Application of a CD40 antibody and LPS costimulated genetically modified B cell in the treatment of cancer

Through CD40 antibody and LPS-costimulated gene modification B cells, the dFv-LDP protein gene was electrotransmitted, which solved the problems of short survival time of B cells and tumor antigen escape, and achieved long-term expression of dFv-LDP protein, significantly reducing tumor volume and weight and reducing treatment costs.

CN119746105BActive Publication Date: 2025-07-11INSTITUTE OF BASIC MEDICAL SCIENCES CHINESE ACADEMY OF MEDICAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411976224.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-31
Publication Date
2025-07-11
Estimated Expiration
2044-12-31

AI Technical Summary

Technical Problem

In the prior art, B cells survive in the treatment of tumors for a short time and require multiple injections, which increases the treatment cost and is difficult to solve the problem of tumor antigen escape. The prior art cannot effectively treat tumors.

Method used

B cells that were costimulated by CD40 antibodies and LPS were used to modify B cells and electrotransfer the dFv-LDP protein gene to prepare long-term expression of dFv-LDP protein for the treatment of cancer.

Benefits of technology

The long-term expression of dFv-LDP protein in B cells in vivo was achieved, which significantly reduced the tumor size and weight, reduced the economic burden of patients' multiple injections, and improved the therapeutic effect on tumors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119746105B_ABST
    Figure CN119746105B_ABST
Patent Text Reader

Abstract

The present invention discloses the application of CD40 antibody and LPS co-stimulated genetically modified B cells in the treatment of cancer, belonging to the field of biotechnology. First, the present invention discovers that B cells co-stimulated by LPS and anti-CD40 antibody can be used as cell vectors for gene therapy, continuously expressing dFv-LDP protein in vivo to treat cancer. The present invention discovers that B lymphocytes can continuously express dFv-LDP protein for a long time, solves the problem of too rapid reduction of the blood drug concentration of scFv protein to achieve a better therapeutic effect than directly injecting dFv-LDP protein, and at the same time can reduce the economic burden on patients caused by multiple injections of scFv protein.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to the application of CD40 antibody and LPS co-stimulated gene-modified B cells in the treatment of cancer. Background Art

[0002] Gene therapy refers to a treatment technology that inserts functional genes into the somatic cells of a patient to correct congenital genetic errors or provide new functions for the cells. The current aims of clinical gene therapy are: to correct dysfunctional cells (HSC), increase secreted proteins (AAV - liver), and eliminate cancer cells (CAR - T cells). Gene transfer strategies include: in a living organism (viral vectors, non - viral vectors (with lower efficiency)), and in vitro (stem / progenitor cells).

[0003] B cells, also known as B lymphocytes, are an important part of the immune system and are mainly responsible for the humoral immune response. B cells have the potential to be used as therapeutic gene carriers, but most treated B cells can only survive for one to two months. Therefore, for long - term gene therapy, more long - lasting B cells are needed. Summary of the Invention

[0004] In the prior art, only LPS is used to activate B lymphocytes, and they need to be cultured in vitro for 16 days before being transfused back for treatment. The prior art requires screening for successfully edited B cells before transfusion, which increases the treatment cost for patients. Currently, one of the major difficulties in tumor treatment is the escape of tumor antigens. Since the prior art requires antigen stimulation to secrete antibodies, it is not suitable for the treatment of tumors.

[0005] Therefore, in order to solve the technical problems existing in the prior art, the present invention provides the following technical solutions.

[0006] The present invention provides the application of CD40 antibody and LPS co - stimulated gene - modified B cells in the preparation of a pharmaceutical composition for the treatment of cancer.

[0007] Furthermore, the protein expressed by the gene can treat cancer.

[0008] Furthermore, the gene - modified B cells are B cells expressing the dFv - LDP protein.

[0009] Furthermore, the B cells include naive B cells, conventional B cells, follicular B cells, marginal zone B cells, B1 cells, memory B cells, and plasma cells.

[0010] Furthermore, the B cells are naive B cells.

[0011] Furthermore, the pharmaceutical composition includes pharmaceutically acceptable adjuvants.

[0012] Furthermore, the adjuvant includes a diluent, a dispersion aid, a suspension aid, a surfactant, an isotonic agent, a thickening or emulsifying agent, a preservative, a solid binder, and a lubricant.

[0013] In some embodiments, the dFv-LDP protein (dual single-chain Fv fragment-linked C-1027 protein) refers to a fusion protein prepared by genetic engineering methods, which consists of the single-chain antibody scFv of the anti-type IV collagenase antibody 3G11 and the C-1027 apoprotein LDP. The dFv-LDP protein has an inhibitory effect on the growth of various tumor cells. The dFv-LDP protein shows good tumor targeting ability in in vivo experiments, especially in the ectopic xenograft tumors of human liver cancer Bel-7402, highly metastatic lung cancer PG-BE1, and colon cancer HCT-116 nude mice.

[0014] Furthermore, the pharmaceutical composition is administered orally, rectally, perilesionally, on the surface of the lesion, topically, intravenously, parenterally, intraperitoneally, intramuscularly, intralesionally, intrathecally, intranasally, or subcutaneously.

[0015] The term "pharmaceutically acceptable" in the present invention designates that the specified adjuvant is generally chemically and / or physically compatible with the other components constituting the formulation, and is physiologically compatible with its recipient.

[0016] Pharmaceutically acceptable adjuvants for use in the compositions of the present invention may include, but are not limited to, for example, pharmaceutically acceptable liquid, gel, or solid carriers, aqueous media (such as sodium chloride injection, Ringer's injection, isotonic glucose injection, sterile water injection, or Ringer's glucose and lactate injection), non-aqueous media (such as non-volatile oils of plant origin, cottonseed oil, corn oil, sesame oil, or peanut oil), antimicrobial agents, isotonic agents (such as sodium chloride or dextrose), buffers (such as phosphate or citrate buffers), antioxidants (such as sodium bisulfate), anesthetics (such as procaine hydrochloride), suspension / dispersion agents (such as sodium carboxymethylcellulose, hydroxypropyl methylcellulose, or polyvinylpyrrolidone), chelating agents (such as EDTA (ethylenediaminetetraacetic acid) or EGTA (ethylene glycol tetraacetic acid)), emulsifying agents (such as polysorbate 80 (Tween-80)), diluents, adjuvants, excipients, or non-toxic auxiliary substances, other components known in the art, or various combinations thereof. Suitable components may include, for example, fillers, binders, disintegrants, buffers, preservatives, lubricants, flavoring agents, thickening agents, coloring agents, or emulsifying agents.

[0017] As used in the present invention, the term "B cell" refers to bone marrow-dependent lymphocytes, which originate from the bone marrow and account for 50 - 10% of the total number of blood lymphocytes. Naive B cells that mature in the bone marrow leave the bone marrow and migrate into peripheral lymphoid organs and tissues. After being stimulated by an antigen, they proliferate and differentiate into effector B cells, namely plasma cells, which synthesize and secrete antibodies to exert immune functions; a small amount is transformed into memory B cells for storage, and their function is the same as that of memory T cells. B cells have a relatively short lifespan in the body, only a few days to a few weeks, but their memory cells can survive in the body for a long time.

[0018] As used in the present invention, the term "modification" refers to any form of modification of an amino acid sequence or a nucleotide sequence, such as substitution, deletion, insertion, and / or addition of amino acids or nucleotides.

[0019] The present invention provides a pharmaceutical composition, which comprises a CD40 antibody and LPS costimulated gene-modified B cells in the aforementioned application.

[0020] Furthermore, the gene-modified B cells are B cells expressing the dFv-LDP protein.

[0021] As used herein, a "gene" can be a natural (such as genomic) gene that includes transcriptional and / or translational regulatory sequences, and / or coding regions, and / or untranslated sequences (such as introns, 5'- and 3'-untranslated sequences). The coding region of a gene can be a nucleotide sequence encoding an amino acid sequence or a functional RNA (such as tRNA, rRNA, catalytic RNA, siRNA, miRNA, or antisense RNA). The term "gene" has the meaning understood in the art. However, those of ordinary skill in the art will understand that the term "gene" has many meanings in the art, some of which include gene regulatory sequences (such as promoters, enhancers, etc.) and / or intron sequences, while others are limited to coding sequences. It should also be understood that the definition of "gene" includes nucleic acids that do not encode proteins but encode functional RNA molecules (such as tRNA). For clarity, the term "gene" as used in this application generally refers to a part of a nucleic acid encoding a protein; the term also optionally includes regulatory sequences. This definition is not intended to exclude the use of the term "gene" for non-protein-coding expression units, but rather to clarify that in most cases, the term as used herein refers to a nucleic acid encoding a protein.

[0022] In this specification, the term "long-acting" should be regarded as meaning effective after an initial dose and maintaining its effect for a relatively long period of time. In some embodiments, the long-acting property of the pharmaceutical composition provides an acceptable and sustained effect for more than 120 days after the initial dose.

[0023] As used herein, the term "CD40 antibody" or "anti-CD40 antibody" means an antibody that specifically binds to CD40. A "human CD40 antibody" or "human anti-CD40 antibody" means an antibody that specifically binds to CD40 and is composed of human immunoglobulin amino acid sequences. A human CD40 antibody that binds to human CD40 is an antibody that contains human immunoglobulin amino acid sequences that specifically bind to human CD40, although the antibody may also bind to non-human sequences that have the epitopes recognized by the human CD40 antibody.

[0024] The CD40 antibodies of the present invention include polyclonal or monoclonal antibodies, as well as fragments and modified forms as described herein. Also provided are combined polyclonal and monoclonal antibodies containing two or more different CD40 antibodies having different binding specificities, binding affinities, or functions.

[0025] The CD40 antibodies of the present invention contain κ or λ chain sequences. Each antibody molecule contains two κ or two λ light chains. The main difference between κ and λ light chains lies in the sequence of the constant region. In humans, the κ chain variable region sequence has more diversity than the λ chain variable region sequence, which results in the production of more different (diverse) antibodies. The exemplary CD40 antibody produced by hybridoma F4-465 contains a human λ light chain.

[0026] Exemplary antibodies are designated as nos. 11 (ATCC PTA-2308), 30, 72 (ATCC PTA-2309), and 366, or are produced by hybridomas designated as F1-102, F2-103, F5-77, F5-152, F5-157, and F4-465. Without wishing to be bound by theory, exemplary CD40 antibodies that inhibit CD40 activity, such as nos. 30, 72, 366, and the antibody produced by hybridoma F4-465, appear to reduce the binding of CD40L to CD40 and do not induce CD40 signaling. In contrast, CD40 antibodies that stimulate CD40 activity, such as no. 11 and the antibodies produced by hybridomas F1-102, F2-103, F5-77, F5-152, and F5-157, appear to induce CD40 signaling and enhance CD40L activity.

[0027] Unless otherwise specified, the term "LPS" refers to bacterial lipopolysaccharide, the full English name of which is lipopolysaccharide.

[0028] In some embodiments, the pharmaceutical composition further comprises other active ingredients that can be added, including but not limited to weight loss agents (appetite suppressants, anti-obesity agents), anti-acidosis agents, antihypoxia agents, analgesics (antirheumatic agents), anthelmintics, antiallergic agents, antianemic agents, antiarrhythmic agents, antibiotics (anti-infective agents), antidementia agents (nootropic agents), antidiabetic agents, antidotes, antiemetics (antivertigo agents), antiepileptic agents, antihemorrhagic agents (antifibrinolytics and other hemostatic agents), antihypertensive agents, antihypoglycemic agents, antihypotensive agents, anticoagulants, antifungal agents, antiparasitic agents, anti-inflammatory agents, antitussives (expectorants), antiatherosclerotic agents, bath agents and heat therapy agents, β-blockers, calcium channel blockers, and renin-angiotensin-aldosterone system inhibitors, bronchial agents (antiasthmatic agents), cholagogues and biliary tract therapeutic agents, cholinergic drugs, corticosteroids, dermatological agents, disinfectants (antibacterial agents), diet agents (nutritional agents), diagnostic agents and agents for preparing for diagnosis, diuretics, agents for promoting blood circulation, detoxifying agents (agents for treating addiction), enzyme inhibitors, preparations for enzyme deficiencies, transport proteins, fibrinolytic agents, geriatric drugs, anti-gout preparations, cold and influenza drugs, cough and sneeze drugs, gynecological drugs, hemorrhoid drugs (rectal drugs), hepatic drugs, hypnotics (sedatives), pituitary hormones, hypothalamic hormones, and other regulatory peptides and their inhibitors, immunomodulators.

[0029] The present invention provides a method for constructing a genetically modified B cell that can express a target protein in a long-term manner. The method includes co-stimulating B cells with LPS and anti-CD40 antibody for 1-3 days before electroporating the target gene; the target protein is a protein capable of treating cancer.

[0030] Furthermore, the B cells are in vitro cells.

[0031] Furthermore, the target protein is a dFv-LDP protein.

[0032] Furthermore, the B cells are derived from human or non-human mammals.

[0033] Furthermore, the B cells are derived from human, orangutan, monkey, horse, cow, sheep, pig, donkey, camel, dog, rabbit, cat, rat, mouse.

[0034] In an embodiment of the present invention, the B cells are derived from any animal that can produce B cells (e.g., mammals), including but not limited to humans, non-human primates, dogs, cats, rodents, etc. Furthermore, the B cells are derived from humans.

[0035] Furthermore, the construction method includes the following steps:

[0036] Add 1×10 7Add LPS and anti-CD40 antibody to B cells at a density of cells / ml, stimulate in vitro for 1-3 days, and then transform the gene vector capable of expressing the target protein into the stimulated B cells by electroporation. After that, culture them in a complete B cell medium supplemented with LPS and anti-CD40 antibody, and add a Caspase inhibitor.

[0037] Furthermore, the Caspase inhibitor is Boc-D-FMK.

[0038] Furthermore, in the construction method, Cas9 protein (Invitrogen) and purified gRNA are pre-incubated at room temperature for 30 minutes during the electroporation process. B cells are resuspended in Buffer T at a final density of 1×10 7 cells / ml, and each 10 6 cells contain 5 μg of pre-complexed Cas9 and gRNA, as well as 10 μg of DNA template. Electroporation is carried out under the conditions of 1600 V, 20 ms, and 2 pulses.

[0039] The term "electroporation" used herein, also known as electropermeabilization or transfection, refers to the transient increase in the permeability of cell membranes through the action of a high-intensity electric field, thereby absorbing exogenous molecules in the surrounding medium. This technique can introduce nucleotides, DNA and RNA, proteins, sugars, dyes, and virus particles into prokaryotic and eukaryotic cells.

[0040] The term "CRISPR / Cas9" used herein is an adaptive immune defense formed by bacteria and archaea during long-term evolution, which can be used to combat invading viruses and exogenous DNA. The CRISPR / Cas9 gene editing technology is a technology for specific DNA modification of target genes. The gene editing technology based on CRISPR / Cas9 has shown great application prospects in a series of application fields of gene therapy, such as blood diseases, tumors, and other genetic diseases. The technical achievements have been applied to the precise modification of the genomes of human cells, zebrafish, mice, and bacteria.

[0041] The term "sgRNA" used herein generally refers to single-guide RNA or single-stranded guide RNA in the artificial CRISPR / Cas9 system, which refers to the RNA that guides the Cas9 protein to specifically bind to the target nucleic acid sequence and is an important component in the CRISPR gene knockout / knock-in system. The sgRNA of this application contains a guiding sequence targeting the target sequence. In a preferred embodiment, the sgRNA of this application further contains a tracrRNA sequence and a crRNA sequence.

[0042] The present invention provides a cell, which is constructed by the construction method described above, and the cell can express a target gene in a long-term manner, and the cell is used for treating cancer.

[0043] The present invention provides the use of a CD40 antibody and LPS in the preparation of a product of gene-modified B cells that can express a target protein in a long-term manner; the target protein is a protein capable of treating cancer.

[0044] Furthermore, the target protein is a dFv-LDP protein.

[0045] In this text, the cancer types include, but are not limited to, acute lymphoblastic leukemia (ALL), acute myeloid leukemia, adrenocortical carcinoma, adult acute myeloid leukemia, adult carcinoma of unknown primary site, adult malignant mesothelioma, AIDS-related cancers, AIDS-related lymphoma, anal cancer, appendiceal cancer, astrocytoma, childhood cerebellar or cerebral cancer, basal cell carcinoma, bile duct cancer, bladder cancer, bone tumors, osteosarcoma / malignant fibrous histiocytoma, brain cancer, brainstem glioma, breast cancer, bronchial adenoma / carcinoid, Burkitt lymphoma, carcinoid tumor, carcinoma of unknown primary, central nervous system lymphoma, cerebellar astrocytoma, cerebral astrocytoma / malignant glioma, cervical cancer, childhood acute myeloid leukemia, childhood carcinoma of unknown primary site, childhood cancer, childhood cerebral astrocytoma, childhood mesothelioma, chondrosarcoma, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disorders, colon cancer, cutaneous T-cell lymphoma, desmoplastic small round cell tumor, endometrial cancer, endometrial carcinoma of the uterus, ependymoma, epithelioid hemangioendothelioma (EHE), esophageal cancer, Ewing tumor sarcoma family, Ewing sarcoma of the Ewing tumor family, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, eye cancer, intraocular melanoma, gallbladder cancer, gastric (stomach) cancer, gastric carcinoid, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (GIST), gestational trophoblastic tumor, brainstem glioma, glioma, hairy cell leukemia, head and neck cancer, heart cancer, hepatocellular (liver) cancer, Hodgkin lymphoma, hypopharyngeal cancer, hypothalamic and visual pathway glioma, islet cell carcinoma (endocrine pancreas), Kaposi sarcoma, kidney cancer (renal cell carcinoma), laryngeal cancer, acute lymphoblastic leukemia (also known as acute lymphocytic leukemia), acute myeloid leukemia (also known as acute myelocytic leukemia), chronic lymphocytic leukemia (also known as chronic lymphocytic leukemia), leukaemia, chronic myelogenous leukemia (also known as chronic myelocytic leukemia), hairy cell leukemia (leukemia), lip and oral cavity cancer, liposarcoma, liver cancer (primary), non-small cell lung cancer, small cell lung cancer, lymphoma (AIDS-related), lymphoma, Waldenström macroglobulinemia, male breast cancer, malignant fibrous histiocytoma / osteosarcoma of bone, medulloblastoma, melanoma, Merkel cell carcinoma, metastatic squamous neck cancer of unknown primary, oral cancer, multiple endocrine neoplasia syndrome, childhood multiple myeloma (bone marrow cancer), multiple myeloma / plasma cell neoplasm, mycosis fungoides, myelodysplastic syndrome, myelodysplastic / myeloproliferative diseases, chronic myelogenous leukemia, myxoma, nasal and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin lymphoma, non-small cell lung cancer, oligodendroglioma, oral cancer, oropharyngeal cancer, osteosarcoma / malignant fibrous histiocytoma of bone, ovarian cancer, ovarian epithelial carcinoma (surface epithelial stromal tumors), ovarian germ cell tumors, ovarian tumors of low malignant potential,Pancreatic cancer, islet cell carcinoma, paranasal sinus and nasal cavity cancer, parathyroid carcinoma, penile cancer, pharyngeal cancer, pheochromocytoma, pineal astrocytoma, pineal germinoma, pinealoblastoma and supratentorial primitive neuroectodermal tumor, pituitary adenoma, plasma cell neoplasm / multiple myeloma, pleuropulmonary blastoma, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell carcinoma (renal cancer), transitional cell carcinoma of the renal pelvis and ureter, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Sézary syndrome, skin cancer (melanoma), skin cancer (non-melanoma), Merkel cell skin cancer, small cell lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, metastatic squamous neck cancer with occult primary, stomach cancer, supratentorial primitive neuroectodermal tumor, cutaneous T-cell lymphoma, testicular cancer, laryngeal cancer, thymoma and thymic carcinoma, thymoma, thyroid cancer, transitional cell carcinoma of the renal pelvis and ureter, transitional cell carcinoma of the ureter and renal pelvis, urethral cancer, uterine sarcoma, vaginal cancer, visual pathway and hypothalamic glioma, childhood visual pathway and hypothalamic glioma, vulvar cancer, macroglobulinemia and Wilms' tumor (renal cancer).

[0046] Further, the cancer is pancreatic cancer.

[0047] As used herein, the term "treatment" includes prophylactic or preventive treatment (prevention of the targeted pathological condition or disorder and / or slowing of its development) and curative, therapeutic or disease-modifying treatment, including treatment measures that cure, slow, alleviate the symptoms of a diagnosed pathological condition or disorder and / or arrest its progression; and treatment of patients at risk of having an infectious disease or suspected of having been infected with a disease and patients who are ill or have been diagnosed as having a disease or medical condition. The term does not necessarily imply that an individual is treated until complete recovery. The term "treatment" also refers to maintaining and / or promoting the health of an individual who is not ill but may be susceptible to an unhealthy condition. The term "treatment" is also intended to include augmenting or enhancing one or more primary prophylactic or therapeutic measures. The term "treatment" is also intended to include dietary control of a disease or disorder or dietary control for preventing or protecting against a disease or disorder. Treatment may be patient- or physician-related.

[0048] When the term "comprising" is used, it is intended to mean that one or more components, one or more functions, one or more features mentioned or listed thereafter can be implemented not only individually, but also that one or more other components and / or features (such as other additives, other functions) can exist in addition to those specifically mentioned. This is contrary to the terms "containing" or "consisting of", which in this context mean that no other components or features are included except those specifically mentioned after the term, thus representing a complete listing / representation of the features and / or components. Wherever "comprising" is used, when possible and convenient, it can be replaced (independently of the occurrence of this term elsewhere) by the narrower term "consisting of" or (in the case of a process or method) by "steps comprising...", thereby giving rise to specific and preferred embodiments of the present invention.

[0049] Advantages and beneficial effects of the present invention:

[0050] The present invention first discovered that B cells co-stimulated by LPS and anti-CD40 antibodies can be used as cell carriers for gene therapy, continuously expressing the dFv-LDP protein in vivo to treat pancreatic cancer. The present invention found that B lymphocytes can continuously express the dFv-LDP protein, solving the problem of the too rapid reduction in the blood drug concentration of the scFv protein to achieve a better therapeutic effect than directly injecting the dFv-LDP protein, and at the same time reducing the economic burden on patients caused by multiple injections of the scFv protein. Description of the drawings

[0051] Figure 1 It is a result diagram of WB verifying the expression of the dFv-LDP protein by B lymphocytes.

[0052] Figure 2 It is a result diagram of ELISA verifying the secretion of the dFv-LDP protein by B lymphocytes three days after gene editing.

[0053] Figure 3 It is a result diagram of ELISA detecting the dFv-LDP protein in serum proteins by re-infusing mice within 16 weeks.

[0054] Figure 4 It is a statistical chart of the tumor volume results of all mice after re-infusing B lymphocytes.

[0055] Figure 5 It is a statistical chart of the tumor weight results of all mice after re-infusing B lymphocytes.

[0056] Figure 6 It is a result diagram of the abbreviation of the tumor volume of the pancreatic cancer animal model after re-infusing B lymphocytes.

[0057] Figure 7It is a statistical result graph of the survival rate of mice after reinfusion of B lymphocytes.

[0058] Figure 8 It is a result graph of the change in tumor volume of a single mouse after reinfusion of B lymphocytes. Detailed implementation manners

[0059] The terms used in this specification generally have their ordinary meanings in the art, in the context of the present invention, and in the particular context in which each term is used. Certain terms used to describe the present invention will be discussed below or elsewhere in the specification to provide additional guidance to practitioners regarding the description of the present invention. For convenience, some terms may be highlighted, such as using italics and / or quotes. The use of highlighting has no effect on the scope and meaning of the terms; in the same context, the scope and meaning of the terms are the same whether or not they are highlighted. It will be understood that the same thing can be expressed in more than one way. Therefore, for any one or more of the terms discussed herein, alternative languages and synonyms may be used, but this does not confer any special significance on whether the terms are set forth or discussed herein. Synonyms for certain terms are provided. The recitation of one or more synonyms does not exclude the use of other synonyms. The use of examples anywhere in this specification (including examples of any of the terms discussed herein) is merely illustrative and in no way limits the scope and meaning of the present invention or any of the exemplified terms. Similarly, the present invention is not limited to the various embodiments given in this specification.

[0060] Those of ordinary skill in the art will understand that, in addition to the specifically exemplified starting materials, biological materials, reagents, synthetic methods, purification methods, analytical methods, assay methods, and biological methods, other starting materials, biological materials, reagents, synthetic methods, purification methods, analytical methods, assay methods, and biological methods can also be used in the practice of the present invention without resorting to undue experimentation. All known functional equivalents of any such materials and methods are intended to be included in the present invention. The terms and expressions that have been employed are used as descriptive terms rather than restrictive terms, and in using these terms and expressions, it is not intended to exclude any equivalents of the features shown and described or parts thereof, but it should be recognized that various modifications may exist within the scope of the claimed invention. Therefore, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, those skilled in the art can make modifications and variations to the concepts disclosed herein, and such modifications and variations are considered to be within the scope of the present invention defined by the appended claims.

[0061] Example 1

[0062] 1. Experimental method

[0063] 1) Isolation and culture of primary B cells from mice

[0064] Naive B cells were isolated from BALB / c mice using Mouse 1× Lymphocyte Separation Medium (7211011, DAKEWE), and purified using Mouse CD43 (Untouched TM B Cells) (11422D, Invitrogen). Briefly, whole spleens were extracted from the spleens of 8-week-old male Balb / c mice and mechanically disrupted in Mouse 1× Lymphocyte Separation Medium. Centrifuge at 800 g for 30 minutes at room temperature without braking. Aspirate the mononuclear cell layer, add ten volumes of RPMI 1640 medium, and centrifuge at 300 g for 10 minutes at room temperature. The cells were resuspended in 2% FBS / PBS, and then Mouse CD43 (Untouched TM B Cells) (11422D, Invitrogen) magnetic beads were used for negative selection of Naive B cells. Naive B cells were cultured in RPMI 1640 medium supplemented with 15% FBS and 20 ng / μl LPS (L2630, Sigma), 10 ng / μl anti-CD40 monoclonal antibody (16-0401-82, Invitrogen), 50 μM β-mercaptoethanol, GlutaMAX, NEAA, penicillin (100 U / ml), and streptomycin (100 μg / ml; Gibco), at a final density of 1×10 7 cells / ml.

[0065] 2) Electroporation

[0066] B cells co-stimulated with LPS and anti-CD40 antibody were electroporated using the Neon transfection system 1 - 3 days after in vitro stimulation. The Raso26 gRNA sequence was GGATTCTCCCAGGCCCAGGG, with CGG as the protospacer adjacent motif (PAM) site. Cas9 protein (Invitrogen) and purified gRNA were pre-incubated at room temperature for 30 minutes. B cells were resuspended in Buffer T at a final density of 1×10 7 cells / ml, with 5 μg of pre-complexed Cas9 and gRNA, and 10 μg of DNA template per 10 6 cells. Electroporation was performed under the conditions of 1600 V, 20 ms, 2 pulses, and cultured in complete B cell medium (supplemented with LPS and anti-CD40 antibody), plus the Caspase inhibitor Boc-D-FMK (ab142036, Abcam).

[0067] 2. Experimental Results

[0068] 1) After gene editing, it was verified by WB that B lymphocytes could express the dFv-LDP protein

[0069] B cells transfected with the RNP and the homologous repair template of dFv-LDP, as well as B cells transfected only with the homologous repair template of dFv-LDP, could express the dFv-LDP protein ( Figure 1 ). Among them, the dFv-LDP protein has been reported in existing articles, and the specific amino acid sequence is as follows: MQVKLQQSGTEVVKPGASVKLSCKASGYIFTSYDIDWVRQTPEQGLEWIGWIFPGEGSTEYNEKFKGRATLSVDKSSSTAYMELTRLTSEDSAVYFCARGDYYRRYFDLWGQGTTVTVSSGGGGSGGGGSGGGGSDIELTQSPASLAVSLGQRATISCRASESVDTYGDTFMYWYQQKPGQPPKLLIYLATNLGSGVPAGFSGSGSRTNFTLTIDPVEADDAATYYCQQNNEDPYTFGGGTKLEIKRGGGGSEFQVKLQQSGTEVVKPGASVKLSCKASGYIFTSYDIDWVRQTPEQGLEWIGWIFPGEGSTEYNEKFKGRATLSVDKSSSTAYMELTRLTSEDSAVYFCARGDYYRRYFDLWGQGTTVTVSSGGGGSGGGGSGGGGSDIELTQSPASLAVSLGQRATISCRASESVDTYGDTFMYWYQQKPGQPPKLLIYLATNLGSGVPAGFSGSGSRTNFTLTIDPVEADDAATYYCQQNNEDPYTFGGGTKLEIKRGGGGSKLGGGGSAPAFSVSPASGLSDGQSVSVSVSGAAAGETYYIAQCAPVGGQDACNPATATSFTTDASGAASFSFVVRKSYTGSTPEGTPVGSVDCATAACNLGAGNSGLDLGHVALTFGGGGGSLE.

[0070] Group description: Blank control group: B cells transfected with empty electroporation; RNP electroporation group: B cells transfected with gRNA and Cas9 protein; dFv-LDP template electroporation group: B cells transfected only with dFv-LDP DNA template; RNP and dFv-LDP template co-electroporation group: B cells co-transfected with RNP and dFv-LDP DNA template; dFv-LDP: Recombinant dFv-LDP protein as a positive control.

[0071] 2) Three days after gene editing, it was demonstrated by ELISA that B lymphocytes could secrete dFv-LDP protein

[0072] B cells transfected with the homologous repair template of RNP and dFv-LDP, and B cells transfected only with the homologous repair template of dFv-LDP were able to secrete dFv-LDP protein ( Figure 2 ).

[0073] 3) After gene editing, B lymphocytes were transfused into mice, and it was demonstrated by ELISA detection of serum proteins within 16 weeks that B lymphocytes could secrete dFv-LDP protein for a long time

[0074] After transfusing the edited B cells, blood was taken every two weeks for ELISA detection of dFv-LDP. The results showed that mice transfused with B cells co-transfected with DNA template and RNPb could secrete dFv-LDP protein for a long time. At 16 weeks, dFv-LDP protein could still be detected in the serum ( Figure 3 ).

[0075] Example 2

[0076] 1. Experimental method

[0077] 1) Preparation of therapeutic B cells

[0078] Mouse Naive B cells were isolated from the spleen of mice through the above-mentioned mouse primary B cell isolation protocol, and were stimulated with LPS and anti-CD40 antibody for culture for 1 - 3 days. After stimulation and culture, the homologous repair template of RNP and dFv-LDP was electroporated through the above-mentioned electroporation protocol.

[0079] 2) In vivo anti-tumor experiment

[0080] To analyze the anti-tumor ability of dFv-LDP-secreting B cells, a mouse model of pancreatic cancer was first constructed. On day 0, 2×10 6 advanced pancreatic cancer cells SW1990 cells were subcutaneously injected into nude mice. On day 7, 5×10 6 dFv-LDP-secreting B cells were transfused into nude mice through tail vein injection, and then the tumor growth was monitored.

[0081] Group description: Normal saline: Infusion of normal saline; dFv-LDP protein group: Infusion of dFv-LDP recombinant protein; unedited B cell group: Infusion of unedited B cells with the same stimulation time as B cells secreting dFv-LDP; B cells secreting dFv-LDP: Infusion of B cells electroporated with dFv-LDP DNA template and RNP (gRNA and cas9 protein).

[0082] 2. Experimental results

[0083] 1) After infusion of B lymphocytes, the combined treatment of B lymphocytes and dFv-LDP significantly reduced the tumor volume in mice

[0084] After infusion of B lymphocytes, the tumor volume was measured every three days using vernier calipers, and the tumor volume was calculated based on the length, width, and height of the tumor mass. Compared with the group receiving only dFv-LDP protein injection and the group receiving unedited B lymphocyte infusion, the infusion of B cells secreting dFv-LDP significantly reduced the tumor volume in the pancreatic cancer animal model, indicating better anti-tumor ability ( Figure 4 ).

[0085] 2) The combined treatment of B lymphocytes and dFv-LDP significantly reduced the tumor weight in the pancreatic cancer animal model

[0086] Twenty-one days after infusion, the mice in each group were euthanized, and then the tumors were dissected and weighed. Compared with the group receiving only dFv-LDP protein injection and the group receiving unedited B cell infusion, the infusion of B cells secreting dFv-LDP significantly reduced the tumor weight in the pancreatic cancer animal model, indicating better anti-tumor ability ( Figure 5 ).

[0087] 3) The combined treatment of B lymphocytes and dFv-LDP significantly reduced the tumors in the pancreatic cancer animal model

[0088] Twenty-one days after infusion, the mice in each group were euthanized, and then the tumors were dissected and photographed. Compared with the group receiving only dFv-LDP protein injection and the group receiving unedited B cell infusion, the tumors in the pancreatic cancer animal model receiving the infusion of B cells secreting dFv-LDP were significantly smaller than those in other groups, indicating that the infusion of B cells secreting dFv-LDP had better anti-tumor ability ( Figure 6 ).

[0089] 4) The combined treatment effect of B lymphocytes and dFv-LDP was demonstrated to be long-term through survival curves

[0090] The tumor volume was detected 120 days after reinfusion. According to the ethical requirements for laboratory animals, if the maximum diameter of the tumor exceeded 1.5 cm, the mice were euthanized. The results showed that all the mice in the group receiving reinfusion of B cells secreting dFv-LDP survived at 120 days, while most of the mice in the other groups died at an early stage. This result indicated that reinfusion of B cells secreting dFv-LDP had long-term anti-tumor ability( Figure 7 ).

[0091] 5) Record the changes in the tumor volume of individual mice to prove the long-term efficacy of the combined treatment of B lymphocytes and dFv-LDP

[0092] The tumor volume was detected 120 days after reinfusion. According to the ethical requirements for laboratory animals, if the maximum diameter of the tumor exceeded 1.5 cm, the mice were euthanized. From the experimental results( Figure 8 ), it could be seen that the tumor volume of the mice in the normal saline group reached more than 1.5 cm within 45 days and they were euthanized. Mice treated with B lymphocytes alone and those treated with dFv-LDP protein alone both had certain therapeutic effects, while the tumor volume of the B cells secreting dFv-LDP protein used in combination was significantly smaller than that of the other three groups, and the tumor masses of two of the mice completely disappeared. The above results proved that the combined treatment of B lymphocytes and dFv-LDP was effective in the long term.

Claims

1. Use of CD40 antibody and LPS co-stimulated genetically modified B cells in the preparation of a pharmaceutical composition for treating pancreatic cancer, wherein the genetically modified B cells are B cells electrotransfected with the DNA template of dFv-LDP and RNP, the RNP is gRNA and cas9 protein, and the gRNA sequence is GGATTCTCCCAGGCCCAGGG.

2. The use according to claim 1, wherein the B cells include naive B cells, conventional B cells, follicular B cells, marginal zone B cells, B1 cells, memory B cells or plasma cells.

3. The use according to claim 1, wherein the pharmaceutical composition comprises a pharmaceutically acceptable adjuvant.

4. The use according to claim 3, wherein the adjuvant includes a diluent, a dispersion aid, a suspension aid, a surfactant, an isotonic agent, a thickening agent, an emulsifying agent, a preservative, a solid binder or a lubricant.

5. A pharmaceutical composition, which comprises the CD40 antibody and LPS co-stimulated genetically modified B cells in any one of the uses according to claims 1-4.

6. A method for constructing a genetically modified in vitro B cell that stably expresses dFv-LDP protein, the method comprising co-stimulating B cells with LPS and anti-CD40 antibody for 1-3 days before electrotransfecting the dFv-LDP target gene; the genetically modified in vitro B cells are B cells electrotransfected with the DNA template of dFv-LDP and RNP, the RNP is gRNA and cas9 protein, and the gRNA sequence is GGATTCTCCCAGGCCCAGGG.

7. The construction method according to claim 6, wherein the B cells are from humans or non-human mammals.

8. The construction method according to claim 6, wherein the B cells are from humans, chimpanzees, monkeys, horses, cows, sheep, pigs, donkeys, camels, dogs, rabbits, cats, rats or mice.

9. The construction method according to claim 6, wherein the construction method comprises the following steps: Add LPS and anti-CD40 antibody to B cells at 1×10 7 cells / ml, stimulate in vitro for 1 - 3 days, then transform the gene vector capable of expressing the dFv-LDP protein into the stimulated B cells by electroporation, and then culture using a complete B cell medium supplemented with LPS and anti-CD40 antibody, and add a Caspase inhibitor.

10. The construction method according to claim 9, wherein the Caspase inhibitor is Boc-D-FMK.

11. A genetically modified B cell, which is constructed by the construction method according to any one of claims 6-10.

Citation Information

Patent Citations

  • Reagent for inducing efficient amplification of regulatory B cells based on histone deacetylase inhibitory activity and application thereof

    CN113136365A

  • Use of heterogeneous tissue cell compositions for treatment of cancer

    CN115087459A