off the buds with 1-2 stem segments of the plant seedlings in the culture bottle, and then using the tweezers to place them in a new rooting medium, and when the buds grow to 2 / 3 of the height of the culture bottle, repeating this step to obtain batches of sterile tissue culture plants.

[0009] Further, the obtained leaf beetles are tested for bacteria using a dilution plate method and / or a PCR amplification-gel electrophoresis method, wherein

[0010] The dilution plate assay involves the following steps:

[0011] T1. Randomly select 10 leaf beetle eggs obtained by sterile culture and conventional culture, 3 1st, 2nd and 3rd instar larvae and 1 adult; T2. Collect the eggs into a 2 mL grinding tube in a clean bench, and dissect the larval and adult intestines with sterile scissors and forceps under a stereo microscope, and collect the obtained intestinal tissues into a 2 mL grinding tube; T3. Add 100 μL of sterile phosphate buffered saline (PBS) and 3 sterilized steel beads to a 2 mL grinding tube (Axygen, USA), and grind the tissue into a homogenate using a grinder (Jingxin, China); T4. Dilute 100 μL of the homogenate by 10 -4 Add to LB agar medium and spread evenly using a sterile spreader stick; T5. Place the culture dish in a 37°C incubator for 24 hours, observe the bacterial growth and count;

[0012] The PCR amplification-gel electrophoresis detection steps include:

[0013] The total DNA of leaf beetle eggs, larvae of different instars and adults obtained from sterile culture and conventional culture were extracted respectively, and the DNA was amplified by PCR using primers 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (TACGGYTACCTTGTTACGACTT) in the highly conserved region of the 16S rRNA gene, and gel electrophoresis was performed to test the sterile state of the larvae.

[0014] Furthermore, the step of obtaining sterile eggs comprises:

[0015] Select male and female adults in good growth condition to pair up, collect fertilized eggs after mating and laying eggs; soak the collected eggs in 75% ethanol for 5-8 minutes for sterilization and disinfection to fully remove microorganisms on the surface of the eggs; rinse the eggs soaked in disinfectant with sterile pure water to wash away the disinfectant that may remain on the surface of the eggs, then use sterile filter paper to absorb the water from the rinsed eggs and dry them to obtain sterile fertilized eggs for use.

[0016] Furthermore, the sterile tissue culture plants include poplar tissue culture seedlings and poplar tissue culture leaves. The culture medium of the poplar tissue culture seedlings is: MS+0.1 mg / L NAA, and the culture conditions of the poplar tissue culture seedlings are: temperature 25°C, photoperiod 16:8h (light:darkness).

[0017] Furthermore, the number of bacteria in the suspension of a single type of bacteria is determined based on the actual bacterial load in the first-instar larvae of leaf beetles in a natural environment.

[0018] The present invention also provides the use of the sterile tissue culture plants obtained by the method for preparing the leaf beetle adults containing a single bacterium as feed in obtaining sterile leaf beetle adults and single bacterium leaf beetle adults.

[0019] The invention also provides application of the single-bacteria-containing leaf beetle obtained by the method for preparing the single-bacteria-containing leaf beetle adult in research on the influence of microorganisms on the growth and development of insects.

[0020] The present invention also provides application of the single-bacteria-containing leaf beetle adults obtained by the single-bacteria-containing leaf beetle adults preparation method in the prevention and control of agricultural and forestry plant pests.

[0021] The invention also provides application of the monomycete-containing leaf beetle tissue obtained by the method for preparing the monomycete-containing leaf beetle adult in the research of symbiotic insects.

[0022] Compared with the prior art, the beneficial effects of the present invention are as follows: sterile plants obtained by plant tissue culture technology are used to feed leaf beetle larvae hatched from sterile eggs, thereby obtaining sterile larvae, and the microorganisms in their intestines can also be completely eliminated by this method. The sterile plants obtained by tissue culture technology have the advantage of artificially obtaining a large number of sterile host plants by continuously feeding the larvae with sterile tissue culture plants, and there is no change in food type when insects feed on the tissue culture seedlings of the original host plants, which causes symptoms of maladaptation and abnormal development; the normal development, pupation and emergence of insects are ensured. Based on the prepared sterile insects, a single known microorganism can be easily introduced into the body of the sterile leaf beetle in the future, so that the added microorganism can be colonized in the sterile insects, providing a stable and excellent model organism for studying the symbiotic relationship between intestinal microorganisms and insects.

[0023] The intestinal sterile insects prepared by the present invention can be conveniently inoculated with known bacteria, and are used as a good insect animal model in the research of insect intestinal microorganisms. The sterile larvae or the larvae added with known microorganisms are fed with tissue culture plants. Compared with sterile artificial compound feeds, the food structure is not changed, and the tissue culture plants provide a growth condition that is highly close to the insect's wild living environment. The tissue culture fresh leaf plants provide a three-dimensional living environment for the insects. The habits of the insects are consistent with those of the natural environment, ensuring that the food structure of the growth and development process from larvae to adults is basically the same as that of the natural environment, avoiding the potential influence of sterile artificial compound feeds on the development of adults, reducing the errors caused by feed reasons when subsequently adding known microorganisms to conduct various studies on adults, and improving the accuracy of research data. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The growth of the colonies of the eggs of conventional culture (CR) and sterile culture (GF) and the intestinal homogenates of the larvae of different instars and adults of the blue leaf beetle on LB medium;

[0025] Figure 2 The growth of colonies of the intestinal homogenate of larvae and adults of the blue leaf beetle in sterile culture (GF) and inoculated with bacteria Rosenbergiella nectarea (RE-R.nectarea) on LB medium;

[0026] Figure 3 The PCR gel electrophoresis test images of the eggs of conventional culture (CR), sterile culture eggs (GF) and the intestinal homogenate of the larvae and adults of the willow blue leaf beetle at various ages;

[0027] Figure 4 The PCR gel electrophoresis test of the intestinal homogenate of the larvae and adults of each instar of the blue leaf beetle, which was cultured aseptically (GF) and inoculated with bacteria R. nectarea.

[0028] Figure 5This is a statistical chart showing the effects of inoculated bacteria on the growth and development of the willow blue leaf beetle in the single bacteria inoculation model study.

[0029] Among them: egg--egg; 1st instar larva--1st instar larva; 2nd instar larva--2nd instar larva; 3rd instar larva--3rd instar larva; adult--adult. DETAILED DESCRIPTION

[0030] The technical solutions in the embodiments of the present invention will be described clearly and completely below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments.

[0031] The method for preparing leaf beetle adults containing a single bacterium provided in this embodiment includes culturing sterile tissue culture plants, obtaining sterile leaf beetles, and obtaining leaf beetles containing a single bacterium.

[0032] The steps for obtaining sterile tissue culture plants are as follows: taking plant callus tissue for rapid propagation through tissue culture, and when the plant seedlings grow to 2 / 3 of the height of the culture bottle, placing the culture bottle in a sterile clean bench; sterilizing scissors and tweezers at high temperature, cooling to room temperature, using scissors to cut off the buds with 1-2 stem segments of the plant seedlings in the culture bottle, and then using tweezers to place them in a new rooting medium, and when the buds grow to 2 / 3 of the height of the culture bottle, repeating this step to obtain batches of sterile tissue culture plants as feed for leaf beetles.

[0033] The sterile leaf beetles are obtained by hatching and raising sterile eggs under sterile conditions. The steps for obtaining sterile eggs include: selecting male and female adults in good growth conditions to pair up, collecting fertilized eggs after mating and laying eggs; soaking the collected eggs in 75% ethanol for 5-8 minutes for sterilization and disinfection to fully remove microorganisms on the surface of the eggs; rinsing the eggs soaked in disinfectant with sterile pure water to clean the disinfectant that may remain on the surface of the eggs, and then using sterile filter paper to absorb the water from the rinsed eggs and dry them to obtain sterile fertilized eggs for use.

[0034] The sterile fertilized eggs are collected and transferred into a container with sterile tissue culture plants, which is sealed with a sterile breathable sealing film. The above operations are all performed in a sterile environment; the container with the sterile tissue culture plants is placed in an artificial climate chamber, and the conditions of the artificial climate are: temperature is 22-26° C.; humidity is 60-85%; light exposure time / dark time=(14-18) h / (6-10) h, and the air in the climate chamber is kept clean. After the eggs are hatched, intestinal sterile leaf beetle larvae are obtained, and sterile leaf beetle adults are obtained by continuing to feed with the sterile tissue culture plants.

[0035] In order to verify whether the leaf beetles obtained by this method are sterile, the obtained leaf beetles are tested for bacteria using the dilution plate method and / or PCR amplification-gel electrophoresis method, wherein

[0036] The dilution plate assay involves the following steps:

[0037] T1. Randomly select 10 leaf beetle eggs obtained by sterile culture and conventional culture, 3 1st, 2nd and 3rd instar larvae and 1 adult; T2. Collect the eggs into a 2 mL grinding tube in a clean bench, and dissect the larval and adult intestines with sterile scissors and forceps under a stereo microscope, and collect the obtained intestinal tissues into a 2 mL grinding tube; T3. Add 100 μL of sterile phosphate buffered saline (PBS) and 3 sterilized steel beads to a 2 mL grinding tube (Axygen, USA), and grind the tissue into a homogenate using a grinder (Jingxin, China); T4. Dilute 100 μL of the homogenate by 10 -4 Add to LB agar medium and spread evenly using a sterile spreader stick; T5. Place the culture dish in a 37°C incubator for 24 hours, observe the bacterial growth and count.

[0038] The PCR amplification-gel electrophoresis detection steps include:

[0039] The total DNA of leaf beetle eggs, larvae of different instars and adults obtained by sterile culture and conventional culture were extracted respectively, and the DNA was amplified by PCR using primers 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (TACGGYTACCTTGTTACGACTT) in the highly conserved region of the 16S rRNA gene, followed by Southern blot gel electrophoresis to test the sterile state of the larvae.

[0040] Sterile tissue culture plants can be selected from poplar tissue culture seedlings and poplar tissue culture leaves. The culture medium of the poplar tissue culture seedlings is: MS+0.1 mg / L NAA, and the culture conditions of the poplar tissue culture seedlings are: temperature 25°C, photoperiod 16:8h (light:darkness).

[0041] Obtaining leaf beetles containing a single bacterium: select a single type of bacteria and culture it to the logarithmic growth phase. The target concentration is determined according to the actual bacterial load of the single type in the leaf beetle in the natural environment; collect a certain amount of sterile larvae obtained in the previous step; before feeding, apply a certain amount of suspension containing a single type of bacteria to sterile tissue culture plant leaves (the number of bacteria in the suspension is determined according to the actual bacterial load of the first-instar larvae of the leaf beetle in the natural environment); then feed the sterile larvae with the leaves of the tissue culture plant; place the leaf beetle larvae obtained in the previous step in a sterile culture dish and use sterile tissue culture plants for subsequent feeding to obtain leaf beetle adults containing a single type of bacteria. The single type of bacteria can be selected from Rosenbergiella nectarea, Enterobacter ludwigii, Pantoea anthophila, etc.

[0042] This embodiment takes the sterile willow blue leaf beetle inoculated with bacteria Rosenbergiella nectarea (R. nectare) as an example to specifically illustrate the content of the present invention. The willow blue leaf beetles used in the experiment were all from the willow trees in Shahu Park, Wuchang District, Wuhan City. The willow blue leaf beetles at different life stages were brought back to the laboratory, and a perforated disposable lunch box was prepared as a feeding box. Wet absorbent paper was laid in the box, and eggs, larvae, adults and pupae were placed in the box respectively, and placed in an insect breeding room with a temperature of 27±1°C and a relative humidity of 70±5%. The photoperiod was set to 16:8h (light: dark), and fresh willow branches were collected in Shahu for feeding. The eaten willow leaves were replaced every day to avoid fungal infection. Egg masses were collected and placed in new feeding boxes every day, and the egg-laying date was recorded.

[0043] During the experiment, the larvae of the blue leaf beetle were fed with sterile poplar seedlings in vitro. Poplar tissue culture seedlings were propagated regularly. When the poplar seedlings grew to 2 / 3 of the height of the culture bottle, the culture bottle was placed in a sterile clean bench, and the scissors and tweezers were sterilized at high temperature and placed at room temperature. After cooling to room temperature, the buds with 1-2 stem segments of the poplar seedlings in the culture bottle were cut with scissors, and then placed in a new rooting medium with tweezers. After about 1 month, when they grew to 2 / 3 of the height of the culture bottle again, the above operation was repeated. The culture medium formula of sterile poplar tissue culture seedlings is: MS+0.1mg / L NAA. The culture conditions of poplar tissue culture seedlings are: temperature 25℃, photoperiod 16:8h (light: dark).

[0044] 1. Obtaining sterile eggs, larvae and adults of the blue leaf beetle

[0045] A1. Collect fertilized eggs of insects, select male and female adults in good growth condition to pair up, and collect fertilized eggs after mating and laying eggs;

[0046] A2. Soak the collected eggs in 75% ethanol for 5-8 minutes for sterilization to fully remove the microorganisms on the surface of the eggs;

[0047] A3, rinse the eggs soaked in disinfectant with sterile pure water to clean any alcohol that may remain on the surface of the eggs, then use sterile filter paper to absorb the water from the washed eggs and dry them;

[0048] A4, the dried ovum is moved into a container with sterile tissue culture seedlings or tissue culture leaves, and sealed with a sterile breathable sealing film. The above operations are all carried out in a sterile environment;

[0049] A5. Place the container of step A4 in an artificial climate chamber. The conditions of the artificial climate chamber are: temperature of 22-26°C; humidity of 6085%; light time / dark time = (14-18) h / (6-10) h. Keep the air in the climate chamber clean. After the eggs are hatched, the insect larvae with sterile intestinal tract are obtained.

[0050] A6. After the larvae hatch, feed them with sterile tissue culture leaves in a clean bench and regularly replenish and replace the sterile tissue culture leaves.

[0051] A7. Wait for the larvae to pupate and successfully emerge as sterile adults.

[0052] 2. Verification of the sterility of willow blue leaf beetle larvae by traditional bacterial culture method and PCR-gel electrophoresis PCR-gel electrophoresis detection:

[0053] The total DNA of leaf beetle eggs, larvae of various ages and adults obtained from the above-mentioned sterile culture and conventional culture were extracted respectively, and the DNA was subjected to PCR and gel electrophoresis using primers 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (TACGGYTACCTTGTTACGACTT) in the highly conserved region of the 16S rRNA gene. The presence of amplified products was checked under a gel imager to test the sterility of the larvae.

[0054] Traditional bacterial culture method detection (dilution plate method):

[0055] T1, randomly selected 10 eggs obtained from sterile culture and conventional culture, three larvae of each age, and one adult;

[0056] T2. In a clean bench, collect the eggs into a 2-mL grinding tube, and dissect the larval and adult intestines with sterile scissors and forceps under a stereo microscope (Olympus, Japan), and collect the intestines into a 2-mL grinding tube;

[0057] T3, add 100 μL of sterile phosphate buffered saline (PBS) and 3 sterilized steel beads into a 2 mL grinding tube (Axygen, USA), and grind the tissue into a homogenate using a grinder (Jingxin, China);

[0058] T4, dilute 100 μL of homogenate by 10 -4 Add to LB agar medium and spread evenly using a sterile spreader stick;

[0059] T5. Place the culture dish in a 37°C incubator for 24 hours, observe the bacterial growth and count the bacteria.

[0060] 3. Obtaining single-bacteria insects and using the single-bacteria inoculation model to study the effects of bacteria on the blue leaf beetle

[0061] B1. Select the bacterium Rosenbergiella nectarea and culture it in LB liquid medium until the logarithmic growth phase. Centrifuge at 4000rpm for 5min to collect the bacteria. Wash twice with sterile PBS and finally resuspend with PBS to dilute to a final concentration of nearly 2x10 4 cells / mL;

[0062] B2. Prepare sterile larvae and sterile tissue culture plants;

[0063] B3. Before feeding, apply the bacterial suspension onto sterile tissue culture poplar leaves, and then feed the leaves to sterile 1st instar larvae of the blue leaf beetle (the amount of bacteria in the added suspension is determined according to the actual bacterial load in the 1st instar larvae in the natural environment);

[0064] B4. Place the treated insects in a sterile culture dish for subsequent feeding;

[0065] B5. Randomly select sterile culture and single bacteria feeding to obtain three larvae of each age and one adult, and use traditional bacterial culture methods and PCR-gel electrophoresis to verify whether the single bacteria model of willow blue leaf beetle larvae or adults is successfully established (specific primers R22-F (CTAATACCGCATAATGTCGCA), R22-R (ACCCTTCCTCCTGACTGAAA) are designed in the 16S RNA of the bacterial R. nectare with high variation);

[0066] B6. Observe and record the weight, development period, pupation rate and emergence rate of larvae of each instar of leaf beetles every day. Sterile conditions must be maintained during the experiment to prevent contamination by external microorganisms.

[0067] IV. Experimental Results

[0068] Conventional bacterial culture and PCR-gel electrophoresis were performed on the eggs, larvae and intestinal tissue grinding fluids of sterile and conventional cultures to verify the establishment of the sterile leaf beetle system. The results showed that no colonies were observed in the sterile cultured eggs, larvae of various ages and adult tissue grinding fluids after 24 hours of culture on LB medium, while many colonies grew on the conventional cultured eggs, larvae of various ages and adult tissue grinding fluids on LB medium ( Figure 1 ). At the same time, the PCR amplification results also showed that the target fragment could not be amplified from the sterile cultured eggs, larvae and adults, while the target product of about 1500 bp could be amplified from the conventionally cultured eggs, larvae of various ages and adults ( Figure 3 )The above two experimental results both indicate that the disinfection method is feasible and can completely remove the intestinal bacteria of eggs, larvae, and adults of the blue leaf beetle.

[0069] Conventional bacterial culture and PCR were performed on the axenic culture and inoculated R. nectarea larvae and adult intestinal tissue grinding fluid to verify the establishment of a single bacterial leaf beetle system. The results showed that no colonies were observed after 24 hours of incubation of the axenic culture larvae and adult intestinal tissue grinding fluid on LB medium, while the axenic culture larvae and adult intestinal tissue grinding fluid inoculated with R. nectarea grew a certain number of colonies on LB medium ( Figure 2 ). At the same time, the PCR amplification results also showed that the target fragment could not be amplified by the larvae and adults cultured aseptically, while the larvae and adults inoculated with bacteria R. nectarea could amplify the target product of about 300 bp ( Figure 4 ). In addition, the effect of single bacteria inoculation on the weight of blue leaf beetles was detected. The results showed that the average weight of the first-instar larvae of blue leaf beetles fed with sterile poplar trees was 0.4 mg, and the weight of the larvae inoculated with bacteria R. nectarea was 0.33 mg. There was no significant statistical difference in the weight of the larvae between the two groups. The average weight of the second-instar larvae of blue leaf beetles fed with sterile poplar trees was 1.85 mg, and the weight of the second-instar larvae inoculated with bacteria R. nectarea was 2.25 mg, which was significantly higher than that of the control group. For the third-instar larvae, the weights of the sterile group and the inoculated bacteria R. nectarea were 6.97 mg and 7.78 mg, respectively, and the weight of the inoculated bacteria R. neciaea was significantly higher than that of the control group ( Figure 5 AC). However, there were no significant differences in the developmental period, pupation rate, and adult emergence rate between the sterile larvae and the larvae inoculated with bacteria R. nectarea ( Figure 5 DF). The above results show that a single bacterial leaf beetle model containing only bacteria R. nectarea was successfully constructed, and R. nectarea has a certain growth-promoting effect on leaf beetle larvae.

[0070] The sterile tissue culture plants obtained by the method for preparing the imagoes of the leaf beetles containing a single bacterium of the present invention are used as feed to obtain sterile leaf beetles and imagoes of the leaf beetles containing a single bacterium, which are homologous to natural food and have obvious advantages over artificial compound feeds. The leaf beetles containing a single bacterium obtained by the method for preparing the imagoes of the leaf beetles containing a single bacterium are used in the study of the influence of microorganisms on the growth and development of insects, eliminating the interference factors of artificial compound feeds. On this basis, the leaf beetles containing a single bacterium obtained by the method for preparing the imagoes of the leaf beetles containing a single bacterium can be used in the prevention and control of plant pests in agriculture and forestry, and the growth and development of larvae can be inhibited by specific microorganisms, providing an effective path for controlling forestry pests. On the other hand, the tissues (including homogenates, dissected intestinal tissues, etc.) of the leaf beetles containing a single bacterium obtained by the method for preparing the imagoes of the leaf beetles containing a single bacterium of the present invention can be used in the study of symbiotic insects, and provide a stable and excellent model animal material for studying the interaction between intestinal microorganisms and insects.

[0071] Although the embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, substitutions and modifications may be made to the embodiments without departing from the principles and spirit of the invention, and the scope of the invention is defined by the appended claims and their equivalents.

Claims

1. A method for preparing leaf beetle adults containing a single bacterium, characterized in that: include: Collect sterile fertilized eggs, transfer them into a container with sterile tissue culture plants, and seal it with a sterile breathable sealing film. All the above operations are performed in a sterile environment; The container with the sterile tissue culture plants is placed in an artificial climate chamber, wherein the artificial climate conditions are: temperature of 22-26° C.; humidity of 60-85%; light duration / dark duration=(14-18) h / (6-10) h, and the air in the climate chamber is kept clean, and the intestinal sterile leaf beetle larvae are obtained after the eggs are hatched; Select a single type of bacteria and culture it to the logarithmic growth phase; Collecting a certain amount of sterile larvae obtained in the previous step; before feeding, applying the suspension containing the single type of bacteria to sterile tissue culture plant leaves, and then feeding the sterile larvae with the tissue culture plant leaves; The larvae obtained in the previous step are placed in a sterile culture dish and subsequently reared using sterile tissue culture plants to obtain leaf beetle adults containing a single type of bacteria.

2. The method for preparing leaf beetle adults containing a single bacterium according to claim 1, characterized in that: The steps of obtaining the sterile tissue culture plants are as follows: taking plant callus tissue for rapid propagation by tissue culture, and when the plant seedlings grow to 2 / 3 of the height of the culture bottle, placing the culture bottle in a sterile clean bench; The scissors and tweezers are sterilized at high temperature, cooled to room temperature, and then the buds with 1-2 stem segments of the plant seedlings in the culture bottle are cut with the scissors, and then placed in a new rooting medium with the tweezers. When the buds grow to 2 / 3 of the height of the culture bottle, the steps are repeated to obtain batches of sterile tissue culture plants.

3. The method for preparing leaf beetle adults containing a single bacterium according to claim 1, characterized in that: The obtained leaf beetles were tested for bacteria using the dilution plate method and PCR amplification-gel electrophoresis method. The dilution plate assay involves the following steps: T1, randomly selected 10 eggs of leaf beetles obtained by sterile culture and conventional culture, 3 1st, 2nd and 3rd instar larvae, and 1 adult; T2. In a clean bench, collect the eggs into a grinding tube, and dissect the larvae and adult intestines with sterile scissors and forceps under a stereo microscope, and collect the obtained intestinal tissues into a grinding tube; T3, add 100 μL of sterile phosphate buffered saline (PBS) and 3 sterilized steel beads to the grinding tube, and use a grinder to grind the tissue into a homogenate; T4, dilute 100 μL of homogenate by 10 -4 Add to LB agar medium and spread evenly using a sterile spreader stick; T5. Place the culture dish in a 37°C incubator for 24 hours, observe the bacterial growth and count the bacteria; The PCR amplification-gel electrophoresis detection steps include: The total DNA of leaf beetle eggs, larvae of different instars and adults obtained from sterile culture and conventional culture were extracted respectively, and the DNA was amplified by PCR using primers 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (TACGGYTACCTTGTTACGACTT) in the highly conserved region of the 16S rRNA gene, and gel electrophoresis was performed to test the sterile state of the larvae.

4. The method for preparing leaf beetle adults containing a single bacterium according to claim 1, characterized in that: The step of obtaining the sterile eggs comprises: Select male and female adults with good growth conditions to pair up, collect fertilized eggs after mating and laying eggs; Soak the collected eggs in 75% ethanol for 5-8 minutes for sterilization to fully remove the microorganisms on the surface of the eggs; Rinse the eggs soaked in disinfectant with sterile pure water to clean any residual disinfectant on the surface of the eggs. Then use sterile filter paper to absorb the water from the washed eggs and air dry them to obtain sterile fertilized eggs for use.

5. The method for preparing leaf beetle adults containing a single bacterium according to claim 1 or 2, characterized in that: The sterile tissue culture plants include poplar tissue culture seedlings and poplar tissue culture leaves. The culture medium of the poplar tissue culture seedlings is: MS+0.1 mg / L NAA. The culture conditions of the poplar tissue culture seedlings are: temperature 25°C, photoperiod 16:8h (light:darkness).

6. The method for preparing leaf beetle adults containing a single bacterium according to claim 1, characterized in that: The number of bacteria in the suspension of a single type of bacteria is determined based on the actual bacterial load in the first-instar larvae of leaf beetles in natural environments.

7. Use of the sterile tissue culture plants obtained by the method for preparing leaf beetle adults containing a single bacterium according to any one of claims 2 to 6 as feed in obtaining sterile leaf beetle adults and single bacterium leaf beetle adults.

8. Use of the leaf beetle containing a single bacterium obtained by the method for preparing leaf beetle adults containing a single bacterium according to any one of claims 1 to 6 in the study of the effects of microorganisms on insect growth and development.

9. Use of the leaf beetle adults containing a single bacterium obtained by the method for preparing leaf beetle adults containing a single bacterium according to any one of claims 1 to 6 in the control of plant pests in agriculture and forestry.

10. Use of the tissue of the leaf beetle containing a single fungus obtained by the method for preparing leaf beetle adults containing a single fungus according to any one of claims 1 to 6 in the research of symbiotic insects.

Images