Application of ANXA2 in preparation of medicine for treating drug-induced liver injury
By constructing an ANXA2 gene knockout mouse model, it was found that ANXA2 has a protective effect in drug-induced liver injury, which solved the problem of under-study of ANXA2 in the prior art and provided a new method to treat drug-induced liver injury.
Patent Information
- Application Number
- CN202411652997.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-19
- Publication Date
- 2025-04-04
AI Technical Summary
Drug-induced liver injury is a serious adverse drug reaction. The existing technology has not yet effectively solved the role of ANXA2 in drug-induced liver injury, resulting in increased treatment difficulty.
By constructing a C57 mouse model of ANXA2 gene knockout and establishing a drug-induced liver injury model, it was found that ANXA2 gene knockout aggravated liver injury, and drug and biological reagents using ANXA2 as a target were designed and prepared to prevent, alleviate and/or treat drug-induced liver injury.
The liver damage in ANXA2 knockout mice was significantly aggravated and liver function worsened, proving that ANXA2 has a protective effect in drug-induced liver injury, providing a new treatment path and exploration direction.
Smart Images
Figure CN119746032A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedicine technology, and in particular to the application of ANXA2 as a target in the preparation or screening of drugs for drug-induced liver injury. Background Art
[0002] Drug-induced liver injury (DILI) is damage to the liver or biliary system associated with the ingestion of hepatotoxic drugs. It is one of the most common and serious adverse drug reactions. In severe cases, it can cause acute liver failure or even death. In recent years, the number of cases of drug-induced liver injury has increased. A WHO survey found that drug-induced liver injury has ranked fifth in the global mortality rate of liver diseases. my country has a large population base, an aging population, and a growing phenomenon of multiple medications. The irrational use of Chinese herbal medicines and health products is common. Medical staff and the public still lack awareness of drug safety issues. Drug-induced liver injury has become an important issue that needs to be addressed urgently.
[0003] The annexin A2 (ANXA2) gene is located on chromosome 15. The protein it encodes is an important member of the annexin family. It is a calcium-dependent phospholipid-binding protein that is widely present in plants and animals. ANXA2 plays a role in regulating cell growth and signal transduction pathways and is widely present in various types of cells, such as endothelial cells, tumor cells, and innate immune cells. ANXA2 can exist as a free monomer in the cytoplasm, can bind to the intracellular membrane, or attach to the outer surface of the plasma membrane. It is mainly involved in membrane transport and a series of calmodulin-dependent activities on the membrane surface, including membrane fusion, vesicle transport, cell adhesion, cell proliferation, apoptosis, replication, signal transduction, and ion channel formation in exocytosis.
[0004] In recent years, a large number of studies have confirmed that the dysregulated expression of ANXA2 is closely related to the occurrence and development of various tumors. Its expression is upregulated in the vast majority of human tumors. This overexpression phenomenon is closely related to the occurrence, development, infiltration, metastasis and poor prognosis of tumors. Previous studies have confirmed that ANXA2 has an impact on liver diseases such as alcoholic steatohepatitis, non-alcoholic steatohepatitis, viral hepatitis and hepatocellular carcinoma. However, the role of ANXA2 in drug-induced liver injury has not been fully studied. Summary of the invention
[0005] The present invention uses ANXA2 gene knockout C57 mice as experimental subjects to construct a drug-induced liver injury model. The results show that compared with non-gene knockout mice, the liver injury of ANXA2 gene knockout mice is significantly aggravated and the liver function is significantly deteriorated. It is speculated that the ANXA2 gene can be used as a drug target to design and prepare drugs and / or biological agents for preventing, alleviating and / or treating drug-induced liver injury; it can also be used to screen drugs for protecting liver function by constructing an in vitro cell model or animal model of ANXA2 gene knockout; or it can be used to screen drugs for preventing, alleviating and / or treating drug-induced liver injury.
[0006] The specific technical solutions of the present invention are as follows:
[0007] The first aspect of the present invention provides the use of ANXA2 in preparing a drug for drug-induced liver injury.
[0008] Preferably, the drug is selected from liposomes or nanomaterials encapsulating exogenous ANXA2, ANXA2 recombinant expression vectors or ANXA2 protein.
[0009] More preferably, the nucleic acid sequence of ANXA2 is as follows:
[0010] AGTGAGAAGTCCCACTTCGCTTTCCGCACTGCGTTCTCTCACTCTGGACCGTAACTT
[0011] CTGCAATTTCAGCTTTTTTTTTCTTCAAAATGTCTACTGTCCACGAAATCCTGTGCAAGCT
[0012] CAGCCTGGAGGGTGATCATTCTACAACCCCCAAGTGCCTACGGGTCAGTCAAACCCTACA
[0013] CCAACTTCGATGCTGAGAGGGATGCTCTGAACATTGAGACAGCAGTCAAGACCAAAGG
[0014] AGTGGATGAGGTCACCATTGTCAACATCCTGACAAACCGCAGCAATGTGCAGAGGCAG
[0015] GACATTGCCTTCGCCTATCAGAGAAGGACCAAAAAGGAGCTCCCGTCAGCGCTGAAGT
[0016] CAGCCTTATCTGGCCACCTGGAGACGGTGATTTTGGGCCTATTGAAGACACCTGCCCAGT
[0017] ATGATGCTTCGGAACTAAAAGCTTCCATGAAGGGCCTGGGGACTGACGAGGACTCCCTC
[0018] ATTGAGATCATCTGCTCACGAACCAACCAGGAGCTGCAAGAGATCAACAGAGTGTACA
[0019] AGGAAATGTACAAGACTGATCTGGAGAAGGACATCATCTCTGACACATCTGGAGACTTC
[0020] CGAAAGCTGATGGTCGCCCTTGCAAAGGGCAGACGAGCAGAGGATGGCTCAGTTATTG
[0021] ACTACGAGCTGATTGACCAGGATGCCCGGGAGCTCTATGATGCCGGGGTGAAGAGGAA
[0022] AGGAACCGACGTCCCCAAGTGGATCAGCATCATGACTGAGCGCAGTGTGTGCCACCTCC
[0023] AGAAAGTGTTCGAAAGGTACAAGAGCTACAGCCCTTATGACATGCTGGAGAGCATCAA
[0024] GAAAGAGGTCAAAGGGGACCTGGAGAACGCCTTCCTGAACCTGGTCCAGTGCATCCAG
[0025] AACAAGCCCCTGTACTTCGCTGACCGGCTGTACGACTCCATGAAGGGCAAGGGGACTC
[0026] GAGACAAGGTCCTGATTAGAATCATGGTCTCTCGCAGTGAAGTGGACATGCTGAAAATC
[0027] AGATCTGAATTCAAGAGGAAATATGGCAAGTCCCTGTACTACTACATCCAGCAAGACAC
[0028] CAAGGGTGACTACCAGAAGGCACTGCTGTACCTGTGGTGGTGGGGATGACTGAAGGGCT
[0029] CAGCACAGTGGATCACCCAGAAGTGGCTCTACCTGTGCCCCAACCTGGCGTTCTAGAGA
[0030] CTTCGCTCTCCACTAATGGACCCCTGAGCTCCTCCCTGTGAGGATGATGACAGGGCTGC
[0031] CGACCCTTTCCCCATCTTAGCTGCCCTTGCCTGGCTTTCTCCTCATTCTCTCCTTTATGCC
[0032] AAAGAAGTGAACATTCCAGGGAGTGGGGCGTAGCGTCTGTGACATGAGACACTTCCTC
[0033] TTATGTACTGTGTCGTGAATAAACCGTTTTTACTTTAGAAACAA (SEQ ID NO. 1).
[0034] In addition to the above sequence, the following situations also fall within the protection scope of the present invention:
[0035] (i) a molecule that hybridizes to the nucleotide sequence defined by SEQ ID NO.1 under stringent conditions;
[0036] (ii) a nucleic acid molecule that is homologous to or has sequence identity with the nucleotide sequence shown in SEQ ID NO.1 and has similar functions;
[0037] (iii) A nucleic acid molecule having similar functions, wherein one or more nucleotides are substituted, deleted or added to the nucleotide sequence shown in SEQ ID NO.1.
[0038] The second aspect of the present invention provides the use of an ANXA2 recombinant expression vector in preparing a drug for drug-induced liver injury. The ANXA2 recombinant expression vector comprises an expression vector and an ANXA2 nucleic acid molecule inserted into the expression vector, and the sequence thereof is as described above.
[0039] The expression vector includes a viral vector and a non-viral vector.
[0040] The "viral vector" includes adenovirus, adeno-associated virus, lentivirus, coxsackie virus, herpes simplex virus, measles virus, Newcastle disease virus, parvovirus, poliovirus, reovirus, vaccinia virus and vesicular stomatitis virus, etc. Suitable viral vectors are well known to those of ordinary skill in the art.
[0041] The "non-viral vector" includes liposomes or lipid complexes, cationic polymers, chitosan polymers and nanoparticle vectors, etc. Suitable non-viral vectors are well known to those skilled in the art.
[0042] The third aspect of the present invention provides the use of ANXA2 in screening drugs for alleviating or treating drug-induced liver injury. By constructing an in vitro cell model or animal model with ANXA2 gene knockout, it is used to screen drugs for protecting liver function; or to screen drugs for preventing, alleviating and / or treating drug-induced liver injury.
[0043] The fourth aspect of the present invention provides a pharmaceutical composition for treating drug-induced liver injury, comprising an active ingredient and a pharmaceutically acceptable excipient, wherein the active ingredient is the above-mentioned ANXA2 or its recombinant vector.
[0044] In terms of drug form, the drug or drug composition is selected from the following methods of administration: oral administration, injection, gold-coated gene gun bombardment, reproduction-defective bacteria carrying plasmid DNA, replication-defective adenovirus carrying target DNA, transdermal administration, etc.
[0045] When the composition of the present invention is administered to animals including humans, the dosage varies depending on the patient's age and weight, disease characteristics and severity, and administration route. The results of animal experiments and various circumstances can be referred to, and the total dosage cannot exceed a certain range.
[0046] Furthermore, the pharmaceutical composition of the present invention can be used in combination with other pharmaceutical compositions for treating drug-induced liver injury.
[0047] Beneficial protection and effects of the present invention:
[0048] The present invention provides the use of ANXA2 as a target in the preparation or screening of drugs for drug-induced liver injury. Experiments have confirmed that compared with wild-type mice with drug-induced liver injury, ANXA2 gene knockout mice can aggravate drug-induced liver injury, including reducing the necrosis area, delaying the recovery of liver function, and the survival state is also significantly worse than that of wild-type mice with liver injury, proving that ANXA2 has a protective effect in drug-induced liver injury. The present invention provides a new approach and exploration direction for the treatment of drug-induced liver injury. BRIEF DESCRIPTION OF THE DRAWINGS
[0049] Figure 1Western blot results of ANXA2 knockout mice (KO) and wild-type mice (WT) are shown;
[0050] Figure 2 The liver function comparison of ANXA2 knockout mice (KO), wild-type mice (WT) and model group mice (WT-APAP and KO-APAP) is shown: A, comparison of serum AST and ALT test results; B, comparison of liver tissue function; C, comparison of survival curves. DETAILED DESCRIPTION
[0051] The present invention is further described below with examples, but should not be construed as limiting the present invention. The examples do not include a detailed description of conventional methods, which are well known to those skilled in the art and are described in many publications.
[0052] Unless otherwise specified, percentages and parts of the present invention are calculated by volume; unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein can be applied to the present invention, and the preferred implementation methods and materials described in the specific implementation methods are for demonstration purposes only.
[0053] 1. Experimental Animals and Their Breeding
[0054] Experimental animals: Male mice of C57BL / 6 strain, 8-10 weeks old and weighing 20-25 g, ANXA2 knockout mice (KO) and wild-type mice (WT, purchased from Zhejiang Weitong Lihua Experimental Animal Technology Co., Ltd.) were selected.
[0055] Feeding environment: All experimental mice were raised in the SPF-level experimental animal center of Ruijin Hospital affiliated to Shanghai Jiaotong University School of Medicine. The feeding temperature was 22-24℃, the humidity was 40-70%, the light-dark alternating lighting time was 12h, and the mice were free to drink water and eat.
[0056] 2. Construction of ANXA2 knockout mice
[0057] To further study the effect of ANXA2 on drug-induced liver injury, ANXA2 knockout (KO) mice were constructed. ANXA2 knockout mice can be constructed based on CRISPR-Cas9 technology: first, based on the target gene sequence, select appropriate exons or introns for targeted knockout; second, prepare the CRISPR / Cas9 system, including Cas9 protein, sgRNA, and plasmid vectors; then, introduce the CRISPR / Cas9 system into mouse embryonic stem cells, and use the CRISPR / Cas9 system to knock out the target gene; then, identify the efficiency of gene knockout in knockout mouse embryonic stem cells, and verify the knockout effect by PCR, Western blot and other methods; finally, inject the knockout mouse embryonic stem cells into the visceral organs of newborn mice for transplantation to culture knockout mice. Western blot (WB) experiments found that the expression of the ANXA2 gene in the liver of knockout mice was significantly reduced ( Figure 1 ).
[0058] 3. Construction of a mouse model of drug-induced liver injury
[0059] 1. Experimental animal grouping: Male KO and WT mice aged 8-10 weeks and weighing 20-25 g were used as research subjects and divided into 4 groups, namely, sham operation groups (WT-Sham and KO-Sham) and modeling groups (WT-APAP and KO-APAP) of ANXA2 knockout mice and wild-type mice, and then the drug-induced liver injury model was established.
[0060] 2. Operation process of drug-induced liver injury model
[0061] 1) The mice were fasted for 24 h before administration and were allowed to drink water freely.
[0062] 2) After disinfection of the injection site, APAP (300 mg / kg) was injected intraperitoneally.
[0063] 3) Serum and liver samples were collected from mice 24 h after administration.
[0064] 4. Determination of liver damage
[0065] The evaluation indicators of the severity of drug-induced liver injury mainly include determining the area of liver necrosis by HE staining and determining the recovery of liver function by detecting serum AST and ALT. These indicators are positively correlated with the severity of liver injury. Specifically, liver specimens were obtained 24 hours after APAP treatment, fixed in 10% neutral formalin for 24 hours, dehydrated, embedded, paraffin sectioned and HE stained; blood specimens were obtained at the same time, centrifuged to obtain the supernatant, and mouse serum ALT (C009-2-1, Nanjing Jiancheng) and AST (C010-2-1, Nanjing Jiancheng) were detected according to the instructions of the kit.
[0066] The role of ANXA2 in drug-induced liver injury Figure 2 :For normal mice, knockout of ANXA2 had no effect on liver tissue, and the liver tissue of the sham group was basically normal; after APAP treatment, the liver of the WT group mice showed obvious inflammatory cell infiltration, hepatocyte edema, and large-area liver necrosis; the necrosis area of KO mice in the drug-induced liver injury group was significantly higher than that of the WT group ( Figure 2 B); Similarly, the serum AST and ALT of KO mice after APAP treatment were significantly higher than those of KO mice ( Figure 2 A); In addition, the survival status of KO mice after APAP treatment was significantly worse than that of WT mice ( Figure 2 C) It was verified that ANXA2 has a protective effect in drug-induced liver injury.
[0067] The above research results show that ANXA2 gene knockout mice can aggravate drug-induced liver injury, including reducing the area of necrosis and delaying the recovery of liver function, proving that ANXA2 has a protective effect in drug-induced liver injury.
[0068] In view of this, ANXA2 can be used as a drug target to prepare ANXA2 agonists for preventing, alleviating and / or treating drug-induced liver injury, including ANXA2 gene overexpression plasmids, virus-mediated ANXA2 transfection or other drugs or biological agents that can promote ANXA2 expression.
[0069] The preferred embodiments of the present invention have been specifically described above, but the present invention is not limited to the embodiments. Those skilled in the art may make various equivalent modifications or substitutions without violating the spirit of the present invention. These equivalent modifications or substitutions are all included in the scope defined by the claims of this application.
Claims
1. Use of ANXA2 in the preparation of drugs for drug-induced liver injury.
2. The use according to claim 1, characterized in that The drug is selected from liposomes or nanomaterials encapsulating exogenous ANXA2, ANXA2 recombinant expression vectors or ANXA2 proteins.
3. The use according to claim 1, characterized in that The nucleic acid sequence of ANXA2 is shown in SEQ ID NO.
1.
4. Use of ANXA2 recombinant expression vector in the preparation of drugs for drug-induced liver injury.
5. The use according to claim 4, characterized in that The ANXA2 recombinant expression vector comprises an expression vector and an ANXA2 nucleic acid molecule inserted into the expression vector. The nucleic acid sequence of ANXA2 is shown in SEQ ID NO.
1.
6. The use according to claim 5, characterized in that The expression vector is a plasmid vector, a cosmid vector, a phage vector or a virus vector.
7. The use according to claim 6, characterized in that The viral vector is selected from adenovirus, adeno-associated virus, lentivirus, coxsackie virus, herpes simplex virus, measles virus, Newcastle disease virus, parvovirus, poliovirus, reovirus, vaccinia virus or vesicular stomatitis virus.
8. Application of ANXA2 as a target in screening drugs for alleviating or treating drug-induced liver injury.
9. A pharmaceutical composition for treating drug-induced liver injury, characterized in that: The pharmaceutical composition comprises an active ingredient and a pharmaceutically acceptable excipient. Wherein, the active component is the ANXA2 described in any one of claims 1 to 3 or the ANXA2 recombinant expression vector described in any one of claims 4 to 7.
10. The pharmaceutical composition for treating drug-induced liver injury according to claim 9, characterized in that: The pharmaceutical composition is used in combination with other drugs for treating drug-induced liver injury.