Use of an agent or method for inhibiting expression of lysine-specific demethylase 6B in the preparation of a medicament for preventing and treating heart disease caused by administration of an anticancer drug
By inhibiting the expression of lysine-specific demethylase 6B, and using humanized hsa-EPPIR reagent or its extracellular vesicles to regulate histone demethylase activity, the cardiotoxicity problem caused by anticancer drugs has been solved, providing cardioprotection and a new therapeutic approach.
Patent Information
- Application Number
- CN202411612153.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-12
- Publication Date
- 2026-02-03
- Estimated Expiration
- 2044-11-12
AI Technical Summary
There is a lack of effective prevention and treatment methods for the cardiotoxicity problems caused by existing anticancer drugs such as doxorubicin during treatment, especially myocardial damage and heart failure.
By inhibiting the expression of lysine-specific demethylase 6B, using humanized hsa-EPPIR reagent or its extracellular vesicles, the activity of histone demethylase is regulated, the activity of downstream target gene p53 is inhibited, the expression of apoptosis-related proteins is reduced, and cardioprotection is provided.
Without affecting the anti-tumor efficacy of anti-cancer drugs, this study aims to reduce cardiotoxicity caused by anti-cancer drug administration, improve cardiac function, and provide new drug development pathways and targets for the diagnosis and treatment of heart diseases.
Smart Images

Figure CN119746069B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of reagents or methods for inhibiting the expression of lysine-specific demethylase 6B in the preparation of drugs for preventing and treating heart disease caused by anticancer drug administration. Background Technology
[0002] Doxorubicin (Dox) is an anticancer chemotherapy drug widely used to treat various hematologic malignancies and solid sarcomas. However, mounting evidence suggests that the clinical use of Dox can also cause significant cardiotoxicity due to dose dependence, such as heart failure and dilated cardiomyopathy. The molecular mechanisms involved in Dox cardiotoxicity are multifactorial, including increased reactive oxygen species, DNA damage, and apoptosis. Since the risk of cardiotoxicity is increased in cancer patients treated with doxorubicin, there is an urgent need to explore new drugs and strategies to prevent and treat Dox-induced cardiomyopathy.
[0003] Lysine-specific demethylase 6B (KDM6B) is a member of the histone demethylase family. KDM6B affects chromatin accessibility through specific demethylation and regulates gene expression by altering chromatin conformation, playing a crucial role in the occurrence and development of various human diseases, including cancer, immune diseases, and developmental disorders. However, there are currently no studies on developing anticancer drugs targeting KDM6B for the prevention and treatment of heart disease. Summary of the Invention
[0004] The purpose of this invention is to provide a reagent or method for inhibiting the expression of lysine-specific demethylase 6B in the preparation of a drug for preventing and treating cardiac diseases caused by anticancer drug administration. By inhibiting the expression of lysine-specific demethylase 6B, the toxicity of anticancer drugs to the heart can be resisted without affecting the antitumor effect of anticancer drugs, thereby preventing and treating cardiac diseases caused by anticancer drug administration and providing cardioprotection for clinical tumor treatment.
[0005] This invention provides the application of reagents or methods for inhibiting the expression of lysine-specific demethylase 6B in the preparation of drugs for preventing and treating heart disease induced by anticancer drug administration.
[0006] Preferably, the anticancer drug includes doxorubicin, epirubicin, or mitoxantrone.
[0007] Preferably, the heart disease includes myocardial injury and / or heart failure.
[0008] Preferably, the reagent for inhibiting the expression of lysine-specific demethylase 6B includes a reagent for overexpressing humanized hsa-EPPIR, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0009] Preferably, the reagent for overexpressing humanized hsa-EPPIR includes a recombinant expression vector for overexpressing humanized hsa-EPPIR.
[0010] Preferably, the initial vector for the recombinant expression vector includes a lentiviral vector or an adeno-associated virus vector.
[0011] Preferably, the lentiviral vector comprises pLKO.1; the humanized hsa-EPPIR is inserted between the EcoRI and AgeI restriction sites of pLKO.1.
[0012] Preferably, the overexpression of humanized reagents comprises lentiviruses overexpressing humanized hsa-EPPIR and / or extracellular vesicles enriched with humanized hsa-EPPIR.
[0013] The present invention also provides a drug for preventing and treating heart disease caused by anticancer drug administration, wherein the active ingredient of the drug includes a reagent that overexpresses humanized hsa-EPPIR.
[0014] Preferably, the reagent for overexpressing humanized hsa-EPPIR includes lentiviruses overexpressing humanized hsa-EPPIR and / or extracellular vesicles enriched with humanized hsa-EPPIR.
[0015] Beneficial effects:
[0016] This invention provides the application of reagents or methods for inhibiting the expression of lysine-specific demethylase 6B in the preparation of drugs for preventing and treating cardiac diseases induced by anticancer drug administration. This invention inhibits the expression of lysine-specific demethylase 6B, a member of histone demethyltransferases, thereby inhibiting the activity of the downstream target gene p53, affecting the expression of apoptosis-related proteins, and playing a significant role in promoting apoptosis-related pathological processes. Based on this principle, this invention targets lysine-specific demethylase 6B to prevent and treat cardiac diseases induced by anticancer drug administration, improves cardiac function, provides cardiac protection for cancer patients after anticancer drug administration, and also provides new drug development pathways and drug targets for the diagnosis and treatment of heart failure or myocardial injury after drug treatment in cancer patients, possessing significant pharmaceutical value. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.
[0018] Figure 1 The pLKO.1 vector spectrum from Example 1;
[0019] Figure 2 The results of TUNEL immunofluorescence staining were obtained for Dox-administered hESC-CMs treated with overexpressed humanized hsa-EPPIR in Test Example 1.
[0020] Figure 3 To test Example 2, the RT-qPCR cell level was used to verify the overexpression efficiency of humanized hsa-EPPIR and the results of Western blot analysis of Bax / Bcl2, KDM6B, p-p53 and p53 in Dox-treated AC16 cells.
[0021] Figure 4 The results of Western blot analysis of Bax / Bcl2, p-p53 and p53 in A549 cells overexpressing humanized hsa-EPPIR and treated with Dox in Example 3 were used to test the results.
[0022] Figure 5 To test the characterization results of the humanized hsa-EPPIR extracellular vesicles enriched in Example 4. Detailed Implementation
[0023] This invention provides the application of reagents or methods for inhibiting the expression of lysine-specific demethylase 6B in the preparation of drugs for preventing and treating heart disease induced by anticancer drug administration.
[0024] The lysine-specific demethylase 6B described in this invention has the NCBI accession number Gene ID: 23135. In this invention, the anticancer drug preferably includes doxorubicin, epirubicin, or mitoxantrone, more preferably doxorubicin. The cardiac disease described in this invention preferably includes myocardial injury and / or heart failure, more preferably myocardial injury and heart failure; the myocardial injury preferably includes cardiomyocyte apoptosis.
[0025] In this invention, the reagent for inhibiting the expression of lysine-specific demethylase 6B preferably includes a reagent for overexpressing humanized hsa-EPPIR. The nucleotide sequence of the humanized hsa-EPPIR is preferably as shown in SEQ ID NO.1, specifically: 5'-TGCTAATGGTGGAGTTAAAGACTTTTTCT-3'. The humanized hsa-EPPIR of this invention is a newly discovered non-coding small RNA with a unique biological formation process. The overexpression strategy preferably uses a non-U6 promoter.
[0026] The reagent for overexpressing humanized hsa-EPPIR according to the present invention preferably includes a recombinant expression vector for overexpressing humanized hsa-EPPIR. The recombinant expression vector of the present invention preferably includes an initial vector and humanized hsa-EPPIR inserted into the initial vector; the initial vector preferably includes a lentiviral vector or an adeno-associated virus vector, more preferably a lentiviral vector. The lentiviral vector of the present invention preferably includes pLKO.1; when the lentiviral vector is pLKO.1, the humanized hsa-EPPIR is inserted between the EcoRI and AgeI restriction sites of pLKO.1.
[0027] When the initial vector of the recombinant expression vector overexpressing humanized hsa-EPPIR is a lentivirus, the overexpression reagent of the present invention preferably includes a lentivirus overexpressing humanized hsa-EPPIR and / or extracellular vesicles enriched with humanized hsa-EPPIR. The present invention does not specifically limit the packaging process of the lentivirus; conventional lentivirus packaging methods in the art can be used. The extracellular vesicles enriched with humanized hsa-EPPIR of the present invention preferably contain humanized hsa-EPPIR; the humanized hsa-EPPIR is preferably transfected into the target cell line via a lentiviral vector to obtain extracellular vesicles enriched with humanized hsa-EPPIR. The target cell line of the present invention preferably includes the 293T cell line. The present invention does not specifically limit the method for isolating the enriched humanized hsa-EPPIR extracellular vesicles; conventional isolation methods in the art can be used. For example, in one embodiment of the present invention, after constructing a 293T cell line stably expressing the humanized hsa-EPPIR, the enriched humanized hsa-EPPIR extracellular vesicles are obtained by separating the cell supernatant. The preferred concentration of the enriched humanized hsa-EPPIR extracellular vesicles in the present invention is 40 μg / mL or 10 μg / mL. 10 The concentration of the enriched humanized hsa-EPPIR extracellular vesicles is preferably the concentration in phosphate buffer or physiological saline.
[0028] p53 (NCBI accession number: Gene ID: 7157), as a tumor suppressor gene, has attracted much attention due to its crucial role in coordinating regulatory networks within the tumor environment. However, activation of p53 in normal cells can also cause non-specific chemical toxicity. This invention inhibits the expression of lysine-specific demethylase 6B, a member of histone demethyltransferases, thereby suppressing the activity of the downstream target gene p53 and affecting the expression of apoptosis-related proteins. This significantly promotes the pathological process related to apoptosis. In particular, overexpression of the humanized hsa-EPPIR plasmid can serve as a cardiomyocyte-specific p53 inhibitor, providing a new avenue for drug development and a drug target for the diagnosis and treatment of cardiac injury and / or heart failure induced by anticancer (tumor) drugs.
[0029] This invention also provides a medicament for preventing and treating heart disease induced by anticancer drug administration, wherein the active ingredient of the medicament includes a reagent overexpressing humanized hsa-EPPIR. The reagent overexpressing humanized hsa-EPPIR of this invention includes lentiviruses overexpressing humanized hsa-EPPIR and / or extracellular vesicles enriched with humanized hsa-EPPIR. The relevant characteristics of the lentiviruses overexpressing humanized hsa-EPPIR and the extracellular vesicles enriched with humanized hsa-EPPIR of this invention have been defined in the aforementioned documents and will not be repeated here. The medicament of this invention preferably includes pharmaceutically acceptable excipients. The type of excipients is not particularly limited and can be conventionally selected according to the drug dosage form. For example, the excipients of the medicament preferably include one or more of buffers, encapsulating agents, fillers, binders, transdermal absorbents, humectants, disintegrants, absorption enhancers, surfactants, colorants, flavoring agents, and adsorbents. More preferably, the excipients are selected according to the drug dosage form. The dosage form of the drug described in this invention preferably includes tablets, powders, granules, capsules, decoctions, oral liquids, injections, or suppositories, more preferably granules, capsules, decoctions, oral liquids, or injections, and more preferably injections.
[0030] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.
[0031] Example 1
[0032] 1. Construction of humanized hsa-EPPIR lentivirus, the steps are as follows:
[0033] 1) Initial vector digestion
[0034] Mix the pLKO.1 vector (Addgene plasmid #8453) according to the system described in Table 1, gently aspirate to mix, and incubate in a 37°C water bath for 1-2 hours; after enzyme digestion, perform agarose gel electrophoresis to recover the target fragment; the pLKO.1 vector is as follows Figure 1 As shown.
[0035] Table 1. Vector Enzyme Digestion System
[0036]
[0037]
[0038] 2) Obtaining the synthetic fragment of humanized hsa-EPPIR
[0039] The nucleotide sequence of the positive-strand primer hsa-EPPIR-F for preparing humanized hsa-EPPIR is: 5'-CCGGT GCTAATGGTGGAGTTAAAGACTTTTTCTCTCGAGAGAAAAAGTCTTTAACT CCACCATTAGCATTTTTG-3' (SEQ ID NO.2); the nucleotide sequence of the reverse-strand primer hsa-EPPIR-R is: 5'-AATTCAAAAATGCTAATGGTGGAGTTAAAGACTTTTTCTCTCGAGA GAAAAAGTCTTTAACTCCACCATTAGCA-3' (SEQ ID NO.3). The sequences obtained by amplification using the above primers include the restriction enzyme site linked to the pLKO.1 vector, the hsa-EPPIR sequence, the reverse complementary sequence to hsa-EPPIR, and the stem-loop sequence. The stem-loop sequence is used to link the hsa-EPPIR sequence and the reverse complementary sequence to hsa-EPPIR. The primer sequences are mixed according to the system described in Table 2, and reacted in a 95°C water bath for 4 min, followed by natural cooling to room temperature for annealing.
[0040] Table 2 Primer annealing system
[0041] reagents Volume (μL) hsa-EPPIR-F 5 hsa-EPPIR-R 5 NEBbuffer2.1 5 <![CDATA[ddH2O]]> 35 Total 50
[0042] 3) Ligation of the target fragment to the vector
[0043] The enzyme-digested pLKO.1 vector from step 1) was mixed with the annealing product from step 2) according to the system described in Table 3, and ligated overnight at 16°C.
[0044] Table 3 Connection System
[0045] reagents Volume (μL) Annealed products 5 Enzyme digestion vector 1 10×T4Buffer 1 10×T4ligase 1 <![CDATA[ddH2O]]> 2 Total 10
[0046] The ligation product obtained in step 3) was then transformed into *E. coli*. After transformation, the target strain was screened using antibiotic-free LB medium and sent to Qingke Company for sequencing. Plasmid extraction was performed using a nucleic acid extraction kit to obtain the humanized hsa-EPPIR overexpression plasmid (hereinafter referred to as hsa-EPPIR-OE plasmid). Sequencing results showed that the sequencing results were consistent with the target sequence, indicating that the humanized hsa-EPPIR-OE plasmid was successfully constructed.
[0047] Example 2
[0048] 1. Cell model establishment and grouping
[0049] Cardiac cells differentiated from human embryonic stem cells (hESC-CMs) were randomly divided into an doxorubicin treatment group (Dox) (experimental group) and a saline group (Saline) (control group).
[0050] Experimental group: Dox powder was prepared into a stock solution of 0.5 mg / mL using physiological saline. Doxorubicin was added to the cell culture medium (Corning brand DMEM, the same below) to make the final concentration of doxorubicin in the cell culture medium 0.3 μM, and the solution was protected from light for 24 h.
[0051] Control group: treated with an equal volume of physiological saline, with other procedures the same as the experimental group.
[0052] 2. hsa-EPPIR-OE plasmid transfection
[0053] The cells in the control group and the experimental group were divided into two groups, for a total of four groups, which were designated as Saline+Ctr, Saline+hsa-EPPIR-OE, Dox+Ctr, and Dox+hsa-EPPIR-OE groups.
[0054] 1) hESC-CMs were passaged into 96-well plates and cultured at a cell density of 70%-80%;
[0055] 2) Prepare cell transfection reagent A solution: Add 2 μg of hsa-EPPIR-OE plasmid (Ctr is an equal amount of pLKO.1 plasmid) to 500 μL of serum-free culture medium, mix gently, and let stand for 5 min;
[0056] 3) Prepare cell transfection reagent B: Add 4 μL of Lipo2000 transfection reagent to 500 μL of serum-free culture medium, mix gently, and let stand for 5 min;
[0057] 4) Gently mix cell transfection solution A with solution B and let stand at room temperature for 15-20 minutes;
[0058] 5) Remove the old cell culture medium from the cell plate and add 100 μL of the mixed plasmid transfection reagent to each well.
[0059] 6) Replace with normal culture medium after 6-8 hours;
[0060] Test Example 1
[0061] 1. Immunofluorescence TUNEL staining was used to detect the effect of hsa-EPPIR-OE plasmid on Dox-induced cardiomyocyte apoptosis. The steps are as follows:
[0062] (1) After the treatment in Example 2 was completed, the cell model was stained with TUNEL according to the following steps.
[0063] 1) Remove the cell culture medium and wash the cells with 1×PBS;
[0064] 2) Fix with 4% paraformaldehyde at room temperature for 30 min, wash three times with 1×PBS for 5 min each time;
[0065] 3) Disrupt the membrane with 0.5% Triton X-100 for 20 min, wash three times with 1×PBS for 5 min each time;
[0066] 4) Block with 5% BSA at room temperature for 1 hour;
[0067] 5) Incubation with primary antibody: Prepare 1:200 α-actinin with 5% BSA (the source and product number of the antibody used in the experiment are shown in Table 4), and incubate overnight at 4°C on a slow shaker;
[0068] Table 4 Antibody Names and Brand Codes
[0069]
[0070]
[0071] 6) Wash the cell plates three times with 1×PBS, 5 min each time;
[0072] 7) Incubation of secondary antibody: Prepare 1:200 CY3 mouse secondary antibody with 5% BSA, and incubate at room temperature in the dark on a slow shaker for 2 hours;
[0073] 8) Protect the cell plate from light, wash three times with 1×PBS, 5 min each time;
[0074] 9) Cell equilibration: Dilute 5×EquilibrationBuffer to 1×EquilibrationBuffer with ddH2O, 100 μL per well, and equilibrate at room temperature for 10-30 min;
[0075] 10) Prepare the Tunel reaction solution in the dark, as shown in Table 5.
[0076] Table 5. Components of the Tunel reaction solution
[0077] Components negative control Positive control / sample <![CDATA[ddH2O]]> 35μL 34μL 5X EquilibrationBuffer 10μL 10μL FITC-12-dUTP Labeling Mix 5μL 5μL RecombinantTdTEnzyme 0μL 1μL
[0078] 50 μL per well, reacted at 37°C in the dark for 1 hour;
[0079] 11) Protect the cell plate from light, wash three times with 1×PBS, 5 min each time;
[0080] 12) Incubation of nuclear dye: Prepare a 1:2000 Hoechst solution with 5% BSA and incubate at room temperature in the dark for 20 min;
[0081] 13) Protect the cell plate from light, wash three times with 1×PBS, 5 min each time;
[0082] 14) Perform immunofluorescence photography.
[0083] The results are as follows Figure 2 As shown.
[0084] Depend on Figure 2 It can be concluded that: after treatment with doxorubicin, the number of Tunel positive spots increased significantly (indicated by arrows), indicating that doxorubicin induced cardiomyocyte apoptosis; after transfection with hsa-EPPIR-OE plasmid, the number of Tunel positive spots decreased significantly (indicated by arrows), indicating that hsa-EPPIR-OE plasmid can effectively reduce doxorubicin-induced cardiomyocyte apoptosis.
[0085] Example 3
[0086] 1. Cell model establishment and grouping
[0087] Human cardiomyocytes AC16 were randomly divided into an doxorubicin treatment group (Dox group, experimental group) and a saline group (Saline group, control group).
[0088] Experimental group: Dox powder was prepared into a stock solution of 0.5 mg / mL using physiological saline, and doxorubicin (final concentration 0.3 μM) was added to the cell culture medium and treated in the dark for 24 h.
[0089] Control group: treated with an equal volume of physiological saline, with other procedures the same as the experimental group.
[0090] 2. hsa-EPPIR-OE plasmid transfection
[0091] The cells in the control group and the experimental group were divided into two groups, which were designated as Saline+Ctr, Saline+hsa-EP PIR-OE, Dox+Ctr, and Dox+hsa-EPPIR-OE groups, respectively.
[0092] 1) AC16 cells were passaged into 12-well plates and cultured at a cell density of 70%-80%.
[0093] 2) Prepare cell transfection reagent A solution: Add 2 μg of hsa-EPPIR-OE plasmid (Ctr is an equal amount of pLKO.1 plasmid) to 500 μL of serum-free culture medium, mix gently, and let stand for 5 min;
[0094] 3) Prepare cell transfection reagent B: Add 4 μL of Lipo2000 transfection reagent to 500 μL of serum-free culture medium, mix gently, and let stand for 5 min;
[0095] 4) Gently mix cell transfection solution A with solution B and let stand at room temperature for 15-20 minutes;
[0096] 5) Remove the old cell culture medium from the cell plate and add 1 mL of the mixed plasmid transfection reagent to each well.
[0097] 6) Replace with normal culture medium after 6-8 hours;
[0098] Test Example 2
[0099] 1. Using AC16 cells transfected with the control plasmid as the control group, real-time quantitative PCR was used to detect AC16 cells transfected with the hsa-EPPIR-OE plasmid in Example 3. The internal reference gene was 5s. The steps are as follows:
[0100] 1) Configure the real-time PCR reaction system according to the following reaction system (two parallel replicates for each sample) and perform real-time PCR detection. The real-time PCR reaction system is shown in Table 6. All primers were purchased from Guangzhou Ruibo Biotechnology Co., Ltd., China. The product number of the specific positive primer and the universal antisense primer for small RNA is MQPSCM001 and the product name is Bulge-Loophsa-mt-pro qRT-PCR Primer Set.
[0101] Table 6. PCR Detection System
[0102]
[0103]
[0104] 2) After the configuration is complete, the real-time fluorescence quantitative PCR reaction can be performed according to the following reaction procedure, as shown in Table 7.
[0105] Table 7 Real-time quantitative PCR reaction procedure
[0106]
[0107] 3) The experimental analysis employed a relative quantitative method, which reflects the relative expression level of the target gene in each experimental group relative to the control group. After averaging the results from parallel replicates, the results were analyzed using 2... -ΔΔCtThe calculation is performed, where ΔCt = target gene Ct value - internal reference Ct value, and ΔΔCt = ΔCt values of all groups including the control group - average ΔCt value of the control group. The calculation results are as follows: Figure 3 As shown in Figure A.
[0108] Depend on Figure 3 From A, we can conclude that the hsa-EPPIR-OE plasmid was successfully constructed and stably overexpressed humanized hsa-EPPIR.
[0109] 2. Western blot analysis of the effect of humanized hsa-EPPIR-OE plasmid on Dox-induced cardiomyocyte apoptosis in Example 3, the steps are as follows:
[0110] (1) After the treatment in Example 3 was completed, the cell model was subjected to Western blotting according to the following steps.
[0111] 1) Remove the culture medium from the cells, add 100 μL of protein lysis buffer to the cell culture plate, scrape the cells off with a cell scraper, transfer them to a 1.5 mL centrifuge tube, and incubate on ice for lysis for 20 min.
[0112] 2) Centrifuge at 12000 rpm for 20 min at 4℃, and transfer the supernatant into a new 1.5 mL centrifuge tube;
[0113] 3) Add 5× protein loading buffer and incubate at 100℃ for 5 min to allow the protein to denature fully;
[0114] 4) Add samples to the gel wells. After loading, use a constant voltage of 80V for concentration electrophoresis to compress the samples to the same level and clearly separate the protein markers. Then adjust to a constant voltage of 120V for separation electrophoresis.
[0115] 4) After electrophoresis, transfer the membrane under a constant current of 300mA;
[0116] 4) After the transfer is complete, place the PVDF membrane in 5% skim milk and seal it on a slow shaker at room temperature for 2 hours.
[0117] 5) Wash the membrane three times with PBST, 5 min each time;
[0118] 6) Dilute the required antibody to a specific concentration with 5% BSA, incubate the antibody strips overnight on a slow shaker at 4°C;
[0119] 7) Primary antibody recovery, PBST washing of the membrane 3 times for 5 min, secondary antibody prepared with 5% skim milk powder, incubated at room temperature for 2 h;
[0120] 8) Wash the membrane three times with PBST, 5 min each time;
[0121] 9) Develop using a Tanon exposure machine;
[0122] 10) Use ImageJ software to perform grayscale value statistics on the stripes.
[0123] The results are as follows Figure 3 As shown in Figure B, *** indicates a significant difference (P < 0.001).
[0124] Depend on Figure 3 From B, it can be concluded that the hsa-EPPIR-OE plasmid can effectively reduce doxorubicin-induced cardiomyocyte apoptosis.
[0125] 3. Western blot analysis was performed to detect the expression level of KDM6B in Dox-induced cardiomyocyte apoptosis induced by the hsa-EPPIR-OE plasmid in Example 3. The results are as follows: Figure 3 As shown in Figure C, *** indicates a significant difference (P < 0.001).
[0126] Depend on Figure 3 From the results, we can conclude that doxorubicin-induced upregulation of KDM6B protein levels in cardiomyocytes, and that the hsa-EPPIR-OE plasmid can effectively reduce KDM6B protein levels.
[0127] 4. Western blot analysis of the expression levels of p-p53 and p53 after Dox-induced cardiomyocyte apoptosis by the hsa-EPPIR-OE plasmid in Example 4. The results are as follows: Figure 3 As shown in D.
[0128] Depend on Figure 3 From the results, we can conclude that doxorubicin-induced upregulation of p-p53 and p53 protein levels in cardiomyocytes, and that the hsa-EPPIR-OE plasmid can effectively reduce the protein levels of phosphorylated p53 (p-p53, phosphorylation site SER53) and p53, thereby inhibiting their activation.
[0129] The above examples demonstrate that reagents overexpressing humanized hsa-EPPIR plasmids can improve cardiac function after doxorubicin administration. By regulating the activity of histone demethylase KDM6B, it controls histone methylation and p53 activity, thereby inhibiting cardiomyocyte apoptosis after doxorubicin administration. This provides a new approach for drug development and a drug target for the diagnosis and treatment of doxorubicin-induced cardiac injury and / or heart failure.
[0130] Example 4
[0131] 1. Cell model establishment and grouping
[0132] The human non-small cell lung cancer cell line A549 was divided into two groups: an doxorubicin treatment group (Dox) (experimental group) and a saline group (Saline) (control group).
[0133] Experimental group: Dox powder was prepared into a stock solution of 0.5 mg / mL using physiological saline, and doxorubicin (final concentration 0.3 uM) was added to the cell culture medium and treated in the dark for 24 h.
[0134] Control group: treated with an equal volume of physiological saline, with other procedures the same as the experimental group.
[0135] 2. hsa-EPPIR-OE plasmid transfection
[0136] The cells in the control group and the experimental group were divided into two groups, which were designated as Saline+Ctr, Saline+hsa-EP PIR-OE, Dox+Ctr, and Dox+hsa-EPPIR-OE groups, respectively.
[0137] 1) A549 cells were passaged into 12-well plates and cultured at a cell density of 70%-80%.
[0138] 2) Prepare cell transfection reagent A solution: Add 2 μg of hsa-EPPIR-OE plasmid (Ctr is an equal amount of pLKO.1 plasmid) to 500 μL of serum-free culture medium, mix gently, and let stand for 5 min;
[0139] 3) Prepare cell transfection reagent B: Add 4 μL of Lipo2000 transfection reagent to 500 μL of serum-free culture medium, mix gently, and let stand for 5 min;
[0140] 4) Gently mix cell transfection solution A with solution B and let stand at room temperature for 15-20 minutes;
[0141] 5) Remove the old cell culture medium from the cell plate and add 1 mL of the mixed plasmid transfection reagent to each well.
[0142] 6) Replace with normal culture medium after 6-8 hours;
[0143] Test Example 3
[0144] 1. Western blot analysis of apoptosis protein levels in A549 cells treated with Dox using the hsa-EPPIR-OE plasmid in Example 4. The results are as follows: Figure 4 As shown in Figure A, *** indicates a significant difference (P < 0.001), and ns indicates no significant difference.
[0145] Depend on Figure 4 From A, it can be concluded that the hsa-EPPIR-OE plasmid has no significant effect on doxorubicin-induced apoptosis in A549 cells.
[0146] 2. Western blot analysis of the expression levels of p-p53 and p53 in Dox-treated A549 cells by the hsa-EPPIR-OE plasmid in Example 5. The results are as follows: Figure 4As shown in Figure B, *** indicates a significant difference (P < 0.001), and ns indicates no significant difference.
[0147] Depend on Figure 4 From B, it can be concluded that the hsa-EPPIR-OE plasmid has no significant effect on the activation of p53 protein in A549 cells induced by doxorubicin.
[0148] The above examples show that overexpression of the humanized hsa-EPPIR plasmid has no significant effect on tumor cell apoptosis after doxorubicin administration. Overexpression of the humanized hsa-EPPIR plasmid can serve as a cardiomyocyte-specific p53 inhibitor, providing a new approach for drug development and a drug target for the diagnosis and treatment of doxorubicin-induced cardiac injury and / or heart failure.
[0149] Example 5
[0150] 1. Preparation of humanized hsa-EPPIR extracellular vesicles: The construction steps are as follows.
[0151] 1) Pass the 293T host cells into six-well plates and culture them to a cell density of 70%-80%;
[0152] 2) Prepare cell transfection reagent A: Add 4 μg of hsa-EPPIR-OE plasmid to 500 μL of serum-free culture medium, mix gently, and let stand for 5 min;
[0153] 3) Prepare cell transfection reagent B: Add 8 μL of Lipo2000 transfection reagent to 500 μL of serum-free culture medium, mix gently, and let stand for 5 min;
[0154] 4) Gently mix cell transfection solution A with solution B and let stand at room temperature for 15-20 minutes;
[0155] 5) Remove the old cell culture medium from the cell plate, add 1 mL of serum-free culture medium to each well, and after standing, add 1 mL of well-mixed plasmid transfection reagent.
[0156] 6) Replace with normal culture medium after 6-8 hours;
[0157] 7) After 48 hours, add puromycin (1 μg / mL) to remove cells that have not been transfected with plasmids, and observe the cell status after 24 hours.
[0158] 8) Maintain a suitable Puro concentration until no floating dead cells are found after adding Puro and the cells grow normally, and obtain a stable 293T transgenic cell line that stably overexpresses humanized hsa-EPPIR, denoted as 293T-hsa-EPPIR;
[0159] 9) Expand the cell culture from the six-well plate to a culture dish and continue culturing in normal culture medium containing Puro.
[0160] 10) Collect the supernatant of the stable 293T transgenic cell line overexpressing humanized hsa-EPPIR prepared in step 9) and perform ultracentrifugation. The specific steps include: centrifugation at 500g for 5 min; centrifugation at 3000g for 10 min; centrifugation at 12000g for 45 min; filter the supernatant using a 0.22 μm filter, and centrifuge the filtered supernatant at 100000g for 70 min. All centrifugations are performed at 4℃ to obtain humanized hsa-EPPIR extracellular vesicles, denoted as EVs-has-EPPIR.
[0161] Test Example 4
[0162] 1. Using the stable transgenic control plasmid 293T as the control group, the stable transgenic 293T transgenic strain overexpressing humanized hsa-EPPIR, prepared in step 9) of Example 5, was detected by real-time quantitative PCR. The internal reference gene was 5S, and the 5S primers were purchased from Guangzhou Ruibo Biotechnology Co., Ltd., China, product number MQPS0000001, product name Bulge-Loop 5S qPCR Primer Set. The calculation results are as follows. Figure 5 As shown in Figure A, *** indicates a significant difference (P < 0.001). Figure 5 From A, we can conclude that the stable cell line was successfully constructed and stably overexpressed humanized hsa-EPPIR.
[0163] 2. Using the stable transgenic control plasmid 293T as the control group (Ctr), the enrichment efficiency of the humanized hsa-EPPIR extracellular vesicles prepared in Example 5 was detected by real-time quantitative PCR. The internal reference gene was U6, and the U6 primers were purchased from Guangzhou Ruibo Biotechnology Co., Ltd., China, product number MQPS0000002, product name Bulge-Loop U6 qPCR Primer Set. The results are as follows. Figure 5 As shown in B in the figure, *** indicates a significant difference (P < 0.001).
[0164] Depend on Figure 5 From B, we can conclude that the extracellular vesicles isolated from the stable transgenic strain were successfully enriched with humanized hsa-EPPIR.
[0165] 3. Nanoparticle tracking analysis was used to detect the size and concentration of extracellular vesicles enriched with humanized hsa-EPPIR cells. The results are as follows: Figure 5 As shown in C:
[0166] Depend on Figure 5 From C, it can be concluded that this embodiment successfully obtained extracellular vesicles with stable enrichment of humanized hsa-EPPIR.
[0167] The above examples demonstrate that inhibiting the expression of lysine-specific demethylase 6B can prevent and treat heart disease caused by anticancer drug administration, thus providing cardioprotection for clinical tumor treatment.
[0168] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. The application of a reagent for overexpressing humanized hsa-EPPIR in the preparation of a drug for preventing and treating heart disease induced by doxorubicin administration; wherein the reagent for overexpressing humanized hsa-EPPIR is a recombinant expression vector for overexpressing humanized hsa-EPPIR; the nucleotide sequence of the humanized hsa-EPPIR is shown in SEQ ID NO.1; and the heart disease is myocardial injury.
2. The application according to claim 1, characterized in that, The heart disease mentioned is heart failure.
3. The application according to claim 1, characterized in that, The initial vector for the recombinant expression vector includes a lentiviral vector or an adeno-associated virus vector.
4. The application according to claim 3, characterized in that, The lentiviral vector comprises pLKO.1; the humanized hsa-EPPIR is inserted between the EcoRI and AgeI restriction sites of pLKO.
1.
5. The application according to claim 1, characterized in that, The reagent for overexpressing humanized hsa-EPPIR includes a lentivirus that overexpresses humanized hsa-EPPIR.
6. The application according to claim 1, characterized in that, The reagent for overexpressing humanized hsa-EPPIR includes extracellular vesicles enriched with humanized hsa-EPPIR.
7. A drug for preventing myocardial injury induced by doxorubicin administration, characterized in that, The active ingredient of the drug includes a reagent for overexpressing humanized hsa-EPPIR, wherein the reagent for overexpressing humanized hsa-EPPIR is a recombinant expression vector for overexpressing humanized hsa-EPPIR; the nucleotide sequence of the humanized hsa-EPPIR is shown in SEQ ID NO.
1.
8. The medicament according to claim 7, characterized in that, The reagent for overexpressing humanized hsa-EPPIR includes a lentivirus that overexpresses humanized hsa-EPPIR.
9. The drug according to claim 7, characterized in that, The reagent for overexpressing humanized hsa-EPPIR includes extracellular vesicles enriched with humanized hsa-EPPIR.
Citation Information
Patent Citations
Application of piR-mmu-57256903 in preparation of medicine for preventing and treating heart diseases caused by anti-cancer medicine
CN116574798A
Short Non-Coding Protein Regulatory RNAs (sprRNAs) and Methods of Use
US20180273941A1