Lipid nanoparticle cryoprotectants

Abstract

The invention discloses a cryoprotectant of lipid nanoparticles, the cryoprotectant comprises a substance which forms a glassy state in a freezing process, and the cryoprotectant further comprises 5-70% by volume of plasma and / or serum. The cryoprotectant solves the problems of function damage and particle size increase in the LNP cryopreservation process, is easy and convenient to operate, wide in applicability and small in immunoreaction, facilitates application of LNP in development of clinical products, and assists popularization of LNP in the fields of clinical treatment, disease prevention and the like.

Description

Technical Field

[0001] The present disclosure relates to the field of biomedicine, and in particular, to a cryoprotectant for lipid nanoparticles. Background Art

[0002] Lipid nanoparticles (LNPs) have important application value in areas such as nucleic acid drug delivery. However, as many lipid nanoparticle-based formulations approach the clinical application stage, their stability and the impact of optimal storage conditions (including temperature, physical state, and the use of cryoprotectants) on nanoparticle stability and efficacy are still not fully understood. The stability of nanoparticles generally refers to the retention of their physicochemical properties (such as size and charge) over a period of time. Lipid nanoparticles self-assemble due to hydrophobic, hydrophilic, and electrostatic interactions between their different components, but due to their thermodynamically unstable state, mechanical stress and chemical changes will occur over time, leading to problems such as phospholipid hydrolysis or oxidation, nanoparticle aggregation and fusion, and increased membrane permeability, thereby affecting their loading and release performance.

[0003] In order to extend the shelf life of lipid nanoparticles and promote their medium / long-term stability, commonly used strategies include the use of stabilizers (such as polyethylene glycol-modified lipids), cryoprotectants (such as sucrose, trehalose, mannitol, etc.) and the production of dry liposome products by freeze-drying. Among them, cryoprotectants are widely used in biological applications. However, at present, LNP freeze-drying technology faces many obstacles, such as (1) high cost and high equipment requirements: freeze-drying requires expensive equipment, with high purchase, maintenance and operation costs, and strict requirements on equipment performance and parameter control, and high technical barriers; (2) impaired function: the freeze-drying process will damage the structure and function of LNPs, such as destroying the lipid membrane structure, affecting the stability of drug encapsulation, and reducing the efficacy; (3) functional decline over time: LNPs under the protection of existing cryopreservation buffers still gradually decline in function during long-term storage, such as reduced transfection efficiency and inability to maintain high-efficiency delivery capabilities for a long time; (4) increased particle size affects performance: the particle size gradually increases during storage, and the physical and chemical properties change due to aggregation or fusion, affecting the in vivo behavior, reducing the performance as a drug delivery carrier, and increasing the risk of adverse reactions. Therefore, although the cryopreservation buffer in the prior art has a certain effect, it cannot prevent the problem that the LNP function gradually decreases over time, and thus it is necessary to find a new cryoprotectant to solve the above problems. Summary of the invention

[0004] Technical issues solved:

[0005] One aspect of the present disclosure is to provide a cryoprotectant for lipid nanoparticles (LNPs) in view of the defects of lipid nanoparticle (LNP) freezing buffer in the prior art, such as causing functional impairment.

[0006] Specifically, the inventors creatively use new cryoprotectants to solve the following problems existing in the prior art:

[0007] (1) Overcome the problem of decreased ultra-low temperature storage function of LNP in existing technologies.

[0008] Although the freezing buffer in the prior art has a certain effect, it cannot prevent the LNP function from gradually decreasing over time, and cannot meet the requirements of consistent in vivo and in vitro functions with fresh LNP. This technical solution solves this problem, ensuring that the function of LNP does not decrease after long-term storage at ultra-low temperature, maintaining its efficient drug delivery and transfection capabilities, such as ensuring the effective transport and expression of nucleic acid drugs in gene therapy or vaccine development, improving the effectiveness and stability of LNP as a drug carrier, and meeting the clinical and scientific research requirements for LNP functional stability.

[0009] (2) Solve the problem of LNP particle size instability and aggregation and fusion during ultra-low temperature storage.

[0010] The particle size of LNP will gradually increase under the cryopreservation technology of cryopreservation buffer in the prior art, indicating the existence of aggregation and fusion, which affects its physical and chemical properties and application effects. This technical solution can achieve a small change in particle size during long-term ultra-low temperature storage of LNP, close to the particle size state when stored at 4°C without cryoprotectant, reduce the occurrence of aggregation and fusion events, thereby maintaining the good dispersion and uniformity of LNP, enhancing its stability in interaction with cells, ensuring that it can accurately reach the target site in the body to exert its effect, and improving the accuracy and efficacy of drug delivery.

[0011] (3) Reduce the operational difficulty and cost limitations of LNP ultra-low temperature storage technology.

[0012] The high cost and complex equipment requirements of LNP freeze-drying technology limit its application in many laboratories and clinical products. This technical solution provides a simple freezing method that does not require high equipment investment and complex operation procedures. It is suitable for various laboratory scales, lowers the technical threshold, and enables more research institutions to conduct long-term ultra-low temperature storage research of LNP. It also provides an economically feasible solution for the storage of clinical LNP products, promoting the widespread application and development of LNP technology in the clinical field.

[0013] Technical solution:

[0014] A cryoprotectant for lipid nanoparticles, the cryoprotectant comprising a substance that forms a glassy state during freezing, and the cryoprotectant also comprises 5% to 70% by volume of plasma and / or serum.

[0015] Furthermore, in some embodiments, the substance that forms a glassy state during freezing may include one or more selected from carbohydrates, polymers, amino acids, polyols, hydroxyethyl starch or cyclodextrin.

[0016] Furthermore, the above-mentioned plasma and / or serum may be plasma and / or serum derived from human.

[0017] In one embodiment, the cryoprotectant of the lipid nanoparticles of the present disclosure consists of the following components: 5% by volume of glucose, 35% by volume of human plasma (Sigma-Aldrich, catalog number H4522), and the rest is PBS buffer.

[0018] Another aspect of the present disclosure is to provide a method for preparing the above-mentioned cryoprotectant, wherein the plasma and / or serum is sterilized and then mixed with the substance that forms a glassy state during the freezing process in proportion.

[0019] Another aspect of the present disclosure is to provide a lipid nanoparticle composition, which comprises lipid nanoparticles and the above-mentioned cryoprotectant.

[0020] Furthermore, in some embodiments, the volume ratio of the lipid nanoparticles to the cryoprotectant is 1:1-3.

[0021] Another aspect of the present disclosure is to provide a method for preserving lipid nanoparticles, wherein the lipid nanoparticles and the cryoprotectant are uniformly mixed in a volume ratio of 1:1 to 3, and stored at -100°C to -20°C.

[0022] Further, in some embodiments, the fluctuation range of the particle size of the lipid nanoparticles during storage is no more than ±20% of the initial particle size. The particle size of the lipid nanoparticles can be measured by conventional means in the prior art, such as dynamic light scattering (DLS), nanoparticle tracking analysis (NTA), transmission electron microscopy (TEM), scanning electron microscopy (SEM), laser diffraction (LD), atomic force microscopy (AFM), field-flow fractionation (FFF), centrifugal sedimentation analysis (Centrifugal Sedimentation), size exclusion chromatography (SEC), and the combination of the above methods.

[0023] Further, in some embodiments, the transfection efficiency of the above-mentioned lipid nanoparticles preserved is not more than 10% lower than the transfection efficiency of the initial lipid nanoparticles. In some embodiments, the preservation generally refers to the preservation of the lipid nanoparticles for about 3 days, about 5 days, about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 1 month, about 1.5 months, about 2 months, about 2.5 months, about 3 months, about 4 months, about 5 months, about 6 months, about 7 months, about 8 months, about 9 months, and about 12 months. After preservation, the measurement is performed. Preferably, in some embodiments, the above-mentioned preservation time is within about 4 weeks. The transfection efficiency of the lipid nanoparticles can be detected using methods known in the prior art. For example, in one embodiment, the transfection efficiency of the lipid nanoparticles is determined by transfecting the green fluorescent protein (GFP) mRNA carried by LNP into HEK-293T cells and then detecting GFP expression.

[0024] Another aspect of the present disclosure is to provide a nucleic acid preparation, wherein the nucleic acid preparation comprises the above-mentioned cryoprotectant.

[0025] Another aspect of the present disclosure is to provide the use of the cryoprotectant of the lipid nanoparticles in the preparation of nucleic acid drugs. In some embodiments, the nucleic acid drugs include mRNA drugs, siRNA drugs, antisense oligonucleotide (ASO) drugs, plasmid DNA (pDNA) drugs, CRISPR-related nucleic acid drugs, aptamer drugs, and ribozyme drugs.

[0026] Another aspect of the present disclosure is to provide the use of the cryoprotectant of the lipid nanoparticles in the preparation of vaccines. In some embodiments, the vaccines include mRNA vaccines, DNA vaccines, self-amplifying RNA (saRNA) vaccines, and circular RNA (circRNA) vaccines.

[0027] Beneficial effects:

[0028] (1) The problems of functional impairment and particle size increase during LNP cryopreservation were solved.

[0029] Experiments have shown that the cryoprotectant of the present invention can maintain the functional stability of LNP, and achieve no decrease in function after ultra-low temperature storage, which is consistent with the in vitro and in vivo functions of fresh LNP.

[0030] (2) Improved ease of operation.

[0031] Compared with the traditional LNP freeze-drying technology, the technical solution of the present invention is extremely easy to operate. Traditional freeze-drying technology requires complex equipment to accurately control parameters such as freezing rate and vacuum degree. The operation process involves multiple steps and requires professional technicians to operate and maintain. The present invention only needs to configure the commercial components (with reliable sources and simple pretreatment) into cryoprotectants, and then mix them with LNP in proportion. After simple operations such as medium-speed vortexing and point-shaking, they can be placed in a -80°C refrigerator for freezing. The whole process does not require special equipment and complex parameter control, and ordinary laboratory technicians can operate proficiently after simple training. In actual operation, it may take 2 to 3 days to complete a traditional freeze-drying operation, and at least 2 professional technicians are required to monitor and operate the equipment throughout the process. Using the technical solution of the present invention, from preparing materials to completing the freezing operation, a technician can complete it in half a day, which greatly shortens the operation time and reduces manpower investment.

[0032] (3) Wide applicability and low immune response.

[0033] The technical solution of the present invention is suitable for all occasions, thanks to its simple operation and low equipment requirements. Whether it is a large scientific research institution or a small laboratory or other scenario, as long as it has basic cell culture and conventional low-temperature storage equipment (such as a -80°C refrigerator), the LNP freezing method of the present invention can be implemented. Moreover, since human plasma can be used as part of the cryoprotectant, it has good biocompatibility and has a natural advantage in clinical application. The components in human plasma are similar to the physiological environment of the human body, which can reduce the immunogenicity of LNP during storage and application. It is conducive to the application of LNP in clinical products and helps its promotion in clinical treatment and disease prevention and other fields. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 The results of the effect of cryoprotectants on the transfection efficiency of LNP-GFP in the embodiments of the present disclosure are shown in Figure 1. Two LNP formulations with different transfection efficiencies, ALC-L (green) and ALC-H (red), were selected for verification experiments. The LNPs packaged with GFP were mixed with cryoprotectants of samples 1 to 8 at a ratio of 1:1 or 1:3, respectively, and stored at -80°C. After 4 weeks of storage, they were used to transfect 293T cells (transfection conditions were 10 ng GFP mRNA, transfection time 24 hours), and GFP expression level was determined by flow cytometry (with relative green fluorescent protein average fluorescence intensity as an indicator). The results showed that in the absence of a protective agent and stored at 4°C, the functions of ALC-L and ALC-H showed a gradual downward trend. In sharp contrast, when the LNP-GFP was stored at -80°C with a variety of cryoprotectants in this embodiment, the function of LNP did not decline. In addition, this study also observed that the transfection efficiency of LNP increased by 20% to 40% with the increase of the freezing solution content in some samples. After statistical analysis, the improvement was statistically significant. In summary, this study showed that the cryoprotectant in this embodiment can effectively maintain the function of LNPs with different transfection efficiencies, and provide a reliable strategy for the preservation of LNPs. In this result figure, the results are mean ± SEM, and only the statistical significance of the size is shown (ns=not significant; p<0.05; p<0.01; p<0.001);

[0035] Figure 2To investigate the effects of different cryoprotectants on the transfection efficiency and particle size of LNP-GFP in the disclosed embodiments, LNPs packaged with GFP were mixed with sample 1 and sample 2 in the disclosed embodiments at a ratio of 1:1, respectively, and stored at -80°C. After storage for 1 day and 4 weeks, they were used to transfect 293T cells (transfection conditions were 10 ng GFP mRNA and transfection time was 24 hours). The GFP expression level was determined by flow cytometry (with the relative mean fluorescence intensity of green fluorescent protein as an indicator), and the particle size of LNP was evaluated to compare the transfection efficiency and particle size distribution of LNP under different storage conditions. The test conditions included: a control group (without cryoprotectant), a single-component cryopreservation solution containing 5% or 10% glucose, a single-component cryopreservation solution containing 5% or 35% human plasma, and a cryopreservation solution of a combination of glucose and human plasma. The results showed that in the absence of a protective agent and stored at 4°C, the functions of ALC-L and ALC-H gradually decreased, and the single-component glucose Alternatively, although the plasma component can maintain the function of LNP to a certain extent, the effect is far inferior to the cryoprotectant in this embodiment. When the cryoprotectant in this embodiment stores LNP-GFP at -80°C, the function of LNP does not decrease. In addition, after long-term storage of LNP at -80°C using the cryoprotectant in this embodiment, the fluctuation range of the particle size is no more than ±20% of the initial particle size. After statistical analysis, the fluctuation is not statistically significant. In summary, this study shows that the cryoprotectant in this embodiment can effectively maintain the structure and function of LNP. In this result figure, the results are mean ± SEM, and only the statistical significance of the size is shown (ns=not significant; p<0.05; p<0.01; p<0.001);

[0036] Figure 3 The figure is a result diagram of in vivo functional test of two LNPs under different storage conditions on Day 1, Week 2 and Week 4 in the disclosed embodiment. The upper part is the bioluminescent images of mice on Day 1, Week 2 and Week 4 under different storage conditions; the lower part is the quantitative analysis of the corresponding bioluminescent signal intensity, and the figure shows the changes in the in vivo imaging signals of ALC-L (green) and ALC-H (red). Over time, the signal of the control group without a protective agent and stored at 4°C decreases rapidly, while the group with added cryoprotectant (especially 35% human plasma + 5% glucose) maintains a good signal for a long time under -80°C conditions, and the freezing effect is significantly better than that of single-component glucose and human plasma, indicating that the two-component cryoprotectant can significantly improve the functional retention of LNP. In this result figure, the results are mean ± SEM, and only the statistical significance of the magnitude is shown (ns = not significant; p<0.05; p<0.01; p<0.001);

[0037] Figure 4 The figure is a result of measuring the levels of IL-6 inflammatory factors in vivo at different doses after two LNPs were cryopreserved in the embodiment of the present disclosure for 4 hours and 24 hours. In this experiment, the levels of IL-6 inflammatory factors in vivo at different doses after two LNPs were cryopreserved for 4 hours and 24 hours were measured. The experimental subjects were C57 mice, and LNP ALC-L and ALC-H were injected respectively. The doses were set to 0.05 mg / kg, 0.5 mg / kg, and 5 mg / kg of mRNA, among which ALC-L was stored at 4°C without cryoprotectant (marked in green), ALC-H was stored at 4°C without cryoprotectant (marked in red), and the group containing 35% human plasma + 5% glucose cryopreservation solution at -80°C was stored (marked in blue). The experimental results showed that when a high dose of mRNA (5 mg / kg) was delivered, both ALC-L and ALC-H would induce acute inflammatory response, but it is worth noting that compared with the group without cryoprotectant, the group with cryoprotectant did not induce additional immune response. This indicates that when cryoprotectants are used to protect LNPs, the immune response triggered is smaller, the main acute immune response is caused by the LNPs themselves, and after 24 hours, the inflammatory response gradually returns to normal. In this result figure, the results are mean ± SEM, and only the statistical significance of the magnitude is shown (ns = not significant; p<0.05; p<0.01; p<0.001). DETAILED DESCRIPTION

[0038] The present invention discloses a cryoprotectant for lipid nanoparticles, and those skilled in the art can refer to the contents of this article and appropriately improve the process parameters to achieve it. It should be particularly pointed out that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention, and relevant personnel can obviously modify or appropriately change and combine the contents described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0039] In the present disclosure, unless otherwise stated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Unless otherwise expressly stated, throughout the specification and claims, the term "comprising" or its variations such as "including" or "including" etc. will be understood to include the elements or components stated, without excluding other elements or other components. The term "a", "an" and "the" include plural indicators. The term "multiple" refers to two or more. The terms "such as", "for example", etc. are intended to refer to exemplary embodiments, and are not intended to limit the scope of the present disclosure.

[0040] In the present disclosure, when a range of values ​​is provided, it should be understood that the endpoints are included in the range and each intervening value between the upper and lower limits of the range and any other specified value or intervening value in the specified range and any value in the smaller range between the specified values ​​are included unless the context clearly dictates otherwise.

[0041] In this disclosure, the term "about" generally refers to variations within a range of 0.5%-10% above or below a specified value, for example, 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% above or below a specified value.

[0042] In the present disclosure, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. The definition of common terms in molecular biology can be found in Lewin's GENES, Twelfth Edition, Jocelyn E. Krebs, Elliott S. Goldstein, Stephen T. Kilpatrick, Publisher: Jones & Bartlett Learning. The definition of common terms in biochemistry can be found in Lehninger Principles of Biochemistry, Eighth Edition, David L. Nelson, Michael M. Cox, Publisher: WH Freeman. The definition of common terms in cell biology can be found in Molecular Biology of the Cell, Sixth Edition, Bruce Alberts, Alexander Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter, Publisher: Garland Science. The definition of common terms in genetics can be found in Genetics: Analysis of Genes and Genomes, Eighth Edition, Daniel L. Hartl, Maryellen Ruvolo, Publisher: Jones & Bartlett Learning.

[0043] Unless otherwise specified, the experimental techniques herein employ conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA, which can be found in standard books such as the following: Molecular Cloning: A Laboratory Manual; Cell Biology: A Laboratory Handbook, etc.

[0044] the term:

[0045] The term "lipid nanoparticles" (Lipid Nanoparticles, LNPs) is a nanoscale delivery system composed of lipid molecules. Lipid nanoparticles can be compounded with bioactive compounds (such as nucleic acids and / or polypeptides), and are widely used in the encapsulation and targeted transport of drugs, nucleic acids (such as mRNA, siRNA) or other bioactive molecules. Typically, the particle size of LNPs is 1 to 100 nm. Typically, any method known in the art can be used to prepare the lipid nanoparticles containing the contents of the present disclosure, and to prepare a complex of a bioactive compound and the lipid nanoparticles. For example, according to the record in BiochimBiophys Acta 1979, 557:9. The storage method of lipid nanoparticles is crucial to their stability and function, especially in drug delivery and vaccine development. Cryopreservation (-20°C to -80°C) is the most commonly used long-term storage method, and freeze-drying technology can significantly improve stability and convenience. By optimizing the formulation and storage conditions, the efficiency and reliability of LNPs in drug delivery and vaccine development can be ensured. In some embodiments, the cryoprotectant disclosed herein can be applied to ordinary low-temperature freezing storage, and can also be applied to freeze-dried storage. In some embodiments, in addition to the two types of components described in the present disclosure, the cryoprotectant can also include additives known in the art to achieve corresponding functions, such as buffers (such as but not limited to PBS buffer, Tris buffer, HEPES buffer), antioxidants (such as but not limited to α-tocopherol (vitamin E), BHT (butylated hydroxytoluene)), stabilizers (such as but not limited to polyethylene glycol modified lipids, polysorbate (Tween), poloxamer (Poloxamer)), lipid auxiliary components (such as but not limited to DSPC, DOPE, cholesterol), polymers (such as but not limited to polyvinyl pyrrolidone (PVP), hydroxypropyl methylcellulose (HPMC)), amino acids (such as but not limited to histidine), metal ion chelators (such as but not limited to EDTA), etc. LNPs can be freeze-dried and stored using techniques known in the art. For example, the method described in Liangxia Ai et al. Lyophilized mRNA-lipid nanoparticle vaccines with long-term stability and high antigenicity against SARS-CoV-2, Cell Discovery volume 9, Article number: 9 (2023).

[0046] The term "substances that form a glassy state during freezing" refers to substances that form a glassy state (amorphous state) during freezing or lyophilization (freeze drying) and can ensure the stability of the product by inhibiting ice crystal growth, reducing phase separation, and protecting the structural integrity of active ingredients (such as proteins, liposomes, vaccines, etc.). In the prior art, such substances are often used as cryoprotectants for lipid nanoparticles. In some embodiments, illustrative examples include, but are not limited to, sugars (e.g., trehalose, sucrose, lactose, maltose, glucose), polymers (e.g., polyvinyl pyrrolidone (PVP), polyethylene glycol (PEG), Ficoll), amino acids (e.g., glycine, sodium glutamate), polyols (e.g., mannitol, sorbitol, glycerol, xylitol), cyclodextrin, hydroxyethyl starch (HES), and the like.

[0047] The term "plasma" is the liquid component of blood, accounting for about 55% of the volume of whole blood. It is a light yellow viscous liquid mainly composed of water, protein, electrolytes, hormones, metabolic waste and nutrients. Plasma contains fibrinogen and is obtained by treating whole blood with an anticoagulant (such as heparin, EDTA) and then centrifuging. In the present disclosure, the term "serum" can be replaced with "plasma". Serum does not contain fibrinogen (consumed during coagulation) and is obtained by centrifugation after natural coagulation of blood. In some embodiments, plasma and serum have the same function, so the cryoprotectant of the present disclosure may contain plasma, serum, or a mixture of the plasma and serum in any proportion. In some embodiments, the plasma or serum is derived from humans or other animals, for example, mice, rats, cattle (including fetal cattle, calves, adult cattle, newborn cattle), rabbits, sheep (including goats, sheep), horses, chickens, pigs, dogs, donkeys, guinea pigs, etc. In one embodiment, the plasma and / or serum is derived from humans. In some embodiments, the plasma and / or serum is sterile. The plasma and / or serum may be sterilized by any suitable method in the prior art, as long as the activity thereof is not affected, for example, by filtration using a filter membrane.

[0048] Lipid Nanoparticle Composition:

[0049] The lipid nanoparticle compositions provided by the present disclosure include:

[0050] i) Lipid nanoparticles (LNP) can be used to deliver bioactive agents to cells, tissues or animals. In some embodiments, exemplary examples of the cells include mesenchymal stem cells, hematopoietic stem cells (HSC), monocytes, endothelial progenitor cells (EPC), neural stem cells (NSC), limbal stem cells (LSC), tissue-specific primary cells or cells derived therefrom (TSC), induced pluripotent stem cells (iPSC), ocular stem cells, pluripotent stem cells (PSC), embryonic stem cells (ESC), and cells for organ or tissue transplantation.

[0051] ii) a bioactive agent delivered by the lipid nanoparticles i), the bioactive agent forming a complex with the LNP. In some embodiments, exemplary examples of the bioactive agent include mRNA, siRNA, CRISPR-Cas gene editing system components, DNA vaccines and gene therapy components, small molecule drugs and chemotherapeutic drugs (e.g., doxorubicin, paclitaxel), antisense oligonucleotides (ASO), circular RNA (circRNA), and immunomodulators.

[0052] iii) optionally including a buffer (for example, including but not limited to PBS buffer, Tris buffer, HEPES buffer), an antioxidant (for example, including but not limited to α-tocopherol (vitamin E), BHT (butylated hydroxytoluene)), a stabilizer (for example, including but not limited to polyethylene glycol-modified lipids, polysorbate (Tween), poloxamer), a lipid auxiliary component (for example, including but not limited to DSPC, DOPE, cholesterol), a polymer (for example, including but not limited to polyvinyl pyrrolidone (PVP), hydroxypropyl methylcellulose (HPMC)), an amino acid (for example, including but not limited to histidine), and a metal ion chelator (for example, including but not limited to EDTA).

[0053] iv) Carbohydrates (e.g., trehalose, sucrose, lactose, maltose, glucose), polymers (e.g., polyvinylpyrrolidone (PVP), polyethylene glycol (PEG), Ficoll), amino acids (e.g., glycine, sodium glutamate), polyols (e.g., mannitol, sorbitol, glycerol, xylitol), cyclodextrin, hydroxyethyl starch (HES).

[0054] v) Plasma or serum from humans or other animals (e.g., mice, rats, cattle (including fetuses, calves, adult cattle, newborn cattle), rabbits, sheep (including goats and sheep), horses, chickens, pigs, dogs, donkeys, guinea pigs).

[0055] In some embodiments, the volume ratio of the solution composed of i) and ii) above and the solution composed of iii) to v) above is 1:1 to 3, for example, 1:1, 1:1.2, 1:1.4, 1:1.6, 1:1.8, 1:2, 1:2.2, 1:2.4, 1:2.6, 1:2.8, 1:3. In one embodiment, the above volume ratio is 1:1. In some embodiments, in the solution composed of iii) to v), the volume percentage of v) is 5% to 70%. For example, 5%, 10%, 20%, 25%, 30%, 40%, 45%, 50%, 60%, 70%.

[0056] Example:

[0057] In order to enable those skilled in the art to better understand the technical solution of the present invention, the present invention is further described in detail below in conjunction with specific embodiments.

[0058] Example 1: Preparation of lipid nanoparticle compositions.

[0059] 1. Preparation of LNPs.

[0060] In order to facilitate the detection of the quality and function of LNP after freezing, the GFP fluorescent protein mRNA packaged in LNP is used as an example in this embodiment. Those skilled in the art can select other targets according to actual conditions, and the quality and function of their freezing should be the same or similar to that in this embodiment.

[0061] (1) Construct an in vitro transcription plasmid template for Luci-GFP mRNA using the method in the prior art: pIVT-T7-5UTR-Luciferase-E2A-GFP-U3.Hba-A90-backbone P2197.

[0062] (2) In vitro transcription of nucleic acid drug Luci-GFP mRNA:

[0063] The in vitro transcribed Luci-GFP plasmid containing the T7 promoter (TAATACGACTCACTATAGGG) was treated with enzymes to obtain a linear template. 90 A's were added to the template construction to facilitate the subsequent addition of a polyA tail to the 3' end of the mRNA to improve stability. The HiScribe™ T7 mRNA Kit was used for transcription, and CleanCap AG was added to the IVT reaction system to achieve co-transcriptional capping. At the same time, N1-methylpseudouracil (m1ψ) was used instead of uridine to reduce immunogenicity. After incubation at 37°C for 4 hours, the residual DNA template was accurately degraded with DNase I. ® RNA Cleanup Kit purifies mRNA. The concentration is measured by Nanodrop and the bands are verified by gel electrophoresis, providing high-quality nucleic acid raw materials for subsequent applications.

[0064] (3) Microfluidic pump packaging LNP:

[0065] According to the N / P ratio (charge ratio of nucleic acid to cationic lipid) of 6 and the required nucleic acid mass, the required amount of cationic lipid was calculated, and the lipid was dissolved in anhydrous ethanol to form the oil phase according to the ALC-L formula molar ratio (ALC-0315: PEG: cholesterol: phospholipid (DSPC) = 46.3: 1.6:42.7: 9.4) and the ALC-H formula molar ratio (ALC-0315: PEG: cholesterol: phospholipid (DSPC): sphingomyelin = 39: 1.6:39.5:4:8:8), and Luci-GFP mRNA was added to a 50mM sodium citrate solution at pH = 4.0 as the aqueous phase. LNP was packaged by microfluidic chip technology to construct an LNP system with specific functions and structures. By detecting LNP-10ng GFP transfected 293T cells, the GFP positive rate reached more than 90%, which was consistent with the subsequent detection of the effect of cryoprotectant.

[0066] (4) Dialysis and filtration sterilization:

[0067] The LNP packaging product obtained above was used to prepare a SpectraPor ® The dialysate was 1xPBS, and the dialysis medium was replaced with new PBS after 1 hour of dialysis and continued to be dialysed for 2 hours. ®-GV FilterUnit (Millipore). The filter membrane is sterilized to remove impurities, unreacted substances and possible microorganisms to obtain a pure LNP sample that meets the experimental requirements for subsequent mixing with a cryoprotectant.

[0068] 2. Preparation of cryoprotectant.

[0069] This experiment uses commercially available human plasma, specifically human male AB type plasma from the United States (Sigma-Aldrich, product catalog number H4522). AB type plasma is used because it has the characteristics of reducing the probability of immune rejection, which can provide strong support for the storage stability of LNP. The obtained plasma must undergo a strict sterile filtration process to effectively remove possible impurities, various microorganisms, etc., to maximize the purity of the plasma and avoid adverse interference with the subsequent experimental process and LNP storage effect. The cryoprotectant in the embodiment of the present disclosure may include 5% to 70% plasma and / or serum by volume, and form a glassy substance during the freezing process. In addition, those skilled in the art can select other biocompatible components with similar functions, such as plasma from different sources (such as mouse plasma, bovine plasma, etc.), or use other sugars, polymers, etc. as cryoprotectant components. In addition, the volume percentage of plasma can also be adjusted according to specific needs, usually between 5% and 70%. For example, using 10%, 30% or 50% human plasma formula can obtain a good cryoprotective effect. For example, a cryoprotectant is prepared according to the configuration in Table 1 below.

[0070] Table 1

[0071]

[0072] After configuration, store the cryoprotectant sample at 4°C to maintain its stability for subsequent use at a ratio of 1:1 to 1:3.

[0073] 3. Mixing operation of LNP and cryoprotectant.

[0074] According to the specific experimental requirements, take an appropriate amount of two LNPs (ALC-L and ALC-H) with different transfection efficiencies that have been pre-treated. Mix the cryoprotectant samples 1 to 8 that were pre-configured and stored at 4°C with the measured LNPs in a volume ratio of 1:1 or 1:3. Use a Vortex Genie2 vortex oscillator at a medium speed of about 1500-2000rpm to stir the mixed system so that the cryoprotectant and LNP are fully mixed and uniform, ensuring that the LNP can be evenly dispersed in the cryoprotectant, so that the cryoprotectant can fully exert its protective effect on the LNP and avoid differences in protective effects due to uneven local concentrations. Perform a spot-shaking operation to remove bubbles that may exist in the mixed solution. Since bubbles may cause problems such as local pressure changes and oxidative stress during LNP storage, removing bubbles is extremely critical to ensuring the stability and quality of LNP storage.

[0075] 4. Frozen storage.

[0076] The mixed solution obtained by the above treatment is placed in a -80°C refrigerator to complete the freezing process of LNP. In this ultra-low temperature environment, combined with the effect of the protective agent prepared in this example, it is expected to achieve long-term stable storage of LNP.

[0077] Example 2: Verification of the cryopreservation effect.

[0078] 1. The effect of cryoprotectants on the quality parameters of frozen LNPs.

[0079] The average particle size, polydispersity index (PDI) and zeta potential of the exemplary LNP samples obtained in Example 1 were measured using a Zetasizer Nano (Malvern Instruments, Malvern, UK) using dynamic light scattering technology. The cryopreservation period was the first day and the fourth week. The results are shown in Figure 2 A and Figure 2 As shown in B. The results show that the particle size of LNPs frozen with the cryoprotectant prepared in Example 1 remained basically stable during long-term storage at -80°C, which was comparable to the particle size of LNPs stored at 4°C without the addition of cryoprotectant. This indicates that the cryoprotectant in Example 1 effectively reduced the aggregation and fusion of LNPs and maintained their particle size stability.

[0080] 2. In vitro functional verification (transfection efficiency).

[0081] The LNP obtained in Example 1 after freezing using samples 1 to 8 was used in an experiment to transfect cells for 24 hours. The above LNP was taken out on the first day and / or the fourth week after freezing. The specific operation is as follows: a certain amount (such as 10ng) of LNP containing GFP mRNA was added to 0.05M / 96-well 293T cell culture medium, and after culturing for 24 hours under standard culture conditions, the cells were collected and data was collected using a flow cytometer, focusing on the GFP mean fluorescence intensity (GFP-MFI) indicator, which can accurately reflect the intracellular GFP expression level. In order to reduce the interference of system errors, the measured GFP-MFI was divided by the GFP-MFI of 293T WT cells to obtain the relative value of GFP-MFI (Relative GFP MFI). The transfection efficiency of the LNP after freezing is thus evaluated, and compared with the transfection efficiency of the freshly prepared LNP to determine whether they are consistent or close. The results are as follows Figure 1 A and Figure 1 B. Figure 2 A and Figure 2 As shown in B. The results show that the transfection efficiency and particle size distribution changes under different storage conditions were compared. The control group (Con) was LNP stored at 4°C without the addition of cryoprotectant. The freezing conditions included no cryoprotectant (NO CPA), 5% or 10% glucose (Glc) and 5% or 35% human plasma (Plasma), or a combination of the two. The single component and the cryoprotectant in Example 1 had a significant effect as a protective agent in preserving LNP-GFP expression, and significantly increased the relative fluorescence intensity of GFP compared to the group without a protective agent. Among them, the cryoprotectant in Example 1 showed a better protective effect and was suitable for long-term low-temperature storage of LNP.

[0082] 3. In vivo functional verification.

[0083] Animal experiments were performed in accordance with protocols approved by the SKLEH Institutional Animal Care and Use Committee. Cryopreserved LNPs and fresh LNPs were diluted to Luci 1ug / ml using PBS and injected into C57 mice at a dose of 0.02mg / kg. Four hours after injection, mice were imaged in vivo using the Spectrum Small Animal In vivo Optical Imaging System. The distribution, retention, and expression of LNPs in vivo were evaluated by detecting the intensity and distribution of bioluminescent signals (Radiance, p / sec / cm² / sr), and the differences in in vivo function between cryopreserved LNPs and fresh LNPs were compared to determine whether the cryopreservation process had a significant effect on the in vivo function of LNPs, thereby comprehensively evaluating the consistency or closeness of the functional properties of cryopreserved LNPs with those of fresh LNPs.

[0084] The results are as follows Figure 3As shown. The upper part shows the bioluminescent images of mice at Day 1, Week 2, and Week 4 under different storage conditions; the lower part shows the quantitative analysis of the corresponding bioluminescent signal intensity. The figure shows the changes in the in vivo imaging signals of ALC-L (green) and ALC-H (red). The results showed that over time, the signal of the group without cryoprotectant decreased rapidly, while the signal of the group with cryoprotectant added (especially 35% human plasma + 5% glucose) was maintained better at -80°C, indicating that the combination of cryoprotectants can significantly improve the functional retention of LNPs.

[0085] 4. Determination of IL-6 inflammatory factor levels in mouse plasma.

[0086] 4h and 24h after LNP injection, 90μl of whole blood was collected from the tail vein of mice and transferred to EP tubes containing 10μl 3.2% sodium citrate solution (i.e., 1:9) for anticoagulation. The blood samples were centrifuged at 2000×g, 12℃ for 20min, and the supernatant was taken as plasma. The IL-6 level in plasma was detected using Basic IL-6 Mouse ELISA Kit (Invitrogen). According to the instructions, the standard was diluted into a series of concentrations for drawing the standard curve. The collected plasma samples were appropriately diluted (according to the ratio recommended in the instructions). The standards and diluted samples were added to the pre-coated microplate. The microplate was sealed with a sealing film and placed in a constant temperature incubator for 2 hours. After the incubation, the microplate was washed using a plate washer. Then 100μl IL-6 Biotin Conjugate solution was added and incubated at room temperature for 30min. After the incubation, the microplate was washed using a plate washer. Then add 100ul Streptavidin-HRP solution and incubate at room temperature for 30 minutes. After incubation, wash the microplate using a plate washer. Add substrate solution to each microwell and incubate in the dark for 15-20 minutes. Add stop solution to stop the enzymatic reaction. Use a microplate reader to read the absorbance (OD450 value) of each microwell. Calculate the concentration of IL-6 in the sample based on the standard curve.

[0087] The results are as follows Figure 4 The results show that when high doses of mRNA (5 mg / kg) were delivered, both ALC-L and ALC-H induced acute inflammatory responses, but it is worth noting that the groups with cryoprotectants did not induce additional immune responses compared to the groups without cryoprotectants. This indicates that when cryoprotectants are used to protect LNPs, the immune response induced is small, the main acute immune response is caused by the LNPs themselves, and after 24 hours, the inflammatory response gradually returns to normal.

[0088] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A cryoprotectant for lipid nanoparticles, the cryoprotectant comprising a substance that forms a glassy state during freezing, characterized in that: The cryoprotectant also includes 5% to 70% by volume of plasma and / or serum.

2. The cryoprotectant according to claim 1, characterized in that The substance that forms a glassy state during freezing includes one or more selected from sugars, polymers, amino acids, polyols, hydroxyethyl starch or cyclodextrin.

3. The cryoprotectant according to claim 1, characterized in that The plasma and / or serum is plasma and / or serum derived from human.

4. The method for preparing a cryoprotectant according to any one of claims 1 to 3, characterized in that: The plasma and / or serum is aseptically treated and then mixed with the substance that forms a glassy state during freezing in proportion.

5. A lipid nanoparticle composition, characterized in that: The lipid nanoparticle composition comprises lipid nanoparticles and the cryoprotectant according to any one of claims 1 to 3.

6. The lipid nanoparticle composition according to claim 5, characterized in that The volume ratio of the lipid nanoparticles to the cryoprotectant is 1:1-3.

7. A method for preserving lipid nanoparticles, characterized in that: The lipid nanoparticles are uniformly mixed with the cryoprotectant as described in any one of claims 1 to 3 in a volume ratio of 1:1 to 3, and stored at -100°C to -20°C.

8. The storage method according to claim 7, characterized in that: The fluctuation range of the particle size of the lipid nanoparticles during storage is no more than ±20% of the initial particle size.

9. The storage method according to claim 7, characterized in that: The transfection efficiency of the preserved lipid nanoparticles decreases by no more than 10% compared with the transfection efficiency of the initial lipid nanoparticles.

10. A nucleic acid preparation, characterized in that: The nucleic acid preparation comprises the cryoprotectant according to any one of claims 1 to 3.

Images