Monoclonal antibody 7A12 for identifying gene type 2 swine fever as well as preparation method and application method of monoclonal antibody 7A12

Abstract

The invention relates to the technical field of biology, and aims to provide a monoclonal antibody 7A12 for identifying gene type 2 swine fever as well as a preparation method and an application method of the monoclonal antibody 7A12. The monoclonal antibody comprises Ig structural domains VH CDR1, VH CDR2 and VH CDR3 of a heavy chain of the antibody, and Ig structural domains VL CDR1, VL CDR2 and VL CDR3 of a light chain of the antibody, wherein the amino acid sequences of the VH CDR1, the VH CDR2 and the VH CDR3 are respectively as shown in SEQ ID NO: 1 to SEQ ID NO: 3; the amino acid sequences of the VL CDR1, the VL CDR2 and the VL CDR3 are respectively as shown in SEQ ID NO: 4 to SEQ ID NO: 6. The antibody provided by the invention has the advantages of high titer, strong specificity, high affinity and the like; the kit has the advantages of high sensitivity and strong specificity, has no cross reaction with the type 1 swine fever vaccine strain, and can identify and diagnose swine fever gene type 2 wild strain infection and vaccine immunity in serology; the method can be further used for establishing a blocking ELISA kit for identifying the gene type 2 hog cholera, and can effectively diagnose and purify the gene type 2 hog cholera virus.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a monoclonal antibody 7A12 for identifying genotype 2 swine fever and a preparation and application method thereof. Background Art

[0002] Classical swine fever (CSF) is a highly contagious and fatal infectious disease of pigs caused by classical swine fever virus (CSFV). Clinically, it is characterized by rapid onset, prolonged high fever, systemic diffuse punctate hemorrhage and splenic infarction. It can cause fever, anorexia, diarrhea, death, etc. in sick pigs, and may have neurological symptoms. Sows may miscarry or give birth to dead piglets. Under natural conditions, pigs of different ages and breeds can be infected. It is widely distributed around the world, causing huge economic losses to the global pig industry.

[0003] CSFV belongs to the genus Pestivirus of the family Flaviviridae. Other recognized species that belong to the genus Pestivirus include bovine viral diarrhea virus type 1 (BVDV-1), bovine viral diarrhea virus type 2 (BVDV-2), and sheep border virus (BDV). CSFV is an enveloped single-stranded positive-strand RNA virus with a genome size of approximately 12.3 kb, containing a large open reading frame (ORF). The ORF encodes a polyprotein composed of 3898 amino acids, which is cleaved into 12 mature viral proteins under the action of viral and host cell proteases, including 4 structural proteins and 8 non-structural proteins. The structural proteins include nucleocapsid protein C and 3 envelope glycoproteins, Erns, E1 and E2, and the non-structural proteins include Npro, p7, NS2, NS3, NS4A, NS4B, NS5A and NS5B. Each mature protein plays a different role in the life cycle and infection process of classical swine fever virus.

[0004] CSFV contains 3 genotypes and 11 genotypes. Domestic researchers have successfully controlled the prevalence of CSF based on the widespread use of type 1 CSFV attenuated vaccine (C strain). However, under the pressure of the C strain vaccine, the 1.1 subgenotype has gradually withdrawn from the stage since the beginning of the 21st century. At present, the CSFV strains prevalent in the main pig-producing areas in China are mainly subgenotype 2.1, such as QZ14 strain, HZ08 strain, HuN23 strain, HLJ1 strain, etc. Although the C strain is recognized as a safe and effective CSF vaccine, it cannot be effectively used for the differential diagnosis of genotype 2 swine fever, resulting in the inability to ultimately purify swine fever. Therefore, establishing an effective rapid identification technology for genotype 2 CSFV epidemic strain infection serum antibodies and C strain immune serum antibodies is an important issue that needs to be solved urgently, which will further promote the purification of swine fever virus.

[0005] Since the first application of cell-cultured classical swine fever virus to immunize mice to establish and prepare MAbs for classical swine fever in 1986, MAbs have been widely used in the diagnosis of classical swine fever. Based on this technology, many anti-CSFV monoclonal antibodies and their recognition epitopes have been discovered. However, monoclonal antibodies that can distinguish between genotype 2 CSFV epidemic strains and vaccine C strains have not been reported.

[0006] Therefore, the present application intends to propose a new monoclonal antibody to solve the above technical problems. Summary of the invention

[0007] The technical problem to be solved by the present invention is to overcome the deficiencies in the prior art and provide a monoclonal antibody 7A12 for identifying genotype 2 classical swine fever and a preparation and application method thereof.

[0008] To solve the technical problem, the solution of the present invention is:

[0009] Provided is a monoclonal antibody 7A12 for identifying genotype 2 classical swine fever, the monoclonal antibody comprising the Ig domain V of the antibody heavy chain H CDR1, V H CDR2 and V H CDR3, and the Ig domain V of the antibody light chain L CDR1, V L CDR2 and V L CDR3; wherein the V H CDR1, V H CDR2 and V H The amino acid sequences of CDR3 are shown in SEQ ID NOs: 1 to 3 respectively; L CDR1, V L CDR2 and V L The amino acid sequences of CDR3 are shown in SEQ ID NOs: 4 to 6, respectively.

[0010] As a preferred embodiment of the present invention, the monoclonal antibody is a full-length antibody, a Fab antibody or a F(ab')2 antibody.

[0011] As a preferred embodiment of the present invention, in the monoclonal antibody, the amino acid sequence of the light chain variable region is shown as SEQ ID NO.7, and the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO.8.

[0012] The present invention also provides a gene encoding the aforementioned monoclonal antibody, wherein the gene sequence encoding the light chain variable region is shown as SEQ ID NO.9, and the gene sequence encoding the heavy chain variable region is shown as SEQ ID NO.10.

[0013] The present invention further provides a method for preparing the aforementioned monoclonal antibody, comprising the following steps:

[0014] (1) Based on the genotype 2 CSFV E2HZ protein gene sequence shown in SEQ ID NO: 11, a recombinant plasmid having the genotype 2 CSFV E2HZ protein gene sequence was constructed using specific primers shown in SEQ ID NO. 12 and SEQ ID NO. 13;

[0015] (2) further expressing and purifying the recombinant CSFV-E2HZ protein using an insect cell expression system;

[0016] (3) Animal immunization with recombinant CSFV-E2HZ protein;

[0017] (4) Through hybridoma monoclonal antibody technology, positive hybridoma cells are screened and monoclonalized to identify monoclonal antibodies for identifying genotype 2 classical swine fever.

[0018] The present invention also provides an application method of any one of the aforementioned monoclonal antibodies, which is to prepare a kit for identifying genotype 2 swine fever using the monoclonal antibody.

[0019] The present invention also provides a kit for identifying genotype 2 classical swine fever, the kit comprising any one of the monoclonal antibodies described in claim 1 or 2.

[0020] As a preferred embodiment of the present invention, the kit is a blocking ELISA kit, and the detection method when using the kit is serological detection.

[0021] Compared with the prior art, the technical effects of the present invention are:

[0022] 1. The monoclonal antibody provided by the present invention is of IgG1 subtype, which has the advantages of high titer, strong specificity, high affinity, etc.

[0023] 2. The monoclonal antibody provided by the present invention has high sensitivity and strong specificity, and has no cross reaction with type 1 classical swine fever vaccine strains. It can serologically differentiate and diagnose classical swine fever gene type 2 wild strain infection and vaccine immunity.

[0024] 3. The monoclonal antibody provided by the present invention can be further used to establish a blocking ELISA kit for identifying genotype 2 classical swine fever virus, which can effectively diagnose and purify genotype 2 classical swine fever virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is an indirect immunofluorescence and SDS-PAGE analysis of the eukaryotically expressed and purified genotype 2 CSFV E2HZ protein in Example 1.

[0026] Figure 2 The reactivity of the serum of mice immunized with CSFV E2HZ protein in Example 2 with Bac-CSFV E2 HZ.

[0027] Figure 3 The reactivity of the CSFV E2HZ 7A12 monoclonal antibody in Example 2 with E2 of different CSFV strains.

[0028] Figure 4 This is the subtype classification of the CSFV E2HZ 7A12 monoclonal antibody in Example 2.

[0029] Figure 5 The present invention is the identification of the antigenic epitope recognized by the CSFV E2HZ 7A12 monoclonal antibody in Example 3 and its conservation analysis.

[0030] Figure 6 The optimal antigen coating concentration, monoclonal antibody dilution ratio, and serum dilution ratio of the genotype 2 classical swine fever identification blocking ELISA system in Example 4 were determined.

[0031] Figure 7 This is the preliminary establishment of the ELISA system for identifying and blocking genotype 2 classical swine fever in Example 4.

[0032] Figure 8 This is the specific detection of the ELISA system for identifying and blocking genotype 2 classical swine fever in Example 4. DETAILED DESCRIPTION

[0033] The present invention obtains CSFV E2HZ protein with high purity and good activity through a eukaryotic expression system, obtains monoclonal antibody 7A12 capable of identifying genotype 2 classical swine fever virus infection after immunizing mice, and preliminarily establishes a classical swine fever identification blocking ELISA system.

[0034] The implementation of the present invention is described in detail below in conjunction with specific implementation examples.

[0035] Example 1: Preparation of genotype 2 CSFV E2HZ protein

[0036] Implementation method:

[0037] (1) Construction of eukaryotic expression vector of genotype 2 CSFV E2HZ protein: The gene sequence of genotype 2 CSFV E2HZ protein is shown in SEQ ID NO: 11. Specific primers (F: CTGCTGGTGACCGGGGCACAAGGGATGCGGCTGTCCTGTAAGGAAGACTACAG, sequence SEQ ID NO. 12; R: TCTAGTACTTCTCGACAAGCTTTTAGTGATGGTGATGGTGATGGGTCACGTCCA GATCAAACCAGTAT, sequence SEQ ID NO. 13) were used to perform PCR with genomic cDNA of genotype 2 CSFV HZ08 strain as template. The target gene was inserted into pFastBac with secretion signal peptide (SP) by homologous recombination method. TM The recombinant plasmid pFastBac was constructed on the HTB vector. TM HTB-SP-E2HZ. The correct pFastBac TM The HTB-SP-E2HZ shuttle plasmid was transformed into DH10Bac competent medium, revived at 37°C for 5 h, spread on a triple-antibody plate (kanamycin, tetracycline and gentamicin, KTG) containing 100 μL X-gal and 5 μL IPTG, cultured at 37°C overnight, screened for blue-white spots, selected white colonies, cultured at 37°C with shaking for 14 h, and the bacterial solution was streaked again to isolate single white colonies and preserved.

[0038] (2) Recombinant CSFV-E2HZ baculovirus transfection and expansion: Use the kit to extract the bacmid of the recombinant baculovirus Bac-CSFVE2HZ. Take 2 μg of Bacmid-E2HZ and add 250 μL of Sf-900 without double antibody. TM III SFM culture medium, pipette and mix, mark as liquid A; take another 8μL of CellfectinⅡReagent transfection reagent and add it to another 250μL Sf-900TMIII SFM culture medium without double antibody, vortex and mix, mark as liquid B; mix liquid A and liquid B, incubate at room temperature for 15-20min. Add the mixture dropwise to the Sf9 cells that have been rinsed after discarding the culture medium, and add 1.5mL of Sf-900 without double antibody. TM III SFM medium, incubate at 27.5℃ for 5h. Aspirate the transfection mixture and add 5mL Sf-900 containing 1% Antibiotic-Antimycotic (100x)TM III SFM medium. Observe the cell lesions every day. About 5 days later, a large amount of CPE appeared in SF9 cells, the cells became larger and rounder, and a large area of ​​​​shedding was observed. After the cells were harvested and frozen and thawed, the supernatant was centrifuged to obtain the P1 generation virus stock solution, which was divided into 1.5mL EP tubes, 500μL per tube, and stored at -80℃. Take 500μL of the P1 generation virus stock solution and add it to 90% density SF9 cells, culture at 27℃, observe for lesions every day, harvest the cells after a large number of lesions appear at 72-96, freeze and thaw, centrifuge and take the supernatant, obtain the P2 generation virus stock solution, divide it into 1.5mL EP tubes, 500μL per tube, and store it at -80℃. The same method was used to amplify the P3 generation virus stock solution.

[0039] (3) IFA identification of recombinant CSFV-E2HZ protein: When the density of Sf9 cells in the 96-well plate reaches 70-80%, 10 μL of P1 virus solution is inoculated into each well and cultured in a 27.5°C incubator. After the cytopathic effect is observed, IFA is used to identify whether Sf9 cells express recombinant type 2 CSFV E2HZ protein. The IFA procedure is as follows: discard the cell culture medium, wash the cells once with PBS, and aspirate dry; add 100 μL of 80% acetone pre-cooled at -20°C to each well and fix at -20°C for more than 30 minutes; discard the cold acetone, wash twice with PBS, and aspirate dry; use mouse anti-6×His monoclonal antibody (1:1000 dilution) and swine fever positive serum (1:1000 dilution) as primary antibodies and incubate at 37°C for 1 hour; discard the primary antibody, wash twice with PBS, and aspirate dry; add 50 μL of FITC-labeled goat anti-mouse IgG diluted 1:2000 to each well and incubate at 37°C in the dark for 1 hour. The secondary antibody was discarded, and the fluorescence was observed under an inverted fluorescence microscope and photographed for preservation.

[0040] (4) Expression of recombinant CSFV-E2HZ protein: Sf9 cells cultured in T75 cell culture flasks were transferred into 100 mL Sf-900 TM III SFM medium in a cell shake flask, and culture in suspension in a 27.5°C incubator. Monitor the cell density every 24 hours, and wait until the cell density reaches 2.0×10 6 When the number of recombinant baculoviruses was 1 / mL, the P3 recombinant baculovirus was inoculated into the suspension cultured Sf9 cells at an infection ratio (MOI) of 1 according to the recombinant baculovirus titer, and the cells were shaken and cultured at 27.5°C and 140 rpm for 96 h. The cells were harvested and centrifuged at 4000 rpm for 5 min to obtain the supernatant and cell pellet. The target protein was in the supernatant.

[0041] (5) Purification of recombinant CSFV-E2HZ protein: 1.5 mL of nickel column gel particles were added to the empty column of the purification column, and the nickel column was equilibrated with 3 column volumes of 50 mM PBS to remove ethanol; the equilibrated nickel column gel particles were added to the supernatant containing the target protein, and the mixture was combined on a test tube flip mixer at 4°C overnight; the protein sample after nickel column binding was added to the empty column of the purification column, the flow control valve was opened to allow the liquid to flow out, and the flow-through was collected; the impurities were washed with 30 mL of 50 mM PBS containing 10 mM imidazole and 20 mM imidazole, respectively, and the washing solution was collected; the target protein was eluted with 5 mL of 50 mM PBS containing 500 mM imidazole, and the eluate was collected.

[0042] (6) SDS-PAGE analysis: Prepare SDS-PAGE gel by adding 10 μL of 5× Loading Buffer to 40 μL of flow-through, 10 mM imidazole wash buffer, 20 mM imidazole wash buffer, and 500 mM imidazole elution buffer, mixing well by pipetting, and heating in a boiling water pot for 10 min. Assemble the electrophoresis tank, fill it with electrophoresis buffer, load the sample, and perform electrophoresis at 80 V for 30 min followed by 120 V for 90 min. After the electrophoresis, place the gel in Coomassie brilliant blue dye solution and shake on a shaker at 37°C for 2 h for staining. Then place the gel in decolorizing solution for decolorization. Change the decolorizing solution every 1 h. When the bands are clearly visible, place the gel on a gel imager to take a photo and observe the results.

[0043] Experimental results:

[0044] The genotype 2 CSFV E2HZ gene fragment (993 bp) was obtained by PCR amplification and inserted into the pFastBac containing the secretion signal peptide (SP) by homologous recombination. TM The recombinant plasmid pFastBac was constructed on the HTB vector. TM HTB-SP-E2HZ. The shuttle plasmid was introduced into DH10Bac competent cells, and after blue-white screening and PCR sequencing, recombinant E. coli DH10Bac-CSFV E2HZ was obtained. The bacmid was extracted and transfected into SF9 cells, and baculovirus of P1, P2, and P3 generations was successfully obtained. Figure 1 -A, CSFV E2HZ was successfully expressed in SF9 cells through IFA identification. CSFV E2HZ protein was further expressed and purified in a large amount in a shake flask to obtain a CSFV E2HZ protein with good purity, with a size of about 50 kDa and a protein concentration of 0.34 mg / mL. The SDS-PAGE Coomassie Brilliant Blue staining results of CSFV E2HZ protein are shown in Figure 1 -B. The obtained genotype 2 CSFV E2HZ protein can be used for subsequent monoclonal antibody preparation.

[0045] Example 2: Screening of monoclonal antibodies that identify CSFV genotype 2

[0046] Experimental methods:

[0047] (1) Animal immunization: The purified type 2 CSFV E2HZ protein was mixed with an equal amount of 206VG adjuvant and emulsified, and subcutaneously immunized at multiple points on the back of the neck of mice at a dose of 50-100 μg / mouse. The second and third protein immunizations were performed in the same manner 14 and 28 days after the first immunization. Blood was collected from the orbital vein of the mice 35 days after immunization, and the separated serum was diluted at 1:500 as the primary antibody. FITC-labeled goat anti-mouse IgG diluted at 1:2000 was used as the fluorescent secondary antibody. The specific antibodies against type 2 CSFV E2HZ protein in the mouse serum were detected by IFA. 42 days after immunization, one mouse was selected and intraperitoneally injected with 50 μg type 2 CSFV E2HZ protein for shock immunization. Three days later, the mouse spleen cells were prepared for fusion.

[0048] (2) Cell fusion: After the above-mentioned immunization treatment, the mice were killed by removing their eyeballs and drawing blood, and the positive serum and spleen of the mice were separated. The spleen was placed in a well of a six-well plate, and the tissues, fascia and fat outside the spleen were washed and removed. The washed spleen was placed on a copper mesh. The spleen was crushed with a sterilized test tube until it was crushed and filtered through the copper mesh. The filtered cells were transferred to a centrifuge tube and centrifuged at 1200 rpm and 28°C for 10 minutes. Four 75 cm 2Resuspend the SP2 / 0 cells in the square bottle with 1640 medium, transfer to a centrifuge bottle, and centrifuge at 1200rpm, 28℃ for 10min. Resuspend the cells obtained in the above two steps with medium and combine them into one bottle, centrifuge at 1200rpm, 28℃ for 10min. Resuspend and centrifuge with new medium again, wash once, and discard the supernatant. Tap the centrifuge tube on a paper towel to mix the two cells until they are in a thin slurry. Suspend the centrifuge tube in a 37°C sterile water bath, draw 1mL of 50% PEG1450 preheated at 37°C and drip it near the bottom of the tube within 1 minute, shake while adding to fully mix the cells, let stand for 30 seconds, and terminate the fusion by gradient dilution: that is, add different volumes of RPMI 1640 (1mL, 2mL, 3mL, 4mL, 5mL and 6mL) preheated at 37°C in advance step by step, add each volume within 1 minute, shake while adding, and let stand for 30 seconds between each addition; centrifuge at room temperature at 1200rpm for 5 minutes, discard the supernatant, resuspend the cell pellet with 150mL HAT screening medium (containing RPMI1640, 20% fetal bovine serum, 1% Antibiotic-Antimycotic and 1% HAT), and evenly spread it into 10 96-well cell culture plates. After 3-4 days, the medium was replaced by half with HT screening medium (containing RPMI1640, 20% fetal bovine serum, 1% Antibiotic-Antimycotic and 1% HT) and the culture was continued.

[0049] (3) Screening of monoclonal hybridoma cell lines for differential diagnosis of swine fever: When the hybridoma cells after successful fusion divide and aggregate to about 1 / 3 of the bottom area of ​​the well (8-10 days), take the hybridoma supernatant for IFA screening. When the density of PK-15 cells in the 96-well plate reaches 50-60%, inoculate 100 TCID 50 / well of CSFV HZ08 strain and vaccine C strain, cultured at 37℃ for 48h. Discard the culture medium supernatant, wash the cells once with PBS, and dry; add 100μL of 80% acetone pre-cooled at -20℃ to each well, fix at -20℃ for more than 30min; discard the cold acetone, wash twice with PBS, and dry; use 50μL of hybridoma supernatant as the primary antibody of CSFV HZ08 strain and C strain cell plate, incubate at 37℃ for 1h; discard the primary antibody, wash twice with PBS, and dry; add 50μL of FITC-labeled goat anti-mouse IgG diluted at 1:2000 to each well, and incubate at 37℃ in the dark for 1h. Discard the secondary antibody, observe the reactivity of the antibodies secreted by the hybridoma cells in each well with the CSFV HZ08 strain and C strain under an inverted fluorescence microscope, and screen the hybridoma cells with identification ability (specifically recognize HZ08 strain, not recognize C strain) for cell amplification and monocloning.

[0050] (4) Western blot detection of the reactivity of 7A12 monoclonal antibody with E2 of different CSFV strains: CSFV E2HZ and E2C protein samples were loaded for SDS-PAGE. PVDF membranes with a size similar to that of the protein to be tested were cut out by electrophoresis, and the PVDF membranes were soaked in methanol for 30 seconds and then transferred to wet transfer buffer for several minutes. Filter paper and sponge were also placed in wet transfer buffer for soaking. The layers were placed in the order of (-) thick sponge-thin filter paper-gel-PVDF membrane-thin filter paper-thick sponge (+) and bubbles were removed. The membranes were transferred at a constant current of 200 mA for 40 minutes. Blocking: The transferred PVDF membranes were placed in TBST containing 5% skimmed milk powder and blocked at 37°C for 1 hour. Washing: The skimmed milk was discarded and the PVDF membranes were washed 3 times with TBST for 5 minutes each time. Incubate with primary antibody: 7A12 monoclonal antibody (1:1000 dilution), swine fever positive serum (1:1000 dilution, positive control), incubate overnight at 4℃ shaker. Wash: discard the primary antibody, wash the PVDF membrane 3 times with TBST, 5 min each time. Incubate with secondary antibody: add HRP-labeled goat anti-mouse IgG secondary antibody (1:5000 dilution), incubate at 37℃ shaker for 1h. Wash: discard the secondary antibody, wash the PVDF membrane 3 times with TBST, 5 min each time. Color development: add FDbio-Pico ECL for color development and take pictures.

[0051] (5) IFA detection of the reactivity of 7A12 monoclonal antibody with E2 of different CSFV strains: PK-15 cells were inoculated into 96-well cell culture plates one day in advance, and CSFV HZ08 strain infection wells, CSFV C strain infection wells, and normal cell wells were set up respectively. The infection dose of HZ08 and C strains was 100 TCID 50 / well. After 48 hours, discard the cell culture supernatant, wash twice with PBS, add 100 μL of -20℃ precooled 80% acetone to each well, fix at -20℃ for more than 30 minutes; wash twice with PBS, add the monoclonal antibody 7A12 to be tested (1:1000 dilution), set up positive control (1:1000 dilution of swine fever positive serum) and negative control (1640 culture medium), incubate at 37℃ for 1 hour; wash twice with PBS, use FITC-labeled goat anti-mouse IgG as the secondary antibody (1:2000 dilution), incubate at 37℃ for 1 hour; discard the secondary antibody, observe the fluorescence under an inverted fluorescence microscope and take pictures for preservation.

[0052] (6) Determination of subtypes of monoclonal antibodies: The monoclonal antibody 7A12 obtained above was identified according to the instructions of the Proteintech antibody subtype identification kit. The principle of antibody subtype identification is to use enzyme-linked immunosorbent assay (ELISA) to measure the binding of the test antibody with different subtype-specific antibodies (provided in the identification kit), identify the antibody that specifically binds to the test antibody, and the subtype of the test antibody can be obtained based on the specificity of the binding antibody. Identification method: According to the instructions of the kit, the subtype of the monoclonal antibody to be tested is determined by detecting the absorbance using an ELISA instrument.

[0053] Experimental results:

[0054] After mice were immunized with recombinant type 2 CSFV E2HZ protein multiple times, specific antibodies against type 2 CSFV E2HZ protein were produced in all three mice (see attached data). Figure 2 ). After the mouse spleen cells with high serum titer were fused with myeloma cells, a high-affinity CSFV E2-specific monoclonal antibody was successfully obtained through multiple rounds of IFA differential diagnosis screening, named 7A12. Western blot results showed that the monoclonal antibody can specifically recognize genotype 2 CSFV E2 protein and does not react with type 1 C strain E2 protein (see the results in the attached Figure 3 -A). IFA results further showed that the monoclonal antibody can specifically recognize genotype 2 CSFV strains and does not react with genotype 1 C strains (see attached Figure 3 -B), indicating that it can be used for differential diagnosis of CSFV epidemic strains. After subtype identification of 7A12 monoclonal antibody, it was found that monoclonal antibody 7A12 was IgG1 subtype with κ light chain. The results are shown in the attached Figure 4 .

[0055] Example 3: Identification and analysis of antigenic epitopes recognized by the genotype 2 CSFV E2HZ 7A12 monoclonal antibody

[0056] Identification of the antigenic epitope recognized by the CSFV E2HZ 7A12 monoclonal antibody and its conservation analysis: To clarify the antigenic epitope recognized by the monoclonal antibody 7A12, truncated and single-point mutant type 2 CSFV E2HZ protein gene fragments were amplified by PCR and connected to the pET30a vector and transformed into DH5α competent cells. The positive monoclonal colonies with correct sequencing were expanded and cultured, and the plasmids were extracted and transformed into Rosseta competent cells. The positive monoclonal colonies were screened by PCR identification, expanded and cultured to OD600=0.6, and 1mMIPTG was added to induce the expression of truncated E2 protein at 16℃. The truncated E2 protein was further reactively identified with the monoclonal antibody 7A12 by Western blot, and the antigenic epitope recognized by the monoclonal antibody 7A12 was determined, and its conservation on the E2 protein of different CSFV strains was further analyzed.

[0057] Experimental results:

[0058] The results are attached Figure 5 -A, monoclonal antibody 7A12 reacts with recombinant truncated proteins aa1-332 and aa1-72, but not with aa1-56 and aa199-332, indicating that the epitope recognized by monoclonal antibody 7A12 is located in the aa1-72 interval of type 2 CSFV E2 protein. According to the sequence alignment results of E2 proteins of different CSFV strains (Appendix Figure 5 -B), further single-point mutations in the E2HZ protein of type 2 CSFV determined that the key amino acid sites for mAb 7A12 to distinguish between genotype 2 CSFV and genotype 1 C strains were proline 20, glutamic acid 24, and aspartic acid 40, among which the identification amino acid site E24 was conserved in the type 2 epidemic strain E2, while the identification amino acid sites P20 and D40 were only conserved in the type 2.1 epidemic strain E2.

[0059] Example 4: Establishment of CSFV identification blocking ELISA

[0060] (1) Determination of the optimal antigen coating concentration and detection monoclonal antibody dilution ratio: Purified CSFV E2HZ was used as the coating antigen, and the titer of monoclonal antibody 7A12 was determined by indirect ELISA. The reaction conditions were optimized by the Fang Zheng titration method: the coating concentrations of CSFV E2HZ protein were 1μg / mL, 2μg / mL and 4μg / mL, and the dilution ratios of monoclonal antibody 7A12 were 1:1000, 1:2000, 1:4000, 1:8000 and 1:16000. After adding the detection monoclonal antibody, react at 37℃ for 1h, wash 3 times with PBST, and pat dry; add 1:10000 diluted HRP-labeled goat anti-mouse IgG secondary antibody, react at 37℃ for 1h, wash 3 times with PBST, and pat dry; use TMB to develop color for 10min, 2M sulfuric acid to stop the color development, and OD 450nm reading.

[0061] (2) Determination of the optimal serum dilution ratio: Based on the determined CSFV E2HZ antigen coating concentration and the detection monoclonal antibody 7A12 dilution ratio, the effect of serum dilution multiple on the blocking rate was tested. The serum collected 28 days after the genotype 2 CSFV strain QZ14 infection (serum to be tested) and a CSFV standard negative serum were diluted at 1:5, 1:10, 1:20 and 1:40, 50 μL / well, incubated at 37°C for 1 hour, washed 3 times with PBST, and patted dry; 50 μL of 1:8000 diluted monoclonal antibody 7A12 was added to each well, incubated at 37°C for 1 hour, washed 3 times with PBST, and patted dry; 50 μL of 1:10000 diluted HRP-labeled goat anti-mouse IgG secondary antibody was added to each well, incubated at 37°C for 1 hour, washed 3 times with PBST, and patted dry; 100 μL of TMB was added to each well for color development for 10 minutes, 2M sulfuric acid was used to stop the color development, and the OD was measured.450nm The blocking rate was calculated according to the following formula: blocking rate (%) = (1-OD of serum to be tested) 450nm ) / negative serum OD450nm .

[0062] Table 1 Blocking rate of different dilutions of genotype 2 CSFV strain QZ14 challenge serum against monoclonal antibody 7A12

[0063]

[0064] (3) Preliminary establishment of ELISA system for identification and blocking of genotype 2 classical swine fever: Based on the determined CSFV E2HZ antigen coating concentration, detection monoclonal antibody dilution ratio and serum dilution ratio, an ELISA system for identification and blocking of genotype 2 classical swine fever was established. The serum collected 28 days after the genotype 2 CSFV strain QZ14 attack (serum to be tested), the serum collected 28 days after the vaccine C strain immunization (serum to be tested) and a CSFV standard negative serum were diluted 1:5, 50 μL / well, incubated at 37°C for 1h, washed 3 times with PBST, and patted dry; 50 μL of 1:8000 diluted monoclonal antibody 7A12 was added to each well, incubated at 37°C for 1h, washed 3 times with PBST, and patted dry; 50 μL of 1:10000 diluted HRP-labeled goat anti-mouse IgG secondary antibody was added to each well, incubated at 37°C for 1h, washed 3 times with PBST, and patted dry; 100 μL TMB was added to each well for color development for 10min, 2M sulfuric acid was used to stop the color development, and the OD was measured. 450nm Read the value.

[0065] (4) Specific detection of the blocking ELISA system for identification of genotype 2 classical swine fever: 12 pig sera (4 sera from pigs infected with type 2 CSFV epidemic strains 21 days ago, 3 sera from pigs immunized with vaccine C strain 28 days ago, 2 sera from pigs infected with BVDV type 1, 2 sera from pigs infected with BVDV type 2, and 1 serum from a CSFV-negative pig) were collected and tested using the blocking ELISA system established above.

[0066] Experimental results:

[0067] Based on the monoclonal antibody 7A12 for differential diagnosis of genotype 2 CSFV, a blocking ELISA detection method for identifying genotype 2 CSFV was initially established. In this blocking ELISA system, monoclonal antibody 7A12 can distinguish between infection with genotype 2 epidemic strains and vaccine C strains (see Appendix Figure 6 ), and further determined that the CSFV E2HZ protein coating concentration was 1 μg / mL and the 7A12 dilution ratio was 1:8000 (see Appendix Figure 7 ), serum dilution ratio 1:5 (see Table 1). Several serum samples were taken for specificity testing of the blocking ELISA system. The results are shown in the attached Figure 8As shown, the antibody blocking rates of 4 CSFV epidemic strain sera were greater than 47%, the antibody blocking rates of 3 vaccine C strain positive sera and 4 BVDV positive sera were less than 13%, indicating that the blocking ELISA system has good specificity, can be used for the screening of large-scale clinical serum samples, and has the potential to be developed into a differential diagnosis kit.

[0068] Example 5: Sequence analysis of the gene encoding the CSFV E2HZ 7A12 monoclonal antibody

[0069] Experimental methods:

[0070] The total RNA of CSFV E2HZ 7A12 monoclonal hybridoma cells was extracted using a kit and reverse transcribed into cDNA. Two pairs of degenerate primers were designed according to the variable regions of the heavy and light chains of the antibody, and PCR amplification was performed respectively. The target fragments were recovered and cloned into T vectors and sent to the company for sequencing.

[0071] Experimental results:

[0072] The V of 7A12 monoclonal antibody was obtained by IMGT analysis H CDR1, V H CDR2 and V H CDR3 and V L CDR1, V L CDR2 and V L CDR3, wherein the V H CDR1, V H CDR2 and V H The amino acid sequences of CDR3 are shown in SEQ ID NOs: 1 to 3, respectively. L CDR1, V L CDR2 and V L The amino acid sequences of CDR3 are shown in SEQ ID NOs: 4 to 6. The amino acid sequence of the light chain variable region is shown in SEQ ID NO.7, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.8; the gene sequence encoding the light chain variable region is shown in SEQ ID NO.9; and the gene sequence encoding the heavy chain variable region is shown in SEQ ID NO.10.

[0073] Example 6: Specific application example of CSFV E2HZ 7A12 monoclonal antibody

[0074] Prepare a blocking ELISA kit for identifying genotype 2 classical swine fever virus according to the following recipe:

[0075] Its components are as follows:

[0076] (a) Genotype 2 CSFV E2 eukaryotic expression protein CSFV-E2HZ and its pre-coated ELISA plate (100 ng / well);

[0077] (b) sample diluent;

[0078] (c) negative control;

[0079] (d) mAb 7A12;

[0080] (e) HRP-labeled goat anti-mouse IgG;

[0081] (f) Washing solution: 0.5% PBST (10 mM PBS + 0.5% Tween 20);

[0082] (g) Color development solution: TMB substrate (Solution A, Solution B);

[0083] (h) Stop solution: 2M H2SO4

[0084] How to use this blocking ELISA kit:

[0085] (1) All kit components must be returned to room temperature (18-25°C) before use. Reagents should be mixed by gently vortexing.

[0086] (2) Serum was diluted with sample diluent at a ratio of 1:5, 50 μL was added to each well, duplicate wells and negative controls were set up, incubated at 37°C for 1 h or 4°C overnight, washed 3 times with 0.5% PBST, 5 min each time, and patted dry;

[0087] (3) Monoclonal antibody 7A12 was diluted 1:8000 with sample diluent, 50 μL was added to each well, incubated at 37°C for 1 h, washed 3 times with 0.5% PBST, 5 min each time, and patted dry;

[0088] (4) HRP-labeled goat anti-mouse IgG, diluted 1:10000 with sample diluent, added 50 μL to each well, incubated at 37°C for 1 h, washed 3 times with 0.5% PBST, 5 min each time, and patted dry;

[0089] (5) Add 100 μL of freshly prepared TMB colorimetric solution (mix equal volumes of Solution A and Solution B) and place in a dark place at room temperature for 10 min. Start timing after adding the solution to the first well.

[0090] (6) At 10 minutes, add 50 μL of stop solution (2M H2SO4) to each reaction well to stop the reaction. The order of adding the stop solution should be the same as that of adding the color development solution.

[0091] (7) Measure the absorbance of the sample at 450 nm.

[0092] (8) Calculate the blocking rate of the sample according to the following formula:

[0093] Blocking rate (%) = (1-test serum OD 450nm ) / negative serum OD 450nm .

[0094] (9) Result determination:

[0095] If the blocking rate of the sample under test is greater than or equal to 36%, the sample can be judged as positive, that is, the serum contains antibodies to the genotype 2 CSFV strain;

[0096] If the blocking rate of the sample under test is less than or equal to 29%, the sample can be judged as negative, that is, the serum does not contain antibodies to the genotype 2 CSFV strain;

[0097] If the blocking rate of the sample under test is between 29% and 36%, it is judged as suspicious.

[0098]

[0099]

[0100]

Claims

1. A monoclonal antibody 7A12 for identifying genotype 2 classical swine fever, characterized in that: The monoclonal antibody comprises the Ig domain V of the antibody heavy chain H CDR1, V H CDR2 and V H CDR3, and the Ig domain V of the antibody light chain L CDR1, V L CDR2 and V L CDR3; wherein the V H CDR1, V H CDR2 and V H The amino acid sequences of CDR3 are shown in SEQ ID NOs: 1 to 3 respectively; L CDR1, V L CDR2 and V L The amino acid sequences of CDR3 are shown in SEQ ID NOs: 4 to 6, respectively.

2. The monoclonal antibody according to claim 1, characterized in that The monoclonal antibody is a full-length antibody, a Fab antibody or a F(ab')2 antibody.

3. The monoclonal antibody according to claim 1 or 2, characterized in that In the monoclonal antibody, the amino acid sequence of the light chain variable region is shown in SEQ ID NO.7, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.

8.

4. The gene encoding the monoclonal antibody according to claim 3, characterized in that: The gene sequence encoding the light chain variable region is shown in SEQ ID NO.9, and the gene sequence encoding the heavy chain variable region is shown in SEQ ID NO.

10.

5. The method for preparing a monoclonal antibody according to claim 1, characterized in that: The following steps are involved: (1) Based on the genotype 2 CSFV E2HZ protein gene sequence shown in SEQ ID NO: 11, a recombinant plasmid having the genotype 2 CSFV E2HZ protein gene sequence was constructed using specific primers shown in SEQ ID NO. 12 and SEQ ID NO. 13; (2) further expressing and purifying the recombinant CSFV-E2HZ protein using an insect cell expression system; (3) Animal immunization with recombinant CSFV-E2HZ protein; (4) Through hybridoma monoclonal antibody technology, positive hybridoma cells are screened and monoclonalized to identify monoclonal antibodies for identifying genotype 2 classical swine fever.

6. The method for using any one of the monoclonal antibodies according to claim 1 or 2, characterized in that: The monoclonal antibody is used to prepare a kit for identifying genotype 2 swine fever.

7. A kit for identifying genotype 2 classical swine fever, characterized in that: The kit comprises any one of the monoclonal antibodies described in claim 1 or 2.

8. The kit according to claim 7, characterized in that This kit is a blocking ELISA kit, and the detection method when using the kit is serological detection.

Images