Adeno-associated virus mutants and their applications

Abstract

The present invention belongs to the field of biomedical technology, and discloses an adeno-associated virus mutant and its application. The amino acid sequence of the adeno-associated virus capsid protein mutant of the present invention is as shown in SEQ ID No. 10. The present invention applies the adeno-associated virus capsid protein mutant, its expression vector, host cell, and recombinant adeno-associated virus in the preparation of a drug delivery tool for preventing and / or treating muscle or heart diseases. The adeno-associated virus capsid protein mutant of the present invention has muscle or heart targeting properties, with the muscle targeting property being increased by up to about 496.41 times, and the liver tropism also being nearly a hundred times lower than that of the control group, with good specificity, and also showing good effects in NHPs. The present invention can promote the large-scale and social application of AAV-based gene therapy methods.

Description

[0001] This invention patent application is a divisional application of the Chinese patent application No. 2024109520630 with the invention title of "Adeno-associated virus mutants and their applications", filed on July 16, 2024. Technical Field

[0002] The present invention relates to the field of biomedical technologies, and particularly to an adeno-associated virus mutant and its applications. Background Art

[0003] Adeno-associated virus (AAV) is a small non-enveloped virus encapsulating a linear single-stranded DNA genome. It belongs to the genus Dependovirus of the family Parvoviridae and requires a helper virus (usually adenovirus) to participate in replication. The AAV genome is a single-stranded DNA fragment contained within a non-enveloped viral capsid and can be divided into three functional regions: two open reading frames (Rep gene, Cap gene) and inverted terminal repeats (ITR). Recombinant adeno-associated virus vector (rAAV) is derived from non-pathogenic wild-type adeno-associated virus. Due to its advantages such as wide host range, non-pathogenicity, low immunogenicity, long-term stable expression of foreign genes, good diffusion performance, and stable physical properties, it has been widely used as a gene transfer vector in gene therapy and vaccine research. In medical research, rAAV has been used in the gene therapy research of various diseases (including in vivo and in vitro experiments), such as gene function research, construction of disease models, preparation of gene knockout mice, etc.

[0004] In recent years, gene therapy has become a new method for treating muscle diseases, and AAV has been widely used as an effective gene vector. Taking Duchenne muscular dystrophy (DMD) as an example, it is a rare and fatal neuromuscular genetic disease that occurs in one out of every 3,500 - 5,000 males worldwide. DMD is caused by changes or mutations in the gene encoding dystrophin. The symptoms of DMD usually appear in infants and young children, and affected patients may experience developmental delays, such as difficulty walking, climbing stairs, or standing up from a sitting position. Elevidys (trade name), whose generic name is delandistrogene moxeparvovec and was formerly known as SRP - 9001, is a gene therapy that delivers the truncated DMD gene (mini - dystrophin gene, micro - dystrophin) in DMD patients using the AAVrh74 vector and the MHCK7 promoter. It was launched in June 2023 for the DMD population aged 4 - 5 years who can walk independently (not applicable to those with deletion mutations in exons 8 and / or 9). On June 20, 2024, the FDA fully approved ELEVIDYS for DMD patients aged 4 and above who can walk independently, and at the same time accelerated the approval (conditional marketing) of this drug for DMD patients aged 4 and above who cannot walk independently. In addition, there are some other AAV treatment cases or clinical studies underway. However, like any drug treatment, AAV treatment also has some potential risks. For example, too high a dose may cause an immune system reaction, leading to side effects. In addition, a high dose also means higher production difficulty and higher cost. Therefore, the main purpose of modifying AAV serotypes is to develop drugs with higher targeting to reduce the drug dose, or to make the drug have better specificity to avoid adverse reactions.

[0005] In summary, although AAV is one of the most widely used and safest gene therapy vectors currently, further improvement is still needed in aspects such as lower in - vivo doses and muscle targeting. It is very important to develop serotype types with better therapeutic effects, lower treatment doses, fewer side effects, and lower usage costs. Therefore, there is an urgent need to develop a new AAV gene therapy product with lower dose requirements and costs to meet the needs of more different patients and promote the large - scale and social application of AAV - based gene therapy methods. Summary of the Invention

[0006] The object of the present invention is to overcome the deficiencies of the prior art and provide an adeno - associated virus mutant with muscle or heart targeting and its application.

[0007] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0008] In a first aspect, the present invention provides an adeno-associated virus capsid protein mutant, the amino acid sequence of which comprises a sequence shown in any one of SEQ ID No. 7-12.

[0009] The adeno-associated virus capsid protein mutant of the present invention has muscle or heart targeting properties. The mutant has good targeting properties for different muscle tissues (such as quadriceps, biceps brachii, and abdominal muscles, etc.). Compared with the control group AAV9, the muscle targeting property is increased by up to about 496.41 times, and the liver tropism is also nearly 100 times lower than that of the control group, with good specificity, and it also shows good effects in nonhuman primates (NHP).

[0010] As a preferred embodiment of the adeno-associated virus capsid protein mutant of the present invention, a targeting peptide is inserted into the amino acid sequence; the amino acid sequence of the targeting peptide is a sequence shown in any one of SEQ ID No. 1-6.

[0011] In a second aspect, the present invention provides a nucleic acid encoding the adeno-associated virus capsid protein mutant.

[0012] As a preferred embodiment of the nucleic acid of the present invention, its nucleotide sequence comprises a nucleotide sequence shown in any one of SEQ ID No. 13-18.

[0013] In a third aspect, the present invention provides an expression vector, which comprises the nucleic acid.

[0014] In a fourth aspect, the present invention provides a host cell, which comprises the expression vector.

[0015] In a fifth aspect, the present invention provides a host cell, which expresses the adeno-associated virus capsid protein mutant.

[0016] In a sixth aspect, the present invention provides a recombinant adeno-associated virus, which comprises the adeno-associated virus capsid protein mutant.

[0017] The recombinant adeno-associated virus vector constructed by using the AAV capsid protein mutant of the present invention has higher specificity, better safety, and a wide range of applications.

[0018] As a preferred embodiment of the recombinant adeno-associated virus of the present invention, it further comprises a heterologous target gene.

[0019] As a preferred embodiment of the recombinant adeno-associated virus of the present invention, the heterologous target gene encodes any one of gene products such as interfering RNA, aptamer, endonuclease, and guide RNA.

[0020] In a seventh aspect, the present invention provides a method for preparing a recombinant adeno-associated virus, comprising introducing at least the following components into a host cell: 1) the nucleic acid or the expression vector as described above, 2) an adeno-associated virus helper plasmid, and 3) a plasmid containing two terminal inverted repeats.

[0021] In an eighth aspect, the present invention provides the rAAV prepared by the method as described above.

[0022] In a ninth aspect, the present invention provides a pharmaceutical composition comprising the recombinant adeno-associated virus or the rAAV as described above, and a pharmaceutically acceptable carrier.

[0023] In a tenth aspect, the present invention uses the adeno-associated virus capsid protein mutant, the expression vector, the host cell, the recombinant adeno-associated virus, and the rAAV in the preparation of a drug or preparation for delivering a gene product to cells or tissues of a subject.

[0024] As a preferred embodiment of the application as described above, the cell is a muscle cell or a heart cell; the tissue is a muscle tissue or a heart tissue.

[0025] In an eleventh aspect, the present invention uses the adeno-associated virus capsid protein mutant, the expression vector, the host cell, the recombinant adeno-associated virus, and the rAAV in the preparation of a drug delivery tool for preventing and / or treating muscle or heart diseases.

[0026] As a preferred embodiment of the application as described above, the muscle diseases include, but are not limited to, any one of Duchenne muscular dystrophy, Becker muscular dystrophy, X-linked myotubular myopathy, limb-girdle muscular dystrophy, myotonic dystrophy, facioscapulohumeral muscular dystrophy; the heart diseases include, but are not limited to, any one of arrhythmogenic cardiomyopathy, ischemic cardiomyopathy, hypertrophic cardiomyopathy, dilated cardiomyopathy, angina pectoris, coronary heart disease, myocardial infarction, heart failure.

[0027] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0028] The present invention constructs an AAV virus library using a specific motif-based method for muscle targeting screening, and can discover effective AAV variants through fewer screening processes, overcoming the disadvantages of the generally used random libraries, such as large variety numbers, poor screening accuracy, and the need for multiple rounds of repeated screening and verification. The adeno-associated virus capsid protein mutants screened by the present invention have muscle or heart targeting properties. The mutants have good targeting properties for different muscle tissues (such as quadriceps femoris, biceps brachii, and abdominal muscles). Compared with the control group AAV9, the muscle targeting property is increased by up to about 496.41 times, and the liver tropism is also nearly 100 times lower than that of the control group, with good specificity, and also shows good effects in NHP. The recombinant adeno-associated virus vector constructed using the AAV capsid protein mutant of the present invention has higher specificity, better safety, and a wide range of applications. This will be of great significance for improving the efficiency of gene therapy and serving the majority of patients in the future. Brief Description of the Drawings

[0029] Figure 1 For the in vivo imaging results of different serotypes infecting Balb / c mice, Figure 1 in which, A: 14 days, B: 21 days;

[0030] Figure 2 For the targeting analysis of different serotypes on the muscle (biceps brachii) of Balb / c mice (21 days), Figure 2 in which, A is the relative mRNA expression level, and B is the protein expression level;

[0031] Figure 3 For the targeting analysis of different serotypes on the muscle (triceps brachii) of Balb / c mice (21 days), Figure 3 in which, A is the relative mRNA expression level, and B is the protein expression level;

[0032] Figure 4 For the targeting analysis of different serotypes on the muscle (quadriceps femoris) of Balb / c mice (21 days), Figure 4 in which, A is the relative mRNA expression level, and B is the protein expression level;

[0033] Figure 5 For the targeting analysis of different serotypes on the muscle (abdominal muscle) of Balb / c mice (21 days), Figure 5 in which, A is the relative mRNA expression level, and B is the protein expression level;

[0034] Figure 6 For the targeting analysis of different serotypes on the muscle (gastrocnemius) of Balb / c mice (21 days), Figure 6 in which, A is the relative mRNA expression level, and B is the protein expression level;

[0035] Figure 7Analysis of the cardiac tropism of different serotypes in Balb / c mice (21 days). Figure 7 In it, A is the relative mRNA expression level, and B is the protein expression level;

[0036] Figure 8 Analysis of the hepatic tropism of different serotypes in Balb / c mice (21 days). Figure 8 In it, A is the relative mRNA expression level, and B is the protein expression level;

[0037] Figure 9 NGS detection and analysis of the muscle tropism and hepatic tropism of different serotypes in cynomolgus monkeys Figure 9 In it, A is the puncture at 14 days, and B is the puncture at 28 days. Detailed implementation manners

[0038] Unless otherwise specified, all technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art.

[0039] Unless the context clearly indicates otherwise, the term "or" refers to a single element among the listed alternative elements, and the term "and / or" refers to any one, any two, any three, any more or all of the listed alternative elements.

[0040] The term "comprising" or "including" means including the stated elements, integers or steps, but does not exclude any other elements, integers or steps. In the text, when using the term "comprising" or "including", unless otherwise specified, the case consisting of the stated elements, integers or steps is also covered. For example, when referring to a polypeptide "including" a specific sequence, it is also intended to cover a polypeptide consisting of that specific sequence.

[0041] "Adeno-associated virus (AAV)" is a non-enveloped icosahedral capsid virus of the Parvoviridae family, including a single-stranded DNA virus genome. The Parvoviridae family includes the genus Dependovirus, which includes AAV, and depends on the presence of a helper virus such as adenovirus for its replication. Due to its relatively simple structure, ability to infect a variety of cells (including quiescent and dividing cells) without integrating into the host genome, and its relatively mild immunogenic characteristics, AAV has been proven to be usable as a biological tool for expressing a gene of interest in vitro or in vivo. Expression vectors based on AAV are also considered herein, including recombinant AAV (rAAV) carrying a gene of interest for therapeutic purposes.

[0042] The wild-type AAV viral genome is a linear, single-stranded DNA (ssDNA) molecule approximately 5000 nucleotides (nt) in length. The AAV viral genome typically includes two inverted terminal repeats (ITRs) that flank the viral genome at the 5' and 3' ends, providing an origin of replication for the viral genome. These ITRs have a characteristic T-shaped hairpin structure and serve multiple functions, including but not limited to acting as a starting point for DNA replication by serving as a primer for the endogenous DNA polymerase complex of the host cell that replicates the virus.

[0043] The wild-type AAV viral genome also includes the Rep gene and the Cap gene, which encode four non-structural Rep proteins (Rep78, Rep68, Rep52, Rep40) and three capsid proteins or structural proteins (VP1, VP2, VP3), respectively. The Rep proteins are associated with viral replication and packaging, while the capsid proteins assemble to form the protein coat or AAV capsid of AAV. Alternative splicing and alternative start codons and promoters result in the production of four different Rep proteins from a single open reading frame in the Rep gene and three capsid proteins from a single open reading frame in the Cap gene.

[0044] When referring to AAV, the terms "viral capsid protein" or "capsid protein" refer to the proteins of AAV that are capable of self-assembling to produce AAV particles, also known as coat proteins or VP proteins. The VP proteins include three subunits, VP1, VP2, and VP3. Thus, changes in VP protein mutants relative to the wild-type VP protein can be reflected in changes in the amino acid sequences of the VP1, VP2, and VP3 subunits. Correspondingly, in this article, "capsid protein mutants" include VP protein mutants as well as VP1, VP2, and / or VP3 subunit mutants. Due to the amino acid sequence identity between the VP1, VP2, and VP3 subunits expressed from the same Cap gene, when changes are made to the coding sequence in the Cap gene, such as changes to the coding sequence of the VP1 subunit, the amino acid sequences of the expressed VP2 and VP3 subunits are simultaneously altered.

[0045] The term "serotype" as used in reference to AAV is used to refer to the serological distinction of the capsid protein of AAV from other AAV serotypes. The determination of serological distinctiveness is based on the reactivity of an antibody with one AAV and the lack of cross-reactivity with other or another AAV. Such differences in cross-reactivity are generally due to differences in the capsid protein sequence (or the sequence of its subunits) / epitopes (e.g., due to differences in the VP1, VP2, and / or VP3 sequences of serotype AAV9). A number of AAV serotypes have been discovered to date, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12, as well as mutants thereof.

[0046] When referring to the capsid protein of AAV or its subunits, the "variable region" refers to the region where its amino acid sequence varies relatively greatly between different serotypes. Generally, by aligning the amino acid sequences of the capsid proteins of numerous AAV serotypes and determining the relatively conserved regions, the sequences located between them are the variable region sequences. The variable region may be related to the binding of AAV to cell surface receptors.

[0047] "Recombinant AAV vector" refers to an AAV genome derived by using molecular biological methods to remove part of the wild-type genes (such as the Rep gene and the Cap gene) from the AAV genome and replacing them with heterologous nucleic acid sequences (such as the coding sequences of proteins or RNAs for therapeutic purposes). Generally, for a recombinant AAV vector, one or two inverted terminal repeat (ITR) sequences of the AAV genome are retained therein. In most cases, recombinant AAV vectors are replication-deficient and lack the sequences encoding functional Rep and Cap proteins in their viral genomes. These replication-deficient AAV particles may lack most of the parental coding sequences and essentially only carry one or two AAV ITR sequences and the target nucleic acid for delivery to cells, tissues, organs, or organisms. AAVs including recombinant AAV vectors are referred to herein as recombinant AAV (rAAV).

[0048] "Amino acid change" includes amino acid substitution, deletion, or insertion herein. The number of amino acid changes in a mutant sequence relative to the parental sequence can be counted as the sum of the number of amino acid substitutions, the number of deleted amino acids, and the number of inserted amino acids.

[0049] In this article, the terms "nucleic acid molecule", "nucleic acid" and "polynucleotide" are used interchangeably and refer to nucleotide polymers. Such nucleotide polymers may contain natural and / or unnatural nucleotides and include (but are not limited to) DNA, RNA and PNA. "Nucleic acid sequence" refers to the linear sequence of nucleotides contained in a nucleic acid molecule or polynucleotide. "Isolated nucleic acid molecule" means that the nucleic acid molecule is separated from its natural environment (such as the intracellular environment), and is substantially free of one or more substances that are usually naturally associated with it, such as proteins, nucleic acids, lipids, carbohydrates, cell membranes, etc., or is an artificially prepared (such as artificially synthesized) nucleic acid molecule.

[0050] The term "expression vector" refers to a nucleic acid molecule containing various expression elements for expressing a protein of interest or an RNA of interest in a host cell. For an expression vector used for expressing a protein of interest in a eukaryotic cell, these expression elements usually include a promoter, an enhancer, a polyadenylation signal sequence, etc. For convenient amplification in Escherichia coli, the expression vector usually also includes an Escherichia coli replicon sequence. In addition, the expression vector may also include an antibiotic resistance gene or a selection marker gene for screening (such as ampicillin resistance gene (AmpR), thymidine kinase gene (TK), kanamycin resistance gene (KanR), neomycin resistance gene (NeoR), etc.) and a multiple cloning site (MCS) for insertion of the target gene.

[0051] The term "host cell" refers to a cell in which an expression vector can be maintained and / or replicated, including prokaryotic cells and eukaryotic cells, such as bacteria (such as Escherichia coli), fungi (yeast), insect cells (such as SF9), and mammalian cells (such as HEK-293T).

[0052] When referring to a pharmaceutical composition, the term "pharmaceutically acceptable carrier" refers to substances such as solid or liquid diluents, fillers, antioxidants, stabilizers, etc. that can be safely administered, which are suitable for administration to humans and / or animals without excessive adverse side effects and are also suitable for maintaining the viability of the drug or active agent located therein. Depending on the route of administration, various different carriers well known in the art can be used, including, but not limited to, sugars, starches, cellulose and its derivatives, maltose, gelatin, talc, calcium sulfate, vegetable oils, synthetic oils, polyols, alginic acid, phosphate buffer, emulsifiers, isotonic saline, and / or pyrogen-free water, etc.

[0053] The "targeting property" of AAV or rAAV refers to the phenomenon that when it is introduced into the body, it relatively accumulates in a specific tissue or organ. For example, the targeting property can be manifested as a higher concentration in tissue A than in tissue B. This targeting property can be reflected by detecting the content or concentration of its genome in different tissues or organs.

[0054] To better illustrate the purpose, technical solutions, and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0055] Unless otherwise specified, the test methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can all be obtained from commercial sources. The nucleotide sequence of the hypo-hepatic tropism serotype capsid can be found in SEQ ID No. 32 in Chinese invention patent document CN116041443B.

[0056] Example 1: Screening of novel mutants

[0057] (1) Construction of the backbone plasmid of the hypo-hepatic tropism serotype mutant library

[0058] The backbone vector of the hypo-hepatic tropism serotype mutant library contains the CAG promoter, Intron, the mutated hypo-hepatic tropism serotype capsid protein sequence [the VP1 sequence after T580 is removed, and the T580 nucleic acid sequence ACC is mutated to ACT, thus forming a restriction enzyme site BsrG I (TGTACA) with the polyA front sequence for subsequent linearization of the backbone by restriction enzyme digestion], and polyA. The above sequences were synthesized by gene synthesis and inserted between the ITRs of the AAV vector plasmid to form the backbone vector of the hypo-hepatic tropism serotype mutant library.

[0059] (2) Construction of the mutated Rep-CAP vector

[0060] By introducing stop codons at the N-terminus of the VP1, VP2, and VP3 proteins of the CAP sequence in the hypo-hepatic tropism serotype, the Rep-CAP vector can normally express the Rep protein and the AAP protein, but cannot express the VP1, VP2, and VP3 proteins of CAP, thus avoiding contamination of the CAP sequence in the parent. The above sequences were synthesized by gene synthesis and inserted to replace the CAP sequence of the hypo-hepatic tropism serotype Rep-CAP vector.

[0061] (3) Construction of a random polypeptide vector library containing the RGD motif

[0062] Design method: The sequences between TNLQ583 and Q588AAT of low hepatotropism serotype CAP are used as the inserted and modified sequences, and the combinations are as follows: AGRGDXXXXXR, AGXRGDXXXXR, AGXXRGDXXXR, AGXXXRGDXXR, AGXXXXRGDXR, AGXXXXXRGDR, AGRGDXXXXXA, AGXRGDXXXXA, AGXXRGDXXXA, AGXXXRGDXXA, AGXXXXRGDXA, AGXXXXXRGDA. The upstream primer sequences are composed of: homologous arm sequence + the above combination sequence + primer matching sequence, and a total of 12 primer sequences are formed. The same sequence is used as the downstream primer. These primers form primer pairs with the downstream primer. When the low hepatotropism serotype CAP vector is used as the template, a library of target fragments is amplified. The two ends of the fragment library have homologous arms, which can undergo homologous recombination with the backbone plasmid of the digested low hepatotropism serotype mutant library to form a vector library.

[0063] The base sequences of the upstream primers (5’->3’) are as follows:

[0064] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCAGAGGAGACNNKNNKNNKNNKNNKAGACAAGCAGCTACCGCAGAT;

[0065] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKAGAGGAGACNNKNNKNNKNNKAGACAAGCAGCTACCGCAGAT;

[0066] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKNNKAGAGGAGACNNKNNKNNKAGACAAGCAGCTACCGCAGAT;

[0067] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKNNKNNKAGAGGAGACNNKNNKAGACAAGCAGCTACCGCAGAT;

[0068] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKNNKNNKNNKAGAGGAGACNNKAGACAAGCAGCTACCGCAGAT;

[0069] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKNNKNNKNNKNNKAGAGGAGACAGACAAGCAGCTACCGCAGAT;

[0070] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCAGAGGAGACNNKNNKNNKNNKNNKGCTCAAGCAGCTACCGCAGAT;

[0071] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKAGAGGAGACNNKNNKNNKNNKGCTCAAGCAGCTACCGCAGAT;

[0072] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKNNKAGAGGAGACNNKNNKNNKGCTCAAGCAGCTACCGCAGAT;

[0073] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKNNKNNKAGAGGAGACNNKNNKGCTCAAGCAGCTACCGCAGAT;

[0074] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKNNKNNKNNKAGAGGAGACNNKGCTCAAGCAGCTACCGCAGAT;

[0075] CAGTATGGTTCTGTATCTACTAACCTCCAGGCTGGCNNKNNKNNKNNKNNKAGAGGAGACGCTCAAGCAGCTACCGCAGAT。

[0076] The base sequence of the downstream primer (5’->3’) is as follows:

[0077] CGGTTTATTGATTAACAATCGATTACAGATTACGAGTCAGGTATCTGGTG。

[0078] The specific operation steps are as follows: Using the vector containing the low-hepatotropism serotype CAP as a template, a fragment containing a random sequence is obtained by PCR amplification with the above primers. The fragment is subjected to gel electrophoresis and gel extraction to obtain a purified nucleic acid fragment; the nucleic acid fragment is ligated into the backbone vector of the low-hepatotropism serotype mutant library constructed in step (1) (digested with BsrG I and purified by gel extraction) by Gibson homologous recombination ligation. After the ligated vector is purified by a PCR product purification kit, it is digested with Plasmid-Safe DNase to remove the unligated fragments; finally, it is purified again by a PCR product purification kit to obtain the constructed low-hepatotropism serotype mutant random polypeptide vector library containing the RGD motif, that is, the low-hepatotropism serotype mutant plasmid library.

[0079] (4) Production of the low-hepatotropism mutant virus library

[0080] The mutated Rep-Cap plasmid constructed in step (2), the low-hepatotropism serotype mutant plasmid library constructed in step (3), and the pHelper plasmid are co-transfected into HEK-293T cells. Adeno-associated virus is purified by iodixanol gradient ultra-high speed centrifugation, and the virus titer is measured to be 10 12 GC / mL to 10 13 GC / mL is the appropriate titer to obtain the low-hepatotropism serotype mutant virus library, which is stored at -80 °C for later use.

[0081] (5) Screening of mutants

[0082] (5.1) Animal injection and dissection

[0083] Cynomolgus monkeys are intravenously injected with the low-hepatotropism serotype mutant virus library. After 28 days of injection, animal dissection and organ sampling are performed. The samples are immediately frozen in liquid nitrogen after sampling and used for subsequent RNA extraction experiments.

[0084] (5.2) Total RNA extraction and RT-PCR

[0085] Grinding of the sample: Pre-cool the grinder 10 minutes in advance and set the grinding parameters. Take out the animal tissue sample stored in the -80°C refrigerator, take about 50 - 100 mg of the tissue, cut it into the size of a soybean in a sterile petri dish, and then transfer it into a 1.5 mL RNase-free EP tube. Add an appropriate amount of TransZol Up according to the ratio of every 50 - 100 mg of tissue: 1 mL of TransZol Up, and then add two clean and sterile 3 mm grinding steel beads, and wrap it with sealing film. Place the sample in a 24-well grinding adapter and balance it, tighten the screw, and press the lid closing button. Start the grinding program, take out the sample after the instrument operation is completed, observe the grinding particle size of the sample, and if there is no large tissue residue, the subsequent extraction operation can be carried out. Centrifuge the ground sample at 4°C and 12,000×g for 2 minutes, and aspirate the supernatant and transfer it to a new 1.5 mL RNase-free EP tube with corresponding labels.

[0086] Extraction of total RNA from the sample: Specifically refer to the instruction manual of TransZol Up Plus RNA Kit (TransGen Biotech, Beijing, Catalog No.: ER501). For every 1 mL of TranZol up used, add 0.2 ml of RNA Extraction Agent and shake vigorously for 5 minutes; centrifuge at 12,000×g and 4°C for 10 minutes. At this time, the sample is divided into three layers. Transfer the colorless aqueous phase to a new 1.5 mL RNase-free EP tube, add an equal volume of absolute ethanol (precipitation may occur at this time), and gently invert and mix; add the obtained solution and precipitate together into the centrifugal column, centrifuge at 12,000×g at room temperature for 30 seconds, and discard the filtrate; add 500 μL of CB9, centrifuge at 12,000×g at room temperature for 30 seconds, and discard the filtrate; repeat the above step once; add 500 μL of WB9, centrifuge at 12,000×g at room temperature for 30 seconds, and discard the filtrate; repeat the above step once; centrifuge at 12,000×g at room temperature for 2 minutes to completely remove the residual ethanol; place the centrifugal column in a 1.5 ml RNase-free EP tube, add 30 - 50 μL (depending on the tissue size) of RNase-free Water in the center of the centrifugal column, and let it stand at room temperature for 1 minute; centrifuge at 12,000×g at room temperature for 1 minute to elute the RNA;

[0087] Determination of the nucleic acid concentration of the sample: Use a micro nucleic acid quantifier detector to detect the RNA concentration, record the concentration, OD260 / 280, OD260 / 230, and store the RNA at -80°C.

[0088] RT-PCR: The first-strand cDNA synthesis was performed using PrimeScriptTM IV 1st strand cDNA Synthesis Mix (Takara, 6215A) on the extracted RNA samples. Subsequently, two rounds of PCR amplification were carried out using NEB Q5 (the first round was amplified with outer primers; the second round used the product of the first round recovered from the gel as a template and was amplified with NGS primers), and the PCR products corresponding to the band sizes were recovered from the gel and sent to the company for NGS sequencing;

[0089] NGS sequencing, data analysis, and selection of candidate vectors: After sequencing, the sequencing data was analyzed, and the sequences with the top occurrence frequencies and multiple occurrences in multiple samples were selected as candidates for subsequent construction and verification of AAV mutants.

[0090] Example 2: Construction of AAV capsid protein mutants and production of viruses

[0091] (1) Construction of mutant serotype vectors and plasmid extraction

[0092] The AAV9 Rep-CAP plasmid (purchased from Guangzhou Pazhen Biotechnology Co., Ltd.) was double-digested with Smi I and BshT I, electrophoresed on a gel, and the fragment band around 5000 bp was excised for gel recovery to obtain the digested backbone fragment.

[0093] According to the Cap sequence of mutant 1, the following primers were designed. The specific steps were as follows: Using the Cap-f + YJ573-R primers with the Rep-CAP plasmid of serotype 109 as a template for amplification and gel recovery to obtain the target product YJ573-1, using the YJ573-F + cap-r primers with the Rep-CAP plasmid of serotype 109 as a template for amplification and gel recovery to obtain the target product YJ573-2. By mixing the backbone fragment, YJ573-1, and YJ573-2 through the following steps and ratios, the Rep-CAP plasmid of mutant 1 can be recombinantly constructed;

[0094] According to the Cap sequence of mutant 2, the following primers were designed. The specific steps were as follows: Using the Cap-f + YJ578-R primers with the Rep-CAP plasmid of serotype 109 as a template for amplification and gel recovery to obtain the target product YJ578-1, using the YJ578-F + cap-r primers with the Rep-CAP plasmid of serotype 109 as a template for amplification and gel recovery to obtain the target product YJ578-2. By mixing the backbone fragment, YJ578-1, and YJ578-2 through the following steps and ratios, the Rep-CAP plasmid of mutant 2 can be recombinantly constructed;

[0095] According to the Cap sequence of mutant 3, the following primers were designed. The specific steps were as follows: Using the Rep-CAP plasmid of serotype 109 as a template, amplify with Cap-f + YJ588-R primers and recover the target product YJ588-1 by gel extraction. Using the Rep-CAP plasmid of serotype 109 as a template, amplify with YJ588-F + cap-r primers and recover the target product YJ588-2 by gel extraction. By mixing the backbone fragment, YJ588-1, and YJ588-2 in the following steps and ratios, the Rep-CAP plasmid of mutant 3 can be recombinantly constructed;

[0096] According to the Cap sequence of mutant 4, the following primers were designed. The specific steps were as follows: Using the Rep-CAP plasmid of serotype 109 as a template, amplify with Cap-f + YJ581-R primers and recover the target product YJ581-1 by gel extraction. Using the Rep-CAP plasmid of serotype 109 as a template, amplify with YJ581-F + cap-r primers and recover the target product YJ581-2 by gel extraction. By mixing the backbone fragment, YJ581-1, and YJ581-2 in the following steps and ratios, the Rep-CAP plasmid of mutant 4 can be recombinantly constructed;

[0097] According to the Cap sequence of mutant 5, the following primers were designed. The specific steps were as follows: Using the Rep-CAP plasmid of serotype 109 as a template, amplify with Cap-f + YJ574-R primers and recover the target product YJ574-1 by gel extraction. Using the Rep-CAP plasmid of serotype 109 as a template, amplify with YJ574-F + cap-r primers and recover the target product YJ574-2 by gel extraction. By mixing the backbone fragment, YJ574-1, and YJ574-2 in the following steps and ratios, the Rep-CAP plasmid of mutant 5 can be recombinantly constructed;

[0098] According to the Cap sequence of mutant 6, the following primers were designed. The specific steps were as follows: Using the Rep-CAP plasmid of serotype 109 as a template, amplify with Cap-f + YJ585-R primers and recover the target product YJ585-1 by gel extraction. Using the Rep-CAP plasmid of serotype 109 as a template, amplify with YJ585-F + cap-r primers and recover the target product YJ585-2 by gel extraction. By mixing the backbone fragment, YJ585-1, and YJ585-2 in the following steps and ratios, the Rep-CAP plasmid of mutant 6 can be recombinantly constructed;

[0099] The primers involved in the construction of the Rep-CAP vector of the above AAV capsid protein mutants are shown in Table 1:

[0100] Table 1 Primer sequence information

[0101]

[0102]

[0103] Take a clean 200 μL PCR tube, make a mark and place it on an ice box. Prepare a reaction solution by mixing the above-mentioned digested backbone and each target fragment according to a molar ratio of backbone:fragment of 1:3. Perform recombinant ligation in a PCR instrument at 50 °C for 30 min. Take 50 μL of competent cells and thaw them on ice. Mix 10 μL of the ligation product with DH5α competent cells and place them on ice for 20 - 30 minutes; heat shock at 42 °C for 45 seconds; quickly place them on ice for a 2-minute ice bath. Add 400 μL of recovery SOC medium (without antibiotics), culture at 37 °C and 200 rpm for 1 h; evenly spread them on an Amp-resistant plate (50 μg / mL) and culture at 37 °C for 14 hours. Select monoclonal bacteria and expand the culture in 4 mL of liquid LB medium (Amp+ resistant) at 37 °C for 14 hours.

[0104] Centrifuge the bacterial solution at 12000 rpm for 1 minute, pour out the supernatant culture medium; add 250 μL of buffer P1 / RNaseA mixture, vortex at high speed to resuspend the bacteria; add 250 μL of buffer P2, invert 8 - 10 times up and down; add 350 μL of buffer P3, immediately invert and mix 8 - 10 times to completely neutralize the solution; centrifuge at 13000 rpm for 10 minutes, take the supernatant and pass it through the column; centrifuge at 12000 rpm for 1 minute, pour out the waste liquid, add 500 μL of PW1, centrifuge at 12000 rpm for 1 minute, pour out the waste liquid; add 600 μL of PW2, centrifuge at 12000 rpm for 1 minute, pour out the supernatant; add 600 μL of PW2, centrifuge at 12000 rpm for 1 minute, pour out the supernatant; centrifuge at 12000 rpm for an empty run for 2 minutes; add 30 - 50 μL of elution buffer preheated at 55 °C, let it stand for 2 minutes, and centrifuge at 12000 rpm for 1 minute. Use a micro nucleic acid quantifier to detect the concentration.

[0105] After the obtained plasmid passes the concentration detection, take 10 μL of the positive plasmid identified by enzyme digestion and send it for sequencing. The positive plasmid is stored at -20 °C. The sequencing results show that the obtained plasmid can encode the variant capsid protein VP1. Finally, extract the relevant Helper plasmid according to the virus amount required for later testing, as well as the plasmid of each group of Rep-Cap plasmids (control serotypes AAV2, AAV9, MyoAAV 4A, 109 and mutants 1 - 6) and the GOI plasmid (ssAAV.CAG.Fluc-2a-eGFP.WPRE.SV40pA).

[0106] (2) Packaging and purification of mutant serotype viruses

[0107] The Rep-Cap plasmids of each group (control serum type and AAV mutants 1-6), the GOI plasmids expressing firefly luciferase (Fluc) and enhanced green fluorescent protein (EGFP), and the pHelper plasmid were co-transfected into HEK-293T cells in appropriate amounts. The AAV virus was purified by iodixanol gradient ultra-high speed centrifugation, and the virus titer was measured to be about 1E+13 GC / mL, which was the appropriate titer, and stored at -80 °C for later use.

[0108] Example 3: Comparative tests of various indicators of mutant serum types

[0109] (1) Mouse injection and dissection

[0110] For animal experiments, 6-8-week-old male Balb / c mice were used. The relevant viruses were prepared according to the designed experimental group and control group (only 2 mice were used for mutants 5 and 6 due to low virus production). Each mouse was injected with 2E11 GC virus. In vivo imaging was performed on the 14th and 21st days after injection respectively. Animal dissection and tissue sampling of various organs were performed 21 days after injection. After the samples were taken, they were immediately frozen in liquid nitrogen and used for subsequent RNA extraction and WB detection experiments respectively.

[0111] (2) In vivo imaging

[0112] In vivo imaging was performed on the 14th and 21st days after mouse injection. Before imaging, the mice were weighed, and the animal in vivo imaging system (AniView100, Guangzhou Boluteng Biotechnology Co., Ltd.) was turned on in advance and the small animal anesthesia system was debugged. The image saving path, shooting parameters and other information were set. Each mouse was intraperitoneally injected with luciferin (15 mg / mL, Promega, E1605) at a dose of 150 mg / kg, that is, 10 μL / g. Imaging started 10 minutes after injection for each group. The shooting of each batch of mice was completed in the order of supine, left lateral, prone, and right lateral. After shooting, the mice were put back into the cage to wait for the anesthesia to wear off, and the state of the mice was observed for any abnormalities.

[0113] (3) Detection of the mRNA expression level of the target gene

[0114] (3.1) Total RNA extraction and reverse transcription

[0115] Grinding of the sample: Pre-cool the grinder 10 minutes in advance and set the grinding parameters. Take out the animal tissue sample stored in the -80°C refrigerator, take about 50 - 100 mg of the tissue, cut it into the size of soybeans in a sterile petri dish, and then transfer it into a 1.5 mL RNase-free EP tube. Add an appropriate amount of TransZol Up according to the ratio of every 50 - 100 mg of tissue: 1 mL of TransZol Up, and then add two clean and sterile 3 mm grinding steel beads, and wrap it with sealing film. Place the sample in a 24-well grinding adapter and balance it, tighten the screw, and press the lid closing button. Start the grinding program, take out the sample after the instrument operation is completed, observe the grinding particle size of the sample. If there is no large tissue residue, the subsequent extraction operation can be carried out. Centrifuge the ground sample at 4°C and 12,000×g for 2 minutes, and aspirate the supernatant and transfer it to a new, correspondingly labeled 1.5 mL RNase-free EP tube.

[0116] Extraction of total RNA from the sample: Specifically refer to the instruction manual of TransZol Up Plus RNA Kit (TransGen Biotech, Beijing, Catalog No.: ER501). For every 1 mL of TranZol up used, add 0.2 mL of RNA Extraction Agent, and shake vigorously for 5 minutes; centrifuge at 12,000×g and 4°C for 10 minutes. At this time, the sample is divided into three layers. Transfer the colorless aqueous phase to a new 1.5 mL RNase-free EP tube, add an equal volume of absolute ethanol (precipitation may occur at this time), and gently invert and mix; add the obtained solution and precipitate together into the centrifugal column, centrifuge at 12,000×g at room temperature for 30 s, and discard the filtrate; add 500 μL of CB9, centrifuge at 12,000×g at room temperature for 30 s, and discard the filtrate; repeat the above step once; add 500 μL of WB9, centrifuge at 12,000×g at room temperature for 30 s, and discard the filtrate; repeat the above step once; centrifuge at 12,000×g at room temperature for 2 minutes to completely remove the residual ethanol; place the centrifugal column in a 1.5 mL RNase-free EP tube, add 30 - 50 μL (depending on the tissue size) of RNase-free Water in the center of the centrifugal column, and let it stand at room temperature for 1 minute; centrifuge at 12,000×g at room temperature for 1 minute to elute the RNA;

[0117] Determination of the nucleic acid concentration of the sample: Use a micro nucleic acid quantifier detector to detect the RNA concentration, record the concentration, OD260 / 280, OD260 / 230, and store the RNA at -80°C.

[0118] Reverse transcription: Each group of RNA samples uses All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) (TransGen Biotech, Catalog No.: AE341-03). Refer to the instruction manual for specific procedures.

[0119] (3.2) Quantitative real-time PCR (qPCR) experiment:

[0120] Use each group of cDNA as a template and configure the qPCR system according to the instruction manual of 2x SYBR Green qPCR Master Mix (Bimake, Catalog No.: B21203):

[0121] Table 2 qPCR System

[0122] Reagent Dosage 2x SYBR Green qPCR Master Mix 10μL cDNA Template 2μL Forward Primer (10μM) 1μL Reverse Primer (10μM) 1μL ROX Reference Dye 0.4μL Deionized Water Up to 20μL

[0123] Table 3 qPCR Primer Information

[0124] Primer Name Primer Sequence (5’->3’) Fluc2-qPCR-F1 AACCAGCGCCATTCTGATCA Fluc2-qPCR-R1 TCGGGGTTGTTAACGTAGCC GAPDH-F2 CAGGAGAGTGTTTCCTCGTCC GAPDH-R2 TTCCCATTCTCGGCCTTGAC

[0125] Table 4 qPCR Program Settings

[0126]

[0127]

[0128] 3.3) Data analysis

[0129] According to the Ct value of each group, calculate the relative expression level according to formula 2 -ΔΔct

[0130] (4) Detect the expression level of the target protein by WB

[0131] Sample pretreatment: Cut the tissue into small pieces, weigh and record the weight, then place it in a 1.5 ml or 2 ml centrifuge tube, label the tube, freeze it at -80 °C for later use, and pre-cool the cryogenic grinder; Dissolve the RIPA (Beyotime, P0013B) lysis buffer (add PMSF a few minutes before use to make the final concentration of PMSF 1 mM).

[0132] ​Add the above complete lysis buffer at a ratio of 150 - 250 μL of lysis buffer per 20 mg of tissue, then add two sterilized zirconia grinding beads, and directly grind the sample in the lysis buffer (for tissue samples such as brain and spinal cord: temperature -20°C, frequency 70 Hz, time: pause for 10 s every 50 s of oscillation, cycle 3 - 4 times; for samples such as muscle and liver: temperature -20°C, frequency 70 Hz, time: pause for 10 s every 50 s of oscillation, 5 - 7 times). After the sample is ground, centrifuge the sample in a refrigerated centrifuge at 4°C, 12,000×g for 5 - 10 min, then take the supernatant and transfer it to a new sterilized EP tube, and store it at -20°C or -80°C;

[0133] Protein concentration determination: After determining the protein concentration according to the method in the improved BCA method protein concentration determination kit (Sangon Biotech, product number C503051), take an appropriate amount of protein homogenate sample according to the required amount, mix it with the corresponding amount of 5X SDS-PAGE protein loading buffer, boil it in a water bath for 10 min, cool it and centrifuge it at low speed for a moment, and wait for loading.

[0134] WB (Western Blot) detection:

[0135] A. SDS-PAGE electrophoresis: Determine the appropriate loading amount according to the protein concentration and expression level, less than 20 μL / well, and the protein loading amount of tissue homogenate is about 20 - 50 μg. The specific operation process of electrophoresis is as follows: Pull out the comb on the precast gel, install the gel into the electrophoresis tank, add electrophoresis buffer to both the inner and outer tanks, add freshly prepared buffer to the inner tank, and check for leaks. If there is no leak, add electrophoresis buffer to the outer tank; Take an appropriate amount of processed protein sample for loading, use a prestained standard protein as a reference, and perform constant voltage electrophoresis at 100 V on a Tianneng electrophoresis device for 100 min until the bromophenol blue reaches the bottom of the gel. Turn off the power, carefully remove the precast gel plate, take out the gel, and place it in the transfer buffer for subsequent operations;

[0136] B. Transfer: Cut 6 pieces of filter paper and 1 piece of PVDF membrane according to the gel area. Immerse the PVDF membrane in methanol for 5 - 10 s, then transfer it to the transfer buffer and soak it for 5 min. The filter paper is also pre-wetted in the transfer buffer; Install the transfer device: negative electrode (black board) - sponge - 3 layers of wetted filter paper - gel - PVDF membrane - 3 layers of wetted filter paper - sponge - positive electrode (transparent board). Drive out the air bubbles in each layer to avoid affecting the transfer effect, clamp the bracket, and place it in the electrotransfer tank; Use constant voltage ice bath transfer at 100 V for 100 min; Judge whether the transfer is successful according to whether the prestained protein molecular weight standard band is completely transferred to the PVDF membrane; Immerse the transferred PVDF membrane in PBST solution and wash it at room temperature for 5 min, and cut the PVDF membrane according to the requirements. Be careful not to let the PVDF membrane dry during the membrane cutting process;

[0137] C. Blocking and Antibody Incubation: Incubate the PVDF membrane with the blocking solution (5% non-fat milk powder) at room temperature for 2 h or overnight at 4°C; Transfer the blocked PVDF membrane into the primary antibody hybridization solution (Luciferase Rabbit Polyclonal antibody (Proteintech, 27986-1-AP) at 1:2000; GADPH Rabbit Polyclonal antibody (Proteintech, 10494-1-AP) at 1:2000; Rabbit GFP tag Polyclonal antibody (Proteintech, 50430-2-AP) at 1:2000, respectively added to 4 ml of QuickBlock TM Western Primary Antibody Dilution Buffer (Beyotime, P0256), and prepare the primary antibody hybridization solution), incubate at room temperature for 1 h or overnight at 4°C, then wash the membrane with PBST, 3×5 min; Transfer the washed PVDF membrane into the secondary antibody hybridization solution (HRP-conjugated Affinipure Goat Anti-Rabbit IgG(H+L) (Proteintech, SA00001-2) at 1:5000 added to 4 ml of QuickBlock TM Western Secondary Antibody Dilution Buffer (Beyotime, P0258), and prepare the secondary antibody hybridization solution), incubate at room temperature for 1 h, wash the membrane with PBST, 3×5 min;

[0138] D. Color Development: Mix equal volumes of Solution A and Solution B of the ECL chemiluminescence kit, shake well, then drop the luminescent solution onto the PVDF membrane to completely cover the PVDF membrane, adjust different exposure times to make the protein bands clear, and take pictures with the instrument.

[0139] (5) Cynomolgus Monkey Injection, Puncture and NGS Analysis

[0140] For animal experiments, male cynomolgus monkeys about 4 years old were used. After passing the AAV2 and AAV9 neutralizing antibody tests before the experiment, different serotype mutants and control serotypes were packaged with different GOIs (ssAAV.CAG.Fluc.WPRE.polyA vectors carrying different Barcodes), and intravenous injection was performed at equal viral amounts (the total dose of the mixed virus was controlled at 3E13 GC / Kg). Muscle puncture and liver puncture at different sites were performed at 2 weeks and 4 weeks respectively. Finally, tissue RNA extraction, RT-PCR and NGS sequencing were carried out. By analyzing the NGS data, the fold change of each serotype mutant relative to the control AAV9 was determined.

[0141] Verified by different methods in mouse experiments, it was found that the obtained mutants 1-6 had better muscle targeting than AAV9 and retained the low hepatotropism of the backbone (this result could be more intuitively observed from the in vivo imaging results at Figure 1 14 days and 28 days). Among them, mutants 1 and 3 even showed stronger muscle targeting than serotypes 109 and MyoAAV 4A. The mRNA levels of mutant 1 in the gastrocnemius, quadriceps femoris, triceps brachii, biceps brachii, abdominal muscles, and heart were 75.97 times, 37.27 times, 186.02 times, 13.79 times, 496.41 times, and 10.06 times that of AAV9, respectively. The mRNA levels of mutant 3 in the gastrocnemius, quadriceps femoris, triceps brachii, biceps brachii, abdominal muscles, and heart were 71.95 times, 43.25 times, 112.55 times, 4.99 times, 247.96 times, and 9.46 times that of AAV9, respectively ( Figure 2 .A- Figure 7 .A). The protein level results of mutants 1 and 3 were basically consistent with the mRNA level trends ( Figure 2 .B- Figure 7 .B). The liver results ( Figure 8 ) further confirmed that all serotype mutants based on the low-hepatotropism backbone showed low liver targeting, with mRNA levels 50-100 times lower than that of AAV9, and still a 9.5-19-fold decrease compared to MyoAAV 4A (screened based on the AAV9 backbone), showing very good targeting specificity.

[0142] To further illustrate the potential clinical use value of the serotypes of the present invention, the mutant and control serotype viruses were intravenously injected into cynomolgus monkeys in an equal mixture, and finally the expression strength relationship of different serotypes in muscle and liver tissues was determined by NGS analysis. Mutants 1 and 3 had good effects in various muscles of cynomolgus monkeys, which were relatively consistent with the results in mice. The mRNA levels of mutant 1 in the gastrocnemius, biceps brachii, triceps brachii, and quadriceps femoris (at 4 weeks) were 5.75 times, 13.31 times, 35.05 times, and 15.76 times that of AAV9, respectively ( Figure 9 ). Except that the expression effect in the gastrocnemius was slightly lower than that of MyoAAV 4A, the performance in other muscles was better than that of MyoAAV 4A, and the expression trend at 2 weeks was basically the same as that at 4 weeks. Slightly different from the mouse results, mutant 2, which showed slightly inferior performance in mouse muscles, had good effects in cynomolgus monkey muscles, and the effects in some muscles (such as the gastrocnemius and quadriceps femoris) were close to those of mutant 1. In addition, all the screened muscle mutants showed much lower hepatotropism than AAV9 and MyoAAV 4A in both mice and cynomolgus monkeys, further indicating the consistency and superiority of this backbone in cross-species use.

[0143] In summary, the present invention uses the strategy of constructing a small AAV mutant library to obtain multiple serotype mutants with better muscle targeting than AAV9. The effectiveness of these mutants has been verified at the mRNA and protein expression levels in muscle tissues such as gastrocnemius, quadriceps femoris, triceps brachii, biceps brachii, and abdominal muscles, and they have lower liver tropism and better specificity. These mutants can be further evaluated for their clinical application value and safety, providing more useful and optional vector tools for the gene therapy of muscle diseases and benefiting a large number of patients.

[0144] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. An adeno-associated virus capsid protein mutant, characterized in that, Its amino acid sequence is as shown in SEQ ID No.

10.

2. A nucleic acid encoding a mutant adeno-associated virus capsid protein, characterized in that, Its nucleotide sequence is as shown in SEQ ID No.

16.

3. An expression vector, characterized in that, It comprises the nucleic acid described in claim 2.

4. A host cell, characterized in that, It comprises the expression vector described in claim 3.

5. A host cell, characterized in that, It expresses the adeno-associated virus capsid protein mutant described in claim 1.

6. A recombinant adeno-associated virus, characterized in that, It comprises the adeno-associated virus capsid protein mutant described in claim 1.

7. The recombinant adeno-associated virus according to claim 6, characterized in that, It further comprises a heterologous target gene.

8. The recombinant adeno-associated virus according to claim 7, wherein, The heterologous target gene encodes any one of the gene products of interfering RNA, aptamer, endonuclease, and guide RNA.

9. A method for preparing recombinant adeno-associated virus, characterized in that, It comprises introducing at least the following components into a host cell: 1) the nucleic acid described in claim 2 or the expression vector described in claim 3, 2) an adeno-associated virus helper plasmid, and 3) a plasmid containing two terminal inverted repeats.

10. The rAAV prepared by the method described in claim 9.

11. A drug delivery tool, comprising the recombinant adeno-associated virus described in any one of claims 6-8 or the rAAV described in claim 10, and a pharmaceutically acceptable carrier.

12. Use of the adeno-associated virus capsid protein mutant according to claim 1, the expression vector according to claim 3, the host cell according to claim 4 or 5, the recombinant adeno-associated virus according to any one of claims 6-8, and the rAAV according to claim 10 in the preparation of a preparation for delivering a gene product to cells or tissues of a subject, characterized in that The cell is a muscle cell or a heart cell; the tissue is a muscle tissue or a heart tissue.

13. Use of the adeno-associated virus capsid protein mutant according to claim 1, the expression vector according to claim 3, the host cell according to claim 4 or 5, the recombinant adeno-associated virus according to any one of claims 6-8, and the rAAV according to claim 10 in the preparation of a drug delivery tool for delivering a gene product to cells or tissues of a subject, characterized in that The cell is a muscle cell or a heart cell; the tissue is a muscle tissue or a heart tissue.

Images