Monoclonal antibody 5E9 for recognizing human R9AP protein and application thereof

Abstract

The invention belongs to the technical field of antibodies, and discloses a monoclonal antibody 5E9 for recognizing human R9AP protein and application of the monoclonal antibody 5E9. The monoclonal antibody or the antigen binding fragment thereof has high affinity to R9AP protein and can significantly inhibit infection of EBV to epithelial cells and B cells. The antibody can be used for detecting the existence or level of R9AP protein in a sample, detecting diseases caused by high expression of R9AP and preventing EB virus infection and / or treating and / or preventing diseases caused by EB virus infection.

Description

Technical Field

[0001] The present invention belongs to the field of antibody technology, and specifically relates to a monoclonal antibody 5E9 for recognizing human R9AP protein and its application Background Art

[0002] R9AP protein (Retinal G protein-coupled receptor interacting protein, R9AP) is a protein located in the cell membrane, which plays an important role in the photoreceptor cells of the retina. It is encoded by the R9AP gene and participates in the signal transduction process related to rhodopsin in cells.

[0003] The main function of R9AP protein is to regulate the function of rhodopsin in the retina. It helps maintain a stable connection between rhodopsin and G protein by interacting with the G protein-coupled receptor complex of rhodopsin, thereby promoting the transmission of visual signals. In particular, in the process of photoreception, rhodopsin is activated by light and stimulates a series of signal transduction reactions. R9AP protein is an indispensable part of this process. At the molecular level, R9AP interacts with rhodopsin and its related molecules (such as G protein) to ensure that visual signals can be quickly and effectively transmitted from external light stimulation to the nervous system, thereby producing visual perception. The absence or dysfunction of R9AP may lead to impaired visual function and even cause some hereditary eye diseases. However, the expression of R9AP is also associated with the occurrence of a variety of tumors, and it may play a potential role in the occurrence and development of some tumors. Specifically, the relationship between high expression of R9AP and the following tumor types has been preliminarily explored: 1. Breast cancer: Some studies have shown that R9AP may have a higher expression level in breast cancer cells, especially in some advanced or invasive breast cancers. Highly expressed R9AP may be associated with the proliferation, migration and invasiveness of tumor cells. 2. Ovarian cancer: R9AP was also found to be highly expressed in ovarian cancer cells, and its high expression may be related to the survival and drug resistance of ovarian cancer cells. This high expression may promote the growth of tumor cells by regulating signaling pathways related to cell survival and growth. 3. Colorectal cancer: In colorectal cancer, some studies have found that the expression level of R9AP is high and is associated with the malignancy and metastatic potential of the tumor. R9AP may affect the growth and migration of colorectal cancer cells by participating in the signal transduction of G protein-coupled receptors. 4. Lung cancer: R9AP is also highly expressed in some types of lung cancer, especially in non-small cell lung cancer. This high expression may be related to the drug resistance, proliferation and metastasis ability of the tumor. 5. Gastric cancer: In gastric cancer studies, the high expression of R9AP protein is believed to be related to the invasive behavior and poor prognosis of gastric cancer. 6. Liver cancer: In some liver cancer studies, high expression of R9AP was also observed, which may be related to the growth, division and drug resistance of liver cancer cells.

[0004] At the same time, recent studies have found that R9AP is an important universal receptor for EB virus-infected cells and is involved in both the infection process of B cells and epithelial cells. Therefore, antibodies against R9AP can inhibit EB virus from recognizing R9AP and further infecting cells.

[0005] There is currently no effective vaccine for EBV, and there is also a lack of specific treatment for diseases caused by EBV infection. Infectious mononucleosis is mostly treated with antiviral drugs such as acyclovir, which can relieve symptoms to a certain extent but cannot eliminate EBV in B lymphocytes and throat epithelium. Therefore, the development of antibodies against R9AP can serve as an important treatment method to block EBV infection. Summary of the invention

[0006] The first aspect of the present invention aims to provide a monoclonal antibody or an antigen-binding fragment thereof.

[0007] The second aspect of the present invention aims to provide a recombinant protein.

[0008] The third aspect of the present invention aims to provide biological materials related to the monoclonal antibody or antigen-binding fragment thereof of the first aspect of the present invention or the recombinant protein of the second aspect.

[0009] The fourth aspect of the present invention aims to provide a method for preparing the monoclonal antibody or antigen-binding fragment thereof of the first aspect of the present invention or the recombinant protein of the second aspect.

[0010] The fifth aspect of the present invention aims to provide a conjugate.

[0011] The purpose of the sixth aspect of the present invention is to provide the use of the monoclonal antibody or antigen-binding fragment thereof of the first aspect, the recombinant protein of the second aspect, the biomaterial of the third aspect, and / or the conjugate of the fifth aspect in the preparation of a product.

[0012] The seventh aspect of the present invention aims to provide a medicine.

[0013] The eighth aspect of the present invention aims to provide a vaccine.

[0014] In order to achieve the above object, the technical solution adopted by the present invention is:

[0015] The first aspect of the present invention provides a monoclonal antibody or an antigen-binding fragment thereof against Epstein-Barr virus R9AP, wherein the monoclonal antibody or the antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region;

[0016] The heavy chain variable region comprises CDR-H1, CDR-H2 and CDR-H3;

[0017] The CDR-H1, CDR-H2 and CDR-H3 are CDR1, CDR2 and CDR3 with amino acid sequences as shown in SEQ ID NO: 4;

[0018] The light chain variable region comprises CDR-L1, CDR-L2 and CDR-L3;

[0019] The CDR-L1, CDR-L2 and CDR-L3 are CDR1, CDR2 and CDR3 whose amino acid sequences are shown in SEQ ID NO:15.

[0020] Preferably, the amino acid sequences of CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 are shown in SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18 respectively, and the CDRs are defined according to the IMGT definition scheme.

[0021] Preferably, the amino acid sequences of CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 are shown in SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18 respectively, and the CDRs are defined according to the Kabat definition scheme.

[0022] Preferably, the amino acid sequences of CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 are shown in SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18 respectively, and the CDRs are defined according to the Chothia definition scheme.

[0023] Preferably, the amino acid sequences of CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 are shown in SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 19, SEQ ID NO: 20 and SEQ ID NO: 21 respectively, and the CDRs are defined according to the Contact definition scheme.

[0024] Preferably, the amino acid sequence of the heavy chain variable region comprises:

[0025] a1) SEQ ID NO: 4; or

[0026] a2) an amino acid sequence in which one or more amino acids are substituted and / or deleted and / or added to SEQ ID NO: 4 and which has the same function as the protein shown in SEQ ID NO: 4; or

[0027] a3) an amino acid sequence that has 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81% or 80% homology to SEQ ID NO: 4 and has the same function as the protein shown in SEQ ID NO: 4;

[0028] The amino acid sequence of the light chain variable region comprises:

[0029] b1) SEQ ID NO: 15; or

[0030] b2) an amino acid sequence in which one or more amino acids are substituted and / or deleted and / or added to SEQ ID NO: 15 and which has the same function as the protein shown in SEQ ID NO: 15; or

[0031] b3) an amino acid sequence that is 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81% or 80% homologous to SEQ ID NO: 15 and has the same function as the protein shown in SEQ ID NO: 17.

[0032] Preferably, the monoclonal antibody or antigen-binding fragment thereof comprises at least one of a full-length antibody, Fab, Fab', F(ab')2, Fv, scFv, a bispecific antibody, and a multispecific antibody.

[0033] Preferably, the heavy chain further comprises a heavy chain constant region; and / or

[0034] The light chain also comprises a light chain constant region.

[0035] Preferably, the heavy chain further comprises a heavy chain signal peptide; and / or

[0036] The light chain also comprises a light chain signal peptide.

[0037] Preferably, the amino acid sequence of the heavy chain signal peptide comprises:

[0038] e1) an amino acid sequence consisting of amino acids 1 to 19 in SEQ ID NO: 3; or

[0039] e2) an amino acid sequence in which one or more amino acids are substituted and / or deleted and / or added to the amino acid sequence described in e1) and which has the same function as the protein of the amino acid sequence described in e1); or

[0040] e3) An amino acid sequence that has 99%, 98%, 97%, 96%, 95%, 94% or 93% homology with the amino acid sequence described in e1) and has the same function as the protein of the amino acid sequence described in e1).

[0041] Preferably, the amino acid sequence of the light chain signal peptide comprises:

[0042] f1) an amino acid sequence consisting of amino acids 1 to 19 of SEQ ID NO: 14; or

[0043] f2) an amino acid sequence in which one or more amino acids are substituted and / or deleted and / or added to the amino acid sequence described in f1) and which has the same function as the protein of the amino acid sequence described in f1); or

[0044] f3) is an amino acid sequence that has 99%, 98%, 97%, 96%, 95%, 94% or 93% homology with the amino acid sequence described in f1) and has the same function as the protein of the amino acid sequence described in f1).

[0045] Preferably, the amino acid sequence of the human R9AP protein comprises:

[0046] g1) the amino acid sequence of SEQ ID NO: 1; or

[0047] g2) an amino acid sequence obtained by replacing and / or deleting and / or adding one or more amino acids to the amino acid sequence described in g1) and having the same function as the protein of the amino acid sequence described in g1); or

[0048] g3) An amino acid sequence that has 99%, 98%, 97%, 96%, 95%, 94% or 93% homology with the amino acid sequence described in g1) and has the same function as the protein of the amino acid sequence described in g1).

[0049] A second aspect of the present invention provides a recombinant protein comprising: the monoclonal antibody or antigen-binding fragment thereof according to the first aspect of the present invention; and

[0050] Optional tag sequence to facilitate expression and / or purification.

[0051] Preferably, the tag sequence is selected from at least one of the following groups: a His tag, a GGGS sequence, a FLAG tag; further a His tag; and further a 6×His tag.

[0052] The third aspect of the present invention provides a biological material related to the monoclonal antibody or antigen-binding fragment thereof of the first aspect of the present invention, or the recombinant protein of the second aspect of the present invention, wherein the biological material comprises at least one of h1) to h16):

[0053] h1) a nucleic acid molecule encoding the monoclonal antibody or antigen-binding fragment thereof of the first aspect of the invention, or the recombinant protein of the second aspect;

[0054] h2) an expression cassette comprising the nucleic acid molecule described in h1);

[0055] h3) a vector comprising the nucleic acid molecule described in h1);

[0056] h4) a vector comprising the expression cassette described in h2);

[0057] h5) a transgenic cell line comprising the nucleic acid molecule described in h1);

[0058] h6) a transgenic cell line comprising the expression cassette described in h2);

[0059] h7) a transgenic cell line comprising the vector described in h3);

[0060] h8) a transgenic cell line comprising the vector described in h4);

[0061] h9) a microorganism comprising the nucleic acid molecule described in h1);

[0062] h10) A microorganism comprising the expression cassette described in h2);

[0063] h11) a microorganism comprising the vector described in h3);

[0064] h12) a microorganism comprising the vector described in h4);

[0065] h13) A virus comprising the nucleic acid molecule described in h1);

[0066] h14) A virus comprising the expression cassette described in h2);

[0067] h15) A virus comprising the vector described in h3);

[0068] h16) A virus comprising the vector described in h4).

[0069] Preferably, the transgenic cell line comprises no reproductive material.

[0070] Preferably, the nucleic acid molecule encoding the monoclonal antibody or antigen-binding fragment thereof as described in the first aspect of the present invention comprises a nucleic acid molecule encoding the heavy chain of the monoclonal antibody or antigen-binding fragment thereof described in the first aspect of the present invention and a nucleic acid molecule encoding the light chain of the monoclonal antibody or antigen-binding fragment thereof described in the first aspect of the present invention.

[0071] The fourth aspect of the present invention provides a method for preparing the monoclonal antibody or antigen-binding fragment thereof of the first aspect of the present invention or the recombinant protein of the second aspect of the present invention, which is obtained by expression and purification using the biological material described in the third aspect of the present invention.

[0072] A fifth aspect of the present invention provides a conjugate comprising: at least one of the monoclonal antibody or antigen-binding fragment thereof according to the first aspect of the present invention and the recombinant protein according to the second aspect of the present invention;

[0073] and a coupling portion, wherein the coupling portion comprises at least one of a detectable label, a drug, a toxin, a cytokine, a radionuclide, and an enzyme.

[0074] Preferably, the detectable marker is selected from a radioactive isotope, a fluorescent substance, a chemiluminescent substance, a colored substance, or any combination thereof.

[0075] Preferably, the conjugate is selected from: fluorescent substances, chemiluminescent markers, colored substances, radioactive isotopes, MRI (magnetic resonance imaging) or CT (computer tomography) contrast agents, or enzymes capable of producing detectable products, radionuclides, biotoxins, cytokines (such as IL-2, etc.), antibodies, antibody Fc fragments, antibody scFv fragments, gold nanoparticles / nanorods, viral particles, liposomes, nanomagnetic particles, prodrug-activated enzymes, chemotherapeutic agents (e.g., cisplatin) or any form of nanoparticles, etc.

[0076] The sixth aspect of the present invention provides the use of the monoclonal antibody or antigen-binding fragment thereof of the first aspect of the invention, the recombinant protein of the second aspect, the biomaterial of the third aspect, and / or the conjugate of the fifth aspect in the preparation of a product;

[0077] The product comprises at least one of a drug, a reagent, a test plate, a test kit, and a test chip.

[0078] Preferably, the drug has at least one of the functions i1) to i2):

[0079] i1) Prevent EB virus infection;

[0080] i2) Treating and / or preventing diseases caused by EB virus infection.

[0081] Preferably, the reagent, detection plate, detection chip or kit has at least one of the functions j1) to j2):

[0082] j1) detecting the presence or level of R9AP protein in a sample;

[0083] j2) Detect diseases related to high expression of R9AP.

[0084] Preferably, the disease includes at least one of breast cancer, ovarian cancer, colorectal cancer, lung cancer, gastric cancer and liver cancer.

[0085] A seventh aspect of the present invention provides a product, wherein the product comprises at least one of k1) to k3):

[0086] k1) the monoclonal antibody or antigen-binding fragment thereof according to the first aspect of the present invention;

[0087] k2) the recombinant protein according to the second aspect of the present invention;

[0088] k3) The conjugate according to the fifth aspect of the present invention;

[0089] The product comprises at least one of a reagent, a detection plate, a test kit, and a detection chip.

[0090] Preferably, the reagent, detection plate, detection chip or kit has at least one of the functions j1) to j2):

[0091] j1) detecting the presence or level of R9AP protein in a sample;

[0092] j2) Detect diseases related to high expression of R9AP.

[0093] Preferably, the disease includes at least one of breast cancer, ovarian cancer, colorectal cancer, lung cancer, gastric cancer and liver cancer.

[0094] The eighth aspect of the present invention provides a drug, which comprises at least one of 11) to 14):

[0095] l1) the monoclonal antibody or antigen-binding fragment thereof according to the first aspect of the present invention;

[0096] 12) The recombinant protein according to the second aspect of the present invention;

[0097] l3) benzene The biomaterial of the third aspect of the invention;

[0098] 14) The conjugate according to the fifth aspect of the present invention.

[0099] Preferably, the medicament further comprises a pharmaceutically acceptable carrier.

[0100] Preferably, the drug has at least one of the functions i1) to i2):

[0101] i1) Prevent EB virus infection;

[0102] i2) Treating and / or preventing diseases caused by EB virus infection.

[0103] Preferably, the disease comprises at least one of nasopharyngeal carcinoma, gastric cancer, Hodgkin's lymphoma, Burkitt's lymphoma, NK / T cell lymphoma, lymphoproliferative disease, and infectious mononucleosis.

[0104] Preferably, the medicament comprises a vaccine.

[0105] Preferably, a vaccine comprises at least one of 11) to 14) and an adjuvant:

[0106] l1) the monoclonal antibody or antigen-binding fragment thereof according to the first aspect of the present invention;

[0107] 12) The recombinant protein according to the second aspect of the present invention;

[0108] l3) benzene The biomaterial of the third aspect of the invention;

[0109] 14) The conjugate according to the fifth aspect of the present invention.

[0110] The beneficial effects of the present invention are:

[0111] The present invention provides a monoclonal antibody or antigen-binding fragment thereof against human R9AP protein, which has high affinity to human R9AP protein and can detect its expression level at multiple levels. At the same time, it can significantly inhibit the infection of EBV to epithelial cells and B cells, and can therefore be used to detect the presence or level of R9AP protein in a sample, detect diseases caused by high expression of R9AP, and prevent EB virus infection and / or treat and / or prevent diseases caused by EB virus infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0112] Figure 1 This is the ELISA binding test result of monoclonal antibody 5E9 and R9AP protein.

[0113] Figure 2 This is a diagram showing the BLI binding test results of monoclonal antibody 5E9 and R9AP protein.

[0114] Figure 3 This is the WB specific binding test result of monoclonal antibody 5E9 and R9AP protein.

[0115] Figure 4This is a graph showing the neutralization results of monoclonal antibody 5E9 on Epstein-Barr virus in epithelial cells.

[0116] Figure 5 This is a graph showing the neutralization results of monoclonal antibody 5E9 in Epstein-Barr virus B cells. DETAILED DESCRIPTION

[0117] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0118] The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or under conditions recommended by the manufacturers. The materials and reagents used in the examples are commercially available unless otherwise specified.

[0119] Example 1 Preparation of human R9AP protein, animal immunization and antibody screening

[0120] 1.1 Expression and purification of R9AP protein

[0121] 1.1.1 Experimental Materials

[0122] (1) Expression vector: Eukaryotic expression vector: pGEX-6P-1(+) (Addgene).

[0123] (2) Expression system: prokaryotic expression system cell DE3.

[0124] (3) Reagents and consumables: TB culture medium (Haibo Biotechnology), GST-tagged protein purification agarose beads (Cytiva), and other conventional reagents and consumables were purchased from commercial sources.

[0125] (4) Gene: The human R9AP gene was optimized and synthesized by Nanjing GenScript Biotech Co., Ltd. and inserted into the pGEX-6P-1 vector, hereinafter referred to as GST-R9AP.

[0126] The total length of the R9AP extracellular segment recombinant protein is 210 amino acid residues, specifically:

[0127] MAREECKALLDGLNKTTACYHHLVLTVGGSADSQNLRQELQKTRQKAQELAVSTCARLTAVLRDRGLAADERAEFERLWVAFSGCLDLLEADMRRALELGAAFPLHAPRRPLVRTGVAGASSGVAARALSTRSLRLEAEGDFDVADLRELEREVLQVGEMIDNMEMKVNVPRWTVQARQAAGAELLSTVSAGPSSVVSLQERGGGCDPRK(SEQ ID NO:1).

[0128] Its DNA expression sequence is 630 base pairs in total, specifically:

[0129] ATGGCGAGGGAGGAGTGCAAGGCGCTGCTGGACGGGCTCAACAAGACGACTGCGTGCTACCACCACCTGGTGCTGACCGTCGGTGGCTCGGCGGACTCGCAGAACCTGCGGCAGGAGCTGCAAAAGACGCGCCAGAAGGCGCAGGAGCTGGCGGTGTCCACCTGCGCCCGGCTGACTGCTGTGCTGCGCGACCGGGGCCTGGCCGCCGACGAGCGCGCCGAGTTCGAGCGGCTCTGGGTGGCCTTCTCGGGCTGCCTGGACCTGTTGGAAGCGGACATGCGACGCGCGCTGGAGCTGGGCGCCGCGTTCCCGCTGCACGCGCCGCGGCGGCCGCTGGTGCGCACAGGTGTGGCTGGCGCCTCCTCCGGCGTGGCGGCGCGCGCGCTGAGCACCCGCAGCCTGCGGCTCGAGGCGGAGGGCGACTTCGACGTCGCGGACCTGCGGGAGCTGGAGCGCGAGGTCCTTCAGGTGGGCGAGATGATCGACAACATGGAGATGAAGGTCAACGTGCCCCGCTGGACCGTGCAAGCCCGGCAGGCGGCGGGCGCCGAGCTCCTGTCCACGGTCAGCGCCGGCCCCTCCTCGGTCGTGTCCTTGCAGGAGCGCGGGGGGGGTTGCGACCCCAGGAAG(SEQ ID NO:2).

[0130] 1.1.2 Protein expression

[0131] Step 1: Transformation and selection of clones

[0132] (1) Add the synthesized plasmid to the frozen-thawed DH5a bacteria and let it stand on ice for 5 minutes.

[0133] (2) Place the bacteria with the plasmid in a shaking metal bath and heat shock at 42°C and 120 rpm for 60-90 seconds.

[0134] (3) Let the bacteria cool on ice for 5 minutes.

[0135] (4) Use a spreading stick to spread the bacteria onto a TB medium plate containing ampicillin resistance and culture overnight.

[0136] (5) The next day, use a sterile pipette to pick a single colony from the surface and transfer it to 500 mL of culture medium. Add 0.1 mg / mL ampicillin and culture at 37°C and 220 rpm for 12-16 hours.

[0137] (6) After the bacterial culture has been incubated for about 8 hours, use Nanodrop to measure its OD value until its OD value reaches about 1.8-2.0.

[0138] (7) Adjust the incubator to 18°C ​​and 220 rpm to cool the bacterial solution.

[0139] (8) Add 1 mM IPTG solution to the bacterial solution and continue culturing for 8-12 hours.

[0140] Step 3: Prokaryotic culture protein purification

[0141] (1) Centrifuge the cultured bacterial solution at 4000 rpm and 4°C for 10 minutes to collect the bacterial precipitate and discard the supernatant.

[0142] (2) Resuspend the pellet using resuspension buffer (250 mM NaCl, 50 mM HEPES pH 8.0, 2% Glycerol, 30 mM Imidazole, 1 mM DTT) at a rate of 50 mL of resuspension buffer per 1 L of bacterial solution.

[0143] (3) Use a pressure crusher to crush and resuspend the precipitate three times at 4°C and 800 Pa pressure.

[0144] (4) The precipitate was centrifuged at 15,000 g and 4°C for 30 minutes to separate the supernatant.

[0145] (5) Filter the supernatant twice using a 0.22 μm filter membrane.

[0146] (6) Use the siphon method to transfer the supernatant to the GST beads purification column, so that the supernatant passes through the purification column completely. If repeated recovery is required, the supernatant can be recovered in this step and re-purified.

[0147] (7) Equilibrate the purification column with three column volumes of resuspension buffer.

[0148] (8) Use elution buffer (250 mM NaCl, 50 mM HEPES pH 8.0, 2% Glycerol, 20 mM GSH, 1 mM DTT) to elute the purification column for two column volumes to obtain the eluate.

[0149] (9) Samples of bacterial disruption solution, centrifugation supernatant, centrifugation precipitate, flow-through solution, equilibrium solution, and eluate were collected for SDS-PAGE to verify protein expression and purification.

[0150] (10) The eluate was concentrated using an ultrafiltration tube of corresponding size to a volume less than 1 mL. The concentrated eluate was centrifuged at 12,000 g and 4° C. for 5 min to remove the precipitate.

[0151] (11) The concentrated eluate was purified by molecular sieve purification using an Akta purifier equipped with a Superdex200 Increase 10 / 300GL molecular sieve column, and the protein sample at the molecular sieve peak was collected and compared with the previous sample for SDS-PAGE verification.

[0152] 2.2.5 Protein preservation

[0153] (1) After the purity is confirmed by SDS-PAGE, the concentration of the concentrated protein is detected using a BCA kit. The brief method is as follows.

[0154] (2) Prepare BSA standard and dilute the sample in 7 steps of 10-fold dilution starting from 1 mg / mL.

[0155] (3) In a 96-well plate, add 0, 1, 2, 4, 8, 12, 16, and 20 μl of the standard into the standard wells of the 96-well plate and add standard diluent to make up to 20 μl, which is equivalent to a standard concentration of 0, 0.025, 0.05, 0.1, 0.2, 0.3, 0.4, and 0.5 mg / ml, respectively.

[0156] (4) Add an appropriate volume of sample to the sample wells of the 96-well plate. If the sample volume is less than 20 μl, add standard diluent to make it up to 20 μl. Please remember to record the sample volume.

[0157] (5) Add 200 μl of BCA working solution to each well and incubate at 37°C for 20-30 minutes.

[0158] (6) Measure the absorbance at a wavelength of 562 nm using an ELISA reader.

[0159] (7) Use the absorbance of the standard and its concentration to make a standard curve, and import the absorbance value of the sample well to calculate its concentration.

[0160] (8) After the concentration is determined, dilute the protein to 1 mg / mL and store it in a 1.5 mL EP tube. Quickly freeze the protein using liquid nitrogen and store it in a -80 °C refrigerator for long-term storage. If the protein needs to be prepared and used immediately, it can be directly used for the experiment without freezing.

[0161] 1.2 EBV R9AP rabbit immunization experiment

[0162] 1.2.1 Vaccine configuration

[0163] (1) The GST-R9AP protein was taken out and frozen and thawed. The dose was 50 μg / mouse. Sterile PBS was used as the solvent for the antigen.

[0164] (2) 500 μL of antigen solution was mixed with an equal volume of 500 μL of complete Freund's adjuvant to form a dose of 1 mL per rabbit, and the mixture was placed on a rocking table at 4°C for mixing overnight.

[0165] 1.2.2 Rabbit immunization and spleen collection

[0166] (1) The rabbits were fed with conventional feed and drinking water and were 12 weeks old at the time of immunization. They were of the New Zealand White rabbit strain.

[0167] (2) Fix the rabbit and use a 2 mL syringe to manually shake the vaccine, then draw it up and inject it into the rabbit via leg muscle injection.

[0168] (3) Observe the rabbit for 3-5 minutes and release it after it resumes normal activities.

[0169] (4) The vaccination process is 0 weeks-3 weeks-6 weeks-8 weeks, and the spleen collection time is 10 weeks.

[0170] (5) The rabbit spleen was collected by spinal dislocation according to animal welfare and standard animal experimental procedures, and the rabbit blood was collected and the spleen was obtained by dissection.

[0171] 1.3 Isolation and cloning of EBV R9AP rabbit B cells R9AP-specific cells

[0172] 1.3.1 Splenic lymphocyte isolation steps:

[0173] (1) 10 weeks after immunization, rabbits were sacrificed by cervical dislocation, and their peripheral lymph nodes and spleen were isolated and placed in EP tubes.

[0174] (2) Add appropriate amounts of DNase and type IV collagenase to 1640 medium to prepare tissue digestion solution. Add appropriate amounts of digestion solution according to the size of the lymph nodes and spleen.

[0175] (3) Using the pressure plug in a sterile syringe, place the tissue on a 70 μm cell sieve and crush it until the tissue is almost broken and minced. Then, rinse the cell sieve with an appropriate amount of fresh culture medium so that all remaining cells are rinsed into the 50 mL centrifuge tube below.

[0176] (4) Add red blood cell lysis buffer and incubate at room temperature for 10 minutes.

[0177] (5) Centrifuge at 2000 g and 18°C ​​for 5 min.

[0178] (6) Add fresh culture medium and wash twice.

[0179] 1.3.2 B lymphocyte antigen staining and sorting

[0180] (1) Wash the cells with PBS to 1*10 ^8 Transfer cells to flow cytometry tubes, centrifuge at 3000 g, 18°C ​​for 5 min, and discard the supernatant.

[0181] (2) Add 5 μL of Fc receptor blocking antibody solution to 100 μL of PBS, resuspend the cells and incubate on ice for 30 min.

[0182] (3) According to the cell grouping situation, PBS was used to prepare the flow cytometry antibody dilution solution. Different dilution gradients can be set for the first use of antibodies. The optimal gradient was selected according to the ratio of antibody to PBS of 1:20, 1:50, 1:100, 1:200, and 1:500. 100 μL of diluted flow cytometry antibody cells and cell death and viability dye were added to resuspend the cells for staining and incubated at 4°C in the dark for 30 minutes. Rabbit IgG and B220 antibodies were used as B cell separation reagents, and R9AP was used as R9AP-specific B cell separation reagent.

[0183] (4) Wash the cells with PBS and centrifuge at 3000 g and 4°C for 5 minutes. Repeat 1 to 2 times and discard the supernatant.

[0184] (5) Resuspend the cells in PBS into a flow cytometry tube and perform flow cytometry sorting on the cells using a BD Rhaspody single cell sorter.

[0185] (6) Add IgG + B220 + The 0.2% cells with the strongest R9AP positive signal were sorted into 96-well plates.

[0186] 1.3.3B cell sequence cloning and expansion

[0187] (1) Using universal cloning primers for rabbit IgG heavy and light chains, PCR was performed on B cells in 96-well plates to obtain the heavy and light chain sequences corresponding to single B cells.

[0188] The forward (F) and reverse (R) primer sequences of the heavy chain VH are:

[0189] F: ggtggttcctctagatcttcctcctctggtggcggtggctcgggcggtggtgggCAGTCGBTGGAGGAGT (SEQ ID NO: 22).

[0190] R: gctggccggcctggccactagt TGARGAGACGGTGACC (SEQ ID NO: 23).

[0191] The forward (F) and reverse (R) primer sequences of the light chain VL are:

[0192] F: ggtggttcctctagatcttcctcctctggtggcggtggctcgggcggtggtgggCAGTCGBTGGAGGAGT (SEQ ID NO: 24)

[0193] R: gctggccggcctggccactagt TGARGAGACGGTGACC (SEQ ID NO: 25).

[0194] (2) After connecting the variable region of the heavy chain of the antibody to the CMV fragment upstream and the constant region of rabbit IgG1 downstream, the fragment of the complete heavy chain can be expressed; and after connecting the variable region of the light chain of the antibody to the CMV fragment upstream and the constant region of the light chain κ / λ downstream, the fragment of the complete light chain can be expressed. The expression of the antibody can be achieved by co-transfecting the plasmids carrying the full-length sequences of the heavy and light chains of the above antibodies into 293F cells, and the antibody can be purified using protein Abeads. A total of 9 antibodies were expressed by this method.

[0195] (3) The obtained antibodies were subjected to R9AP affinity determination using ELISA, and the 5E9 antibody with the highest affinity was screened for further verification.

[0196] Example 2 Preparation of monoclonal antibody 5E9 (monoclonal antibody) against human R9AP protein

[0197] The complete heavy chain fragment can be expressed by connecting the upstream of the antibody heavy chain variable region with the CMV fragment and the downstream with the constant region of human IgG1; and the complete light chain fragment can be expressed by connecting the upstream of the antibody light chain variable region with the CMV fragment and the downstream with the constant region of the light chain κ / λ. The expression of the antibody can be achieved by co-transfecting the plasmids carrying the full-length sequences of the heavy and light chains of the above antibodies into 293F cells, and the antibody can be purified using protein Abeads.

[0198] The 5E9 heavy chain has a total of 128 amino acid residues, specifically:

[0199]

[0200] The underlined part of the sequence is the amino acid sequence of the heavy chain variable region (SEQ ID NO: 4). The italic parts are the three complementary regions CDR-H1 in the heavy chain variable region. CDR-H2 and CDR-H3 The amino acid sequence of the protein (IMGT definition scheme). The bold part is the signal peptide. * indicates the stop codon.

[0201] CDR-H1, CDR-H2, and CDR-H3 in the heavy chain variable region using other CDR definition schemes are shown in Table 11.

[0202] Table 11 CDR-H1, CDR-H2, CDR-H3 in the heavy chain variable region with other CDR definition schemes

[0203]

[0204]

[0205] The 5E9 variable region light chain has a total of 132 amino acid residues, specifically:

[0206]

[0207] The underlined part of the sequence is the amino acid sequence of the light chain variable region (SEQ ID NO: 15). The underlined and bold parts are the three complementary determining regions CDR-L1 in the light chain variable region. CDR-L2 and CDR-L3 The amino acid sequence of the protein (IMGT definition scheme). The bold part is the signal peptide. * indicates the stop codon.

[0208] CDR-H1, CDR-H2, and CDR-H3 in the light chain variable region using other CDR definition schemes are shown in Table 12.

[0209] Table 12 CDR-H1, CDR-H2, CDR-H3 in the light chain variable region with other CDR definition schemes

[0210]

[0211] Example 3 Affinity determination of 5E9

[0212] 3.1 Detection of 5E9 binding ability using enzyme-linked immunosorbent assay (ELISA)

[0213] ELISA can be performed according to conventional methods in the art. In the present embodiment, the specific operation is as follows: R9AP protein is prepared in a PBS solution at a concentration of 10 μg / mL, and 100 μL per well is added to the ELISA high adhesion plate, and the initial coating is performed at room temperature for 3 hours, and then the liquid is discarded. A 0.2 mg / mL BSA solution is prepared and added to the ELISA plate, and the wells are blocked at room temperature for 6 hours, and then the liquid is discarded. Then, the 5E9 antibody is diluted in a gradient from 1:10 and added to the ELISA plate, and the initial binding is performed at room temperature for 2 hours, and then the liquid is discarded. Then, a 1:5000 diluted goat anti-rabbit IgG-HRP secondary antibody is prepared and added to the ELISA plate, and the secondary binding is performed at room temperature for 30 minutes, and then the liquid is discarded. Finally, TMB color developer is added for color development at room temperature for 15 minutes, and dilute hydrochloric acid is used to terminate the color development. The A280 reading in each well is detected using an enzyme reader as a reflection of the R9AP antibody binding ability in each well. The higher the reading, the higher the binding strength. The results are as follows. Figure 1 As shown: the A280 reading of the 5E9 antibody still has a high level of binding at a dilution of 1:512000, while the control unrelated IgG antibody has no R9AP binding ability at all, reflecting its high binding ability.

[0214] 3.2 The affinity of antibody 5E9 was determined using biofilm interferometry (BLI).

[0215] BLI can be performed according to conventional methods in the art. In this embodiment, the specific operation is as follows: a biosensor (Sartorius, Germany) SA probe) is immersed in a buffer solution (a mixture of KB buffer, 0.1wt% BSA and 0.02v / v% Tween20) for equilibrium. It is then taken out and immersed in a solution containing 5μg / mL R9AP-Biotin (biotin-labeled R9AP protein). The R9AP antigen in the solution will bind to the surface of the SA (streptavidin) biological probe, increasing the thickness of the surface film. The biosensor with a solidified antigen of known concentration is then immersed in a buffer solution as a baseline. The biosensor with a solidified antigen of known concentration is immersed in a sample solution containing 31.3-500nM 5E9 antibody for about 120 seconds. Since the specific binding between antigen and antibody will lead to an increase in the thickness of the film layer, the biosensor bound to the 5E9 antibody is immersed in a buffer solution for dissociation for about 180 seconds. The antibody to be tested (5E9 antibody) will fall off the surface of the biosensor, resulting in a decrease in the thickness of the film layer. By real-time monitoring of the biosensor biofilm thickness during the experiment, the kinetic constant of the sample to be tested (5E9 antibody) can be obtained. The results are shown in Figure 2 As shown: KD (M) of 5E9 antibody = 2.6*10 -8 M; This indicates that the 5E9 antibody has a high affinity with the R9AP antigen. 3.3 Determination of the specific binding ability of the antibody 5E9 to R9AP by Western-Blot

[0216] Western-Blot (WB) can be performed according to conventional methods in the art. In the present embodiment, the specific operation is as follows: R9AP full-length plasmid is overexpressed in 293 cells by PEI, and then the cell lysate is collected by WB lysis buffer, and the fully lysed cell contents are collected after sufficient stirring, and the precipitate is discarded by centrifugation. The sample is then run on a gel using the SDS-PAGE method and transferred to a 0.45 μm PVDF membrane by an electroporator. The 5E9 antibody and the R9AP positive antibody (Sigma, catalog number #HPA049791-100UL) are then added to the PVDF membrane, incubated at 4° for 8 hours, and the antibody is discarded. Then, a 1:2000 diluted goat anti-rabbit IgG-HRP secondary antibody and a 1:4000 diluted rabbit anti-mouse IgG-HRP secondary antibody are added, incubated at room temperature for 30 minutes, and the antibody is discarded. Finally, horseradish peroxidase substrate is added for color development, and a BioRad illuminator is used to take pictures. The results are as shown in the figure. Figure 3 As shown: the 5E9 antibody and the well-validated Sigma R9AP antibody have consistent band positions for specific binding to R9AP, indicating that the 5E9 antibody has specific binding to the R9AP antigen.

[0217] Example 4 Neutralization Activity Determination of 5E9 Antibody

[0218] (1) Preparation of EBV virus:

[0219] 1) CNE2 cells infected with EBV-GFP (the virus has been disclosed in the literature: An Antibody Targeting the Fusion Machinery Neutralizes Dual-Tr opic Infection and Defines a Site of Vulnerability on Epstein-Barr Virus) were cultured in RPMI1640 + 5v / v% FBS at 37 degrees incubator (5v / v% CO2). When the cells grew to 90% density (10 cm dish), TPA with a final concentration of 20ng / mL and NaB (sodium butyrate) with a final concentration of 2.5mM were added for induction, and the medium was changed after 12 hours.

[0220] 2) 48-72 hours after the medium is replaced, the culture supernatant is collected to separate and purify the virus. The supernatant is directly aspirated, centrifuged and filtered with a 0.45 μm filter. After concentration, the supernatant is resuspended in serum-free RPMI1640 and immediately used for infection or stored at -80 degrees.

[0221] (2) Neutralization activity assay of 5E9 monoclonal antibody in epithelial cells

[0222] 1) 1x10 cells / well were plated in each well of a 96-well plate. 6 293T epithelial cells were cultured in each well and 100 μL of DMEM medium containing 10% FBS was added to each well.

[0223] 2) On the second day, take the 5E9 monoclonal antibody in the above example and adjust the concentration to 2 mg / mL. Add 60uL of DMEM medium to each well of a new 96-well plate, and add 120uL of 12.5μg / mL 5E9 antibody diluted with DMEM to the first well (the first well does not contain RPMI1640 medium).

[0224] 3) After 2-fold gradient dilution (gradient dilution will aspirate 60 μL from the first well and add it to the second well, and so on, aspirate 60 μL from the last well and discard it, and the final volume of each well is 60uL); add 60 μL of virus diluent to each well (the virus is diluted with DMEM medium, the titer is about 4*10 6 / mL), incubated at 37 degrees for 2 hours, and then added to the 293T cells plated the day before. Placed in a 37-degree incubator for 48 hours before detection.

[0225] 4) After digesting 293T cells with trypsin, a cell suspension was prepared, and the infection rate was detected by flow cytometry. The inhibition rate (neutralization efficiency, %) of the antibody in the 293T epithelial cell infection model was calculated by detecting the reduction ratio of the number of GFP-positive cells in the antibody-treated group compared with the infection control group (adding an equal volume of DMEM).

[0226] The results are as follows Figure 4 As shown: Monoclonal antibody 5E9 can significantly inhibit EBV infection of epithelial cells at a concentration of 400 μg / mL, where the vertical axis represents the EBV infection efficiency.

[0227] Example 5 Detection of B cell neutralizing activity of 5E9 monoclonal antibody

[0228] 1) Take the 5E9 monoclonal antibody in the above example and adjust the concentration to 2 mg / mL. Add 60uL RPMI1640 medium to each well of a new 96-well plate, and add 90uL 100μg / mL 5E9 antibody diluted with RPMI1640 to the first well (the first well does not contain RPMI1640 medium).

[0229] 2) After 3-fold gradient dilution (gradient dilution will aspirate 30 μL from the first well and add it to the second well, and so on, aspirate 30 μL from the last well and discard it, and the final volume of each well is 60 μL); add 60 μL of virus dilution solution to each well (the virus is diluted with DMEM medium, the titer is about 4*10 6 / mL), and then 1*10 6 Raji cells were placed in a 37°C incubator for 48 hours before testing.

[0230] 3) Raji cells were aspirated to prepare a cell suspension, and the infection rate was detected by flow cytometry. The inhibition rate (neutralization efficiency, %) of the antibody in the Raji B cell infection model was calculated by detecting the reduction ratio of the number of GFP-positive cells in the antibody-treated group compared with the infection control group (adding an equal volume of RPMI1640).

[0231] The results are as follows Figure 5 As shown: Monoclonal antibody 5E9 can significantly inhibit EBV infection of B cells at a concentration of 400 μg / mL in B cell infection, wherein the vertical axis represents the EB virus infection efficiency.

Claims

1. A monoclonal antibody or an antigen-binding fragment thereof against human R9AP protein, wherein the monoclonal antibody or the antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region; The heavy chain variable region comprises CDR-H1, CDR-H2 and CDR-H3; The CDR-H1, CDR-H2 and CDR-H3 are CDR1, CDR2 and CDR3 with amino acid sequences as shown in SEQ ID NO: 4; The light chain variable region comprises CDR-L1, CDR-L2 and CDR-L3; The CDR-L1, CDR-L2 and CDR-L3 are CDR1, CDR2 and CDR3 whose amino acid sequences are shown in SEQ ID NO:

15.

2. The monoclonal antibody or antigen-binding fragment thereof according to claim 1, characterized in that: The amino acid sequences of the CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 are shown in SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18, respectively, and the CDRs are defined according to the IMGT definition scheme; or The amino acid sequences of CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 are shown in SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18, respectively, and the CDRs are defined according to the Kabat definition scheme; or The amino acid sequences of CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 are shown in SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18, respectively, and the CDRs are defined according to the Chothia definition scheme; or The amino acid sequences of the CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 are shown in SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 19, SEQ ID NO: 20, and SEQ ID NO: 21, respectively, and the CDRs are defined based on the Contact definition scheme.

3. The monoclonal antibody or antigen-binding fragment thereof according to claim 1 or 2, characterized in that: The monoclonal antibody or antigen-binding fragment thereof comprises at least one of a full-length antibody, Fab, Fab', F(ab')2, Fv, scFv, a bispecific antibody, and a multispecific antibody.

4. A recombinant protein comprising: the monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 3; and an optional tag sequence for facilitating expression and / or purification.

5. A biological material related to the monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 3, or the recombinant protein according to claim 4, wherein the biological material comprises at least one of h1) to h16): h1) a nucleic acid molecule encoding the monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 3, or the recombinant protein according to claim 4; h2) an expression cassette comprising the nucleic acid molecule described in h1); h3) a vector comprising the nucleic acid molecule described in h1); h4) a vector comprising the expression cassette described in h2); h5) a transgenic cell line comprising the nucleic acid molecule described in h1); h6) a transgenic cell line comprising the expression cassette described in h2); h7) a transgenic cell line comprising the vector described in h3); h8) a transgenic cell line comprising the vector described in h4); h9) a microorganism comprising the nucleic acid molecule described in h1); h10) A microorganism comprising the expression cassette described in h2); h11) a microorganism comprising the vector described in h3); h12) a microorganism comprising the vector described in h4); h13) A virus comprising the nucleic acid molecule described in h1); h14) A virus comprising the expression cassette described in h2); h15) A virus comprising the vector described in h3); h16) A virus comprising the vector described in h4).

6. A method for preparing the monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 3, or the recombinant protein according to claim 4, comprising the following steps: It is obtained by expressing and purifying the biological material described in claim 5.

7. A conjugate comprising: at least one of the monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 3 and the recombinant protein according to claim 4; and a coupling portion, wherein the coupling portion comprises at least one of a detectable label, a drug, a toxin, a cytokine, a radionuclide, and an enzyme.

8. Use of at least one of (1) to (4) in the preparation of a product; (1) The monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 3; (2) The recombinant protein according to claim 4; (3) The biomaterial according to claim 5; (4) The conjugate according to claim 7; The product comprises at least one of a drug, a vaccine, a reagent, a test plate, a test kit, and a test chip.

9. A drug comprising at least one of (11) to (14): (l1) The monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 3; (12) The recombinant protein according to claim 4; (13) The biomaterial according to claim 5; (14) The conjugate according to claim 7; Preferably, the medicament further comprises a pharmaceutically acceptable carrier.

10. A kit for detecting Epstein-Barr virus, the kit comprising at least one of (l1) to (l4) and an adjuvant: (l1) the monoclonal antibody or antigen-binding fragment thereof according to any one of claims 1 to 3; (12) The recombinant protein according to claim 4; (13) The biomaterial according to claim 5; (14) The conjugate according to claim 7.

Images