Cucumber corynespora cassiicola effect protein CcSP1 and coding gene and application thereof

Abstract

The invention belongs to the field of plant disease control research, and relates to a cucumber corynespora cassiicola effect protein CcSP1 as well as a coding gene and application thereof. The invention provides a novel cucumber corynespora cassiicola effect protein CcSP1 as well as a coding gene and application thereof. The nucleotide sequence of the coding gene of the corynespora cassiicola effect protein CcSP1 is as shown in SEQ ID NO. 1. Through transient expression of the CcSP1 gene in nicotiana benthamiana, allergic necrosis caused by nicotiana benthamiana can be inhibited. A gene deletion mutant delta CcSP1 is constructed through homologous recombination, vegetative growth is not affected by deletion of the gene, but the pathogenicity is remarkably reduced when cucumber leaves are infected. The result shows that CcSP1 participates in scab expansion after plants are infected by corynespora cassiicola, and plays an important role in the pathogenic process of corynespora cassiicola. The invention has important significance for analyzing the related molecular mechanism of the cucumber corynespora leaf spot and establishing the comprehensive prevention and control technical strategy of the plant cucumber corynespora leaf spot.

Description

Technical Field

[0001] The invention belongs to the research field of plant disease prevention and control, and particularly relates to a cucumber multi-primary coryneform spore effector protein. Background Art

[0002] Polyarchobacterium Corynespora cassiicola ) is an important plant pathogenic fungus distributed worldwide with a wide host range and strong parasitic specialization. It can infect more than 530 species of plants in nearly 380 genera in tropical and subtropical regions, involving vegetable crops such as Solanaceae and Cucurbitaceae, as well as economic and food crops such as rubber, cotton, and soybeans.

[0003] cucumber( Cucumis sativus L.) is one of the main vegetable crops in my country, and its planting area and yield rank first in the world. In recent years, with the rapid promotion of facility cultivation technology, Corynespora leaf spot caused by infection of multiple main corynespora has become an important emerging epidemic disease in my country's cucumber production. The disease was once a minor disease in my country. Since the 1990s, it has frequently occurred in cucumber producing areas across my country, causing serious economic losses, generally reducing production by 20%, and sometimes up to 60%~70%. At present, the disease has become an important factor restricting the development of my country's cucumber industry. At present, a comprehensive prevention and control strategy based on chemical control is adopted for cucumber corynespora leaf spot in production. Therefore, breeding and use of disease-resistant varieties are still the most economical, safe and effective potential ways to prevent and control the disease. However, due to the lack of highly resistant germplasm resources, the current breeding of cucumber corynespora leaf spot resistant varieties has been very slow, especially in the use of genetic engineering for disease-resistant breeding. There are many difficulties, which is related to people's unclear understanding of the interaction mechanism between the pathogen and the host. Patent 201710303171.5 discloses a cucumber disease resistance-related gene CsERF004, its encoding protein and application. It was found that overexpression of the CsERF004 gene significantly increased the content of free salicylic acid in cucumbers, and had obvious resistance to downy mildew and coryneformis leaf spot in the seedling stage, providing a new solution to reduce cucumber diseases and pests and improve cucumber resistance to downy mildew and coryneformis leaf spot. Patent 202110901047.5 discloses a multi-main coryneformis CcTLS1 protein and encoding gene and its application. It is confirmed that after the multi-main coryneformis CcTLS1 gene is knocked out, the multi-main coryneformis knockout mutant obtained has a significantly reduced lesion area on cucumber leaves compared to the wild strain; the mycelial growth rate and cellobiohydrolase activity of the multi-main coryneformis knockout mutant are significantly lower than those of the wild-type multi-main coryneformis. The results showed that the deletion of CcTLS1 gene in the knockout mutant of Corynespora multilocus could lead to a decrease in the infection ability of Corynespora multilocus to cucumber, which is of great significance in the prevention and control of cucumber Corynespora leaf spot disease.

[0004] Therefore, in-depth analysis of the molecular pathogenic mechanism of cucumber coryspore leaf spot pathogen has important scientific and practical significance for further optimizing the prevention and control strategies of the disease. Summary of the invention

[0005] In order to solve the above problems, the present invention proposes a cucumber polysporus effector protein CcSP1 and its encoding gene and application.

[0006] The technical solution of the present invention is achieved in this way: In one aspect, the present invention provides a gene encoding a multi-primary coryneform effector protein CcSP1, the nucleotide sequence of which is shown in any one of the following: 1) The nucleotide sequence is shown in SEQ ID No. 1; 2) The nucleotide sequence has a similarity of more than 90% with the sequence described in SEQ ID No.1 In a second aspect, the present invention provides a biomaterial, wherein the biomaterial comprises the following: (1) An expression protein containing the coding gene according to claim 1; (2) a recombinant vector containing the expression protein described in step (1); (3) A microorganism containing the recombinant vector described in step (2).

[0007] Preferably, the method for constructing the above-mentioned recombinant vector is: using the cDNA of Cucumis sativus HG3 as a template, using CcSP1-HF-F and CcSP1-HF-R as a primer pair to amplify and recover the target fragment, and connecting the amplified product with the PICH vector through one-step cloning to obtain the recombinant vector.

[0008] Preferably, the nucleotide sequence of the above CcSP1-HF-F is shown as SEQ ID No.2, and the nucleotide sequence of CcSP1-HF-R is shown as SEQ ID No.3.

[0009] In a third aspect, the above-mentioned coding gene or the above-mentioned biological material is used to inhibit the pathogenicity of Polymyxin B.

[0010] A fourth aspect is the use of the above-mentioned encoding gene or the above-mentioned biological material in inhibiting plant allergic necrosis reaction.

[0011] Preferably, the plant is Nicotiana benthamiana or cucumber.

[0012] In a fifth aspect, the above-mentioned encoding gene or the above-mentioned biological material is used in preventing and controlling Polymyxin Bacteria or preventing and controlling plant diseases caused by Polymyxin Bacteria.

[0013] Preferably, the above-mentioned plant diseases are diseases of cucurbit plants.

[0014] Preferably, the above-mentioned melon plant disease is cucumber corynespora leaf spot.

[0015] The present invention has the following beneficial effects: The present invention provides a cucumber polyspore effector protein CcSP1 and its encoding gene and application. Transient expression of the CcSP1 gene in Nicotiana benthamiana can inhibit the allergic necrosis reaction caused by Nicotiana benthamiana. The gene deletion mutant ΔCcSP1 was constructed by homologous recombination. The deletion of the gene did not affect the vegetative growth, but the pathogenicity was significantly reduced when infecting cucumber leaves, indicating that CcSP1 was involved in the expansion of lesions after polyspores infected plants, and played an important role in the pathogenic process of polyspores. It is of great significance for analyzing the relevant molecular mechanisms of cucumber coryneform leaf spot disease and establishing a comprehensive prevention and control technology strategy for plant cucumber coryneform leaf spot disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0017] Figure 1 Schematic diagram of the construction of the gene knockout kit.

[0018] Figure 2 is the acquisition of knockout mutants; A is the electrophoresis detection diagram of the upstream and downstream fragments L1 and L2, B is the electrophoresis detection diagram of L1H1 and L2H2, and C is CcSP1 Diagram of four pairs of primers for detecting deletion mutants.

[0019] Figure 3 is the acquisition of complement strain; where A is CcSP1 complement the amplification of the target gene; B is CcSP1 Identification of complementing strains.

[0020] Figure 4 To transiently express the cucumber polysporus effector protein CcSP1 gene in Nicotiana benthamiana leaves to inhibit cellular hypersensitive necrosis response.

[0021] Figure 5 for CcSP1 The knockout mutant and complemented strains were inoculated in four different culture media for nutritional growth assay; A is the colony morphology after 7 days of culture on a 90 mm plate, and B is the statistical graph of colony diameters measured at 7 days.

[0022] Figure 6 for CcSP1 Determination of mutant pathogenicity. DETAILED DESCRIPTION

[0023] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0024] Unless otherwise specified, the experimental methods used in the following experimental examples are all conventional methods; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0025] Example 1 Construction of knockout kit Construction of gene knockout cassette: Using the genomic DNA of the wild-type strain of Cucumis sativus HG3 as a template, the primer pairs CcSP1-1F (TGGAAAGAAGGACCACAATC) / CcSP1-2R (TTGACCTCCACTAGCTCCAGCCAAGCCGGTGACTGGATTGATAGGA) and CcSP1-3F (GAATAGAGTAGATGCCGACCGCGGGTTCTCTAAGATGCTTTTTGGAGGTGGA) / CcSP1-4R (ACGCAACAAGAGAGGAGTG) were used to amplify the upstream L1 and downstream L2 fragments of the target gene CcSP1, respectively. The size of L1 is 1136 bp, and the size of L2 is 1138 bp ( Figure 2-A); pKOV21 plasmid was used as template and primers HYG / F (GGCTTGGCTGGAGCTAGTGGAGGTCAA) and HYG / R (GAACCCGCGGTCGGCATCTACTCTAT) were used to amplify the full length of the hygromycin phosphotransferase (hph) gene. The PCR product was recovered by gel electrophoresis after cutting the gel. PCR reaction system: 2× NG PCR master Mix 10 μL, 1 μL of upstream and downstream primers, 1 μL of DNA template, supplemented with ddH2O to 20 μL. PCR reaction program: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min 20 s, 35 cycles; 72℃ extension for 7 min, and storage at 16℃. The concentration of the L1 L2 fragment recovery product was diluted to 50 ng / μL, and the upstream fragment L1, downstream fragment L2 and hph fragment of the target gene were added to the system in a ratio of 1:1:3 as templates, and fusion PCR was performed using Split-marker recombination technology. PCR reaction system: 2 × Super Pfx MasterMix 5 μL, upstream and downstream fragments L1 and L2 1 μL each, hygromycin fragment HYG 5 μL, supplemented with ddH2O to 25 μL. PCR reaction program: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 58℃ annealing for 30 s, 72℃ extension for 2 min 30 s, 15 cycles; 72℃ extension for 7 min, and storage at 16℃. The fusion PCR product was used as a template and the primer pairs CcSP1-1F / HY-R (GTATTGACCGATTCCTTGCGGTCCGAA) and YG-F (GATGTAGGAGGGCGTGGATATGTCCT) / CcSP1-4R were used to amplify the upstream and downstream fusion fragments LIH1 and L2H2, respectively. The size of L1H1 was 1900 bp and the size of L2H2 was 2155 bp ( Figure 2 -B). After 1.2% agarose gel electrophoresis, the PCR product was cut and recovered. PCR reaction system: 2 × Super Pfx MasterMix 12.5 μL, 0.75 μL of upstream and downstream primers, 1 μL of the previous round of product, supplemented with ddH2O to 25 μL. PCR reaction program: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 58℃ annealing for 30 s, 72℃ extension for 1 min 10 s, 35 cycles; 72℃ extension for 7 min, 16℃ storage. Using the principle of homologous recombination, the CcSP1 gene was replaced with the hygromycin gene ( Figure 1 ).

[0026] Example 2 Construction of complementation strains The genomic DNA of the wild-type HG3 strain was used as a template to amplify the CcSP1 gene and its promoter sequence using primers CcSP1-HF-F (CTCGAGGTCGACCATCGATACCTCATCGCCATTTGCTAA) / CcSP1-HF-R (GACCTGCAGGCATGCAAGCTGAAGGGGGTGGGCTCCTCAAC). The fragment size was 2513 bp ( Figure 3 -A). The PCR product was recovered by gel electrophoresis after 1.2% agarose gel electrophoresis, diluted to 50 ng / μL, and stored at -20℃ for later use. PCR reaction system: 2 × Super PfxMasterMix 12.5 μL, 0.75 μL of each upstream and downstream primer, 2 μL of template DNA, supplemented with ddH2O to 25 μL. PCR reaction program: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 58℃ annealing for 30 s, 72℃ extension for 2 min 30 s, 35 cycles; 72℃ extension for 7 min, stored at 16℃. After the pKNTG plasmid was extracted from Escherichia coli, it was digested with HindⅢ. The reaction system was as follows: 10 × NE Buffe 10 μL, HindⅢ 1 μL, plasmid 1.5 μL, supplemented with ddH2O to 50 μL. The enzyme was digested at 37℃ overnight for 12h, and then inactivated in a water bath at 80℃ for 20 min. The pKNTG vector linearized by HindIII was purified and recovered, diluted to 50 ng / μL, and stored at -20℃ for later use. The target gene fragment containing its own promoter was constructed into the pKNTG vector linearized by HindIII using the One Step Seamless Cloning Kit. The reaction system was as follows: 2 × Onestep Cloning Mix 5 μL, target gene fragment 2 μL, enzyme linearized pKNTG vector 1 μL, supplemented with ddH2O to 10 μL. The PCR reaction program was: 50℃, 15 min, and stored at 16℃. The ligation product was co-transformed into E. coli DH5α competent cells and screened on LBA medium plates containing AMP. The transformants were then verified by colony PCR using CcSP1-5F (TGAACAGCCAGCAAACAG) / GFP-R (GATGCCCTTCAGCTCGATGCGGTTCA) and sequenced. Positive transformants were shake-cultured and the recombinant plasmid was extracted.

[0027] Example 3 Construction of CcSP1 transient expression vector According to the whole genome sequence of Cucumis sativus HG3, the CDS sequence of CcSP1 was obtained by bioinformatics, and the full-length CDS of CcSP1 was designed (CcSP1-HF-F (SEQ ID No.2): TTACAATTATCGATACAATGTACCCATACGACGTCCCAGACTACGCTATGCGCTCTTTCGTTGCTGTGGCT, CcSP1-HF-R (SEQID No.3): CTCATTAAAGCAGGACAAGCGAAGGGGGTGGGCTCCTCAAC). PCR amplification was performed using the cDNA of Cucumis sativus HG3 as a template to obtain the full-length CDS of CcSP1. ΔSP -F (TTACAATTATCGATACAATGTACCCATACGACGTCCCAGACTACGCTATGTGCAATGGCGTAGGAGGTTG), CcSP1-HF-R was used to amplify the fragment without signal peptide, and KOD OneTMPCR Master Mix-Blue- from Toyobo was used for amplification. The PCR reaction system was KOD OneTM PCR Master Mix-Blue-12.5 µL, forward and reverse primers 0.75 µL, and ddH2O was added to 25 µL. Reaction conditions: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s; 56℃ annealing for 5 s; 68℃ extension for 30 s for 35 cycles; 68℃ final extension for 7 min; 16℃ storage. After agarose gel electrophoresis detection, the PCR product was excised and purified, and the target fragment was connected with PICH after enzyme digestion, 50℃ for 50 min; 16℃ storage. The ligation product was transformed into E. coli DH5α cells, positive clones were screened for sequencing, and the correct clones were selected to extract the plasmid.

[0028] Example 4 Transient expression of CcSP1 encoding gene in Nicotiana benthamiana leaves Recombinant plasmids were introduced into Agrobacterium competent cells: plasmid DNA was extracted from the Escherichia coli strain verified by sequencing using a plasmid kit, Agrobacterium GV3101 competent cells were placed on ice to melt, 3 μL of plasmid DNA was gently and slowly added to the competent cells, and they were placed on ice to cool for 30 min. Seal the centrifuge tube with a sealing film, freeze it in liquid nitrogen for 2 min, and heat shock it at 37℃ for 3-5 min. Add 800 μL of LB liquid culture medium and mix well, and culture it in a 28℃ shaker for 3-4 h. Centrifuge at 4000 rpm for 2 min to collect the bacteria, and place the bacteria on the LB culture medium with corresponding resistance for screening. After 2 days, the colonies grew for PCR verification. The verified Agrobacterium colonies were placed in LB+50 μg / mL Kan+50 μg / mL Rif and cultured in a 28℃ 220 rpm shaker for 24 h-36 h. Centrifuge at 5000 rpm for 3 min to collect the bacteria, and suspend the bacteria with MMA. MMA adjusted the bacterial solution to OD = 0.6, and injected the adjusted OD = 0.6 Agrobacterium bacterial solution into tobacco leaves. The effector protein was injected into the tobacco, and BAX was injected 12 hours later. The tobacco necrosis was observed 4 days later. After 4 days, it was found that the complete effector protein CcSP1 inhibited the allergic necrosis reaction caused by BAX, and the coding region without the signal peptide could not inhibit the allergic necrosis reaction caused by BAX, which shows that the signal peptide plays an important role in inhibiting the allergic necrosis reaction caused by BAX ( Figure 4 ).

[0029] Example 5 Obtaining knockout mutants and complemented strains Preparation of protoplasts of Multi-main Coryneformis HG3: The wild type cucumber Multi-main Coryneformis HG3 stored in a 30% glycerol cryovial in a 4℃ refrigerator was activated on the prepared PDA medium and cultured in a constant temperature incubator at 25℃ for 3 days. The young mycelium at the edge of the activated colony was cut into small pieces with a scalpel and placed in the prepared 100 mL YPD liquid medium with AMP, placed in a constant temperature shaker, 28℃, 180 rpm for 24 h, then broken with a homogenizer, and then added to the YPD medium to make the volume 100 mL, and continued to be placed in a constant temperature shaker, 28℃, 180 rpm for 12 h. Filter the bacterial solution with a sterilized funnel with a non-woven filter cloth to obtain the juveniles, rinse the juveniles repeatedly with sterile water until they turn white, and take an appropriate amount of the juveniles in a sterilized small triangular bottle for use. Weigh 200 mg of collapsing enzyme, 100 mg of snail enzyme, and 100 mg of lyase, add them to the prepared 50 mL centrifuge tube containing 10 mL of 0.7 M NaCl solution, wrap it with tin foil to avoid light, put it in a constant temperature shaker, shake it thoroughly at 30°C, 100 rpm for 30 min, centrifuge it at 3500 rpm for 7 min, filter the supernatant with a 0.45 μm bacterial filter to sterilize it into a small triangular bottle containing the larvae, wrap it with tin foil to avoid light, put it in a constant temperature shaker, 30°C, 100 rpm for lysis for 3 h. Filter the lysed protoplasts with a sterile small beaker with a non-woven filter cloth, gently rinse with 0.7 M NaCl solution, collect the protoplasts in a sterile 50 mL centrifuge tube, centrifuge at 3500 rpm for 7 min, gently discard the supernatant, add 1.5 mL of STC buffer to resuspend the protoplast pellet, then divide it into sterile 2 mL centrifuge tubes, centrifuge again at 4°C, 4000 rpm for 2 min, discard the supernatant, and resuspend it again with 500 μL of STC buffer.

[0030] PEG-mediated protoplast transformation: In a sterilized 50 mL centrifuge tube, add 200 μL of prepared protoplasts, and then add 10 μL each of the recovered products L1H1 and L2H2 (in a sterilized 50 mL centrifuge tube, add 200 μL of prepared protoplasts, and then add 10 μL of recombinant plasmid). Gently rotate the centrifuge tube to mix, and let it stand on ice for 30 min; then add 1 mL of PEG dropwise again, gently rotate the centrifuge tube to mix, and let it stand at room temperature for 20 min. Add 5 mL of TB3 liquid culture medium with AMP to a 50 mL centrifuge tube, let it stand at room temperature for 2 h (the time can also be extended), put it in a constant temperature shaker, shake it at 25°C, 100 rpm for 12 h, pour the PDA culture medium at moderate temperature into the recovered mycelium, make the volume to 30 mL, add 30 μL of AMP (AMP concentration is 100 mg / mL) and 30 μL of hygromycin (hygromycin concentration is 50 mg / mL), invert to mix, pour two plates, (make the volume to 30 mL, add 30 μL of AMP (AMP concentration is 100 mg / mL) and 30 μL of G418 (G418 concentration is 50 mg / mL), invert and mix, invert two plates and place them in a 25℃ constant temperature incubator for dark culture. After growing hyphae, cover them with a layer of PDA (G418 PDA) containing AMP and hygromycin. After the hyphae germinate again, pick a single hyphae under a stereoscope and place it on the PDA medium containing AMP and hygromycin to obtain knockout transformants. Four pairs of primers were used for detection (M: Marker, T: target gene, H: hygromycin phosphotransferase gene, F: upstream recombinant fragment, R: downstream recombinant fragment, WT: wild-type control). The target gene CcSP1-5F / CcSP1-6R amplification had no band, the hygromycin HYG-F / HYG-R detection band size was 1380 bp, the upstream connection site detection CcSP1-7F / HY-R detection band size was 2193 bp, and the downstream connection site YG-F / CcSP1-8R detection fragment size was 2360 bp. A total of 4 knockout mutants were obtained through screening with four pairs of primers. ΔCcSP1 -2. ΔCcSP1 -6. ΔCcSP1 -9. ΔCcSP1 -139 ( Figure 2 -C). Select ΔCcSP1-6 for follow-up research. After the hyphae germinate again, a single hyphae is picked under a stereoscope and placed on a PDA medium containing AMP and G418 to obtain knockout transformants. Three pairs of primers are used for detection (primers CcSP1-5F / CcSP1-6R are used to detect whether the target gene and the vector are successfully connected, with a size of 284 bp, primers G852F / G850R are used to detect whether the G418 resistance gene exists, with a size of 650 bp, and primers CcSP1-5F / GFP-R are used to detect whether the connection site is correct, with a fragment size of 776 bp. Two strains were obtained by verification of complementation, namely c CcSP1 -6_1, c CcSP1 -6_3 Three pairs of primers detected correctly ( Figure 3 -B). Select c CcSP1 -6_3 referred to as c CcSP1 -6, for follow-up studies).

[0031] Example 6 Vegetative growth assay of knockout mutants and complemented mutants The wild-type HG3 and knockout mutant Δ CcSP1 and complement mutant c CcSP1 The wild type cucumber polysporus HG3, the knockout mutant Δ CcSP1 , complement strain c CcSP1 The activated cells were cultured on the prepared PDA medium in a 25°C constant temperature incubator for 3 days, and a 5 mm bacterial cake was made on the edge of the hyphae. After 7 days of culture in a 25°C constant temperature incubator, the morphology of the colonies was observed and the diameter of the colonies was counted. CcSP1 -6. Replenishment strain c CcSP1 There was no difference in colony morphology between -6 and wild-type HG3 after 7 days in four different culture media: PDA, OM, CM and MM ( Figure 5 -A), and there was no difference in colony size ( Figure 5 -B).

[0032] Example 7 Effects of knockout mutants and complemented mutants on the pathogenicity of Cucumber Polymycospora leaf spot The wild type cucumber polysporus HG3 and the knockout mutant Δ CcSP1 , complement strain c CcSP1Activate on the prepared PDA medium, culture in a constant temperature incubator at 25°C for 3 days, make a 5 mm cake on the edge of the mycelium, use blank PDA as a blank control, culture in a constant temperature incubator at 25°C for 7 days, scrape the colony with an inoculation needle, rinse with sterile water three to four times, filter with a funnel containing a non-woven filter cloth to collect the spore suspension, and adjust the concentration of the spore suspension to 1 × 10 6 / mL, using the drop method, 40 μL of spore suspension was evenly dropped on a cucumber leaf with a diameter of 2 cm using a pipette. The spore suspension was kept at more than 95% moisture for 12 hours after inoculation, and dark treatment was carried out. It was placed in a 28℃ greenhouse with 12 hours of light and dark alternation. After 5 days, the disease was observed and photographed. The experiment was repeated three times. CcSP1 -6 had no difference in the incidence between wild-type HG3 and the knockout mutant Δ CcSP1 Compared with wild-type HG3, the knockout mutant Δ CcSP1 -6 significantly reduced pathogenicity when infecting cucumber leaves ( Figure 6 ).

[0033] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A gene encoding a multi-primary coryneform effector protein CcSP1, the nucleotide sequence of which is shown in any of the following: 1) The nucleotide sequence is shown in SEQ ID No. 1; 2) The nucleotide sequence has a similarity of more than 90% with the sequence described in SEQ ID No.

1.

2. A biomaterial, characterized in that: The biological material includes the following: (1) An expression protein containing the coding gene according to claim 1; (2) a recombinant vector containing the expression protein described in step (1); (3) A microorganism containing the recombinant vector described in step (2).

3. The biomaterial according to claim 2, characterized in that The construction method of the recombinant vector is as follows: using the cDNA of cucumber polysporus HG3 as a template, using CcSP1-HF-F and CcSP1-HF-R as a primer pair to amplify and recover the target fragment, and connecting the amplified product with the intermediate vector through one-step cloning to obtain the recombinant vector.

4. The biomaterial according to claim 3, characterized in that: The nucleotide sequence of CcSP1-HF-F is shown in SEQ ID No.2, and the nucleotide sequence of CcSP1-HF-R is shown in SEQ ID No.

3.

5. Use of the coding gene according to claim 1 or the biological material according to any one of claims 2 to 4 in inhibiting the pathogenicity of Corynespora multilocus.

6. Use of the coding gene according to claim 1 or the biological material according to any one of claims 2 to 4 in inhibiting plant allergic necrosis reaction.

7. The use according to claim 6, characterized in that: The plant is Nicotiana benthamiana or Cucumis sativus.

8. Use of the coding gene according to claim 1 or the biological material according to any one of claims 2 to 4 in controlling polymyxin B or controlling plant diseases caused by polymyxin B.

9. The use according to claim 8, characterized in that: The plant diseases are melon plant diseases.

10. The use according to claim 9, characterized in that: The melon plant disease is cucumber coryneformis leaf spot.

Images