A Cyperus rotundus producing strain and its application

Abstract

The present invention belongs to the technical field of screening of liquor brewing microorganisms, and relates to a strain of Epicoccum thailandicum and its application. The Epicoccum thailandicum strain DQ-1 has been deposited in the China Center for Type Culture Collection on October 17, 2024, and the strain deposit number is: CCTCC NO: M 20242249. The strain has excellent acid, alkali and high temperature tolerance, and it has the characteristics of being able to produce a variety of flavor substances such as a variety of organic acids, alcohols, and esters.

Description

Technical Field

[0001] The invention belongs to the technical field of white wine brewing microorganism screening and relates to a Cyperus rotundus strain and application thereof. Background Art

[0002] Maotai-flavor liquor is one of the most highly flavored liquors in China. It is loved by consumers for its light color, refreshing taste, smooth texture and rich Maotai aroma. The unique aroma, taste and flavor of Maotai-flavor liquor are directly derived from the types and richness of its flavor substances, and the production of flavor substances depends on the decomposition and metabolism activities of various microorganisms in the liquor brewing process. The traditional Maotai-flavor liquor brewing system is a fermentation process in which multiple microorganisms coexist. Microorganisms are the core of brewing, and the flavors produced by the fermentation metabolism of different microorganisms determine the yield and quality of the base liquor. During the brewing process, brewing microorganisms will face challenges such as high temperature and high acidity, which may lead to production problems such as decreased raw material utilization, insufficient fermentation power, production dropouts and imbalance in base liquor flavor. Therefore, the selection and breeding of key functional microorganisms with high tolerance and the development of supporting microecological regulation technologies can help companies improve production stability and improve the quality of base liquor.

[0003] Epicoccum is the dominant genus in Daqu. According to the study "Study on the structure of microbial communities in Shaoxing rice wine fermentation and its influence on flavor substances", Epicoccum is strongly correlated with flavor substances in rice wine, such as isobutyl acetate, isopentyl acetate, hexyl acetate, phenylethyl acetate, and isobutyl alcohol. In terms of liquor brewing, there are few studies on the correlation between the dominant Epicoccum in high-temperature Daqu and the production of flavor substances. For example, in the literature "The influence of microbial composition of raw materials and auxiliary materials on the flavor of Maotai-flavor liquor", "The source of microorganisms and environmental microbial distribution of Maotai-flavor liquor brewing in Chishui River production area", "Analysis of the association between physical and chemical indicators of Maotai-flavor Daqu with different sensory characteristics and mold communities", it is mentioned that Epicoccum was detected from wheat, Daqu and the environment using high-throughput sequencing, but the functional role of this genus is less explored. At the same time, the related functional research on Epicoccum microorganisms disclosed in the prior art is mainly in the field of prevention and control of plant fungal diseases. For example, Chinese patent CN115197853A discloses an endophytic bacteria strain Epicoccum thailandicum LF-28. After the strain is fermented, the resulting fermentation liquid contains substances with a significant effect of promoting plant growth, which can effectively improve the growth of Panax notoginseng plants, and is particularly suitable for the growth of Panax notoginseng planted in continuously cropped soils. It is beneficial to increase the yield of Panax notoginseng planted in continuously cropped soils and has no toxic effect on the plants.

[0004] Based on this, the study of the attached coccal microorganisms in the high-temperature Daqu used in liquor brewing is of great significance for the subsequent application of strains to improve the flavor and quality of liquor, and is of great significance to the field of sauce-flavor liquor brewing. Summary of the invention

[0005] The invention aims to provide a Cyperus rotundus producing strain and application thereof.

[0006] According to the first aspect of the present invention, the present invention provides a strain DQ-1 producing Epicoccum thailandicum, which has been deposited in the China Center for Type Culture Collection (CCTCC) on October 17, 2024, with a strain deposit number of CCTCC NO: M 20242249, a deposit address of Wuhan University Collection Center, Wuhan, China, and a strain classification nomenclature of Epicoccum thailandicum XJ-MDETH001-1.

[0007] 1) Strain source: The strain DQ-1 of the genus Epicoccum (Epicoccumthailandicum) obtained in the present invention was screened and separated from the brewing process of Maotai-flavor liquor, specifically screened from high-temperature Daqu, and obtained by gradient dilution separation. It has the characteristics of being able to produce a variety of flavor substances such as various organic acids (such as acetic acid, propionic acid, butyric acid, isovaleric acid, heptanoic acid), alcohols (such as 2,3-butanediol, 1,2-propylene glycol, β-phenylethanol, isobutanol), esters (such as ethyl heptanoate, butyl hexanoate, ethyl phenylacetate), etc.

[0008] 2) Colony characteristics: The Epicoccum thailandicum strain DQ-1 has well-developed aerial hyphae on red Bengal medium, which are white in color, and a tree-like colony structure with pink dots in the middle of the colony; the Epicoccum thailandicum strain DQ-1 has shorter, white hyphae on PDB medium, and a round colony structure with wrinkles in the middle.

[0009] 3) Bacterial characteristics: The Epicoccum thailandicum strain is a filamentous fungus, and the hyphae are long tubular branched filamentous structures, and obvious diaphragms can be seen in the long tubular structure of the hyphae.

[0010] 4) Physiological and biochemical characteristics: The results of carbon source utilization experiments showed that the Epicoccum thailandicum strain DQ-1 could well utilize fructose, glucose, lactose, L-rhamnose, β-glucan, xylo-oligosaccharide and mannan. The results of nitrogen source utilization experiments showed that the Epicoccum thailandicum strain DQ-1 could well utilize peptone, beef extract and yeast powder, followed by ammonium sulfate and urea.

[0011] 5) Tolerance: The Epicoccum thailandicum strain DQ-1 is a thermotolerant fungus that cannot grow at 20-35°C, but can grow well at 40-55°C. The brewing process of Maotai-flavor liquor is a high-temperature fermentation process, the temperature of Daqu can reach up to 65°C, and the fermentation temperature of the fermented grains can reach up to 50°C. Therefore, the thermotolerant strain has good survival ability in the liquor brewing process; at the same time, the Epicoccum thailandicum strain DQ-1 is acid-resistant and alkali-resistant. The strain can still grow well at pH 3, does not grow at pH 2, and can still grow well at pH 10. The high-temperature Daqu used in the brewing process of Maotai-flavor liquor produces abundant enzymes to hydrolyze raw materials under high temperature conditions. At the same time, a large amount of organic acids are produced during the metabolism process, which increases the acidity of the Daqu. The acidity of the Daqu used for brewing is generally between 0.10 and 0.35 mmol / g, that is, the pH is between 3.46 and 4.00. Therefore, the strain DQ-1 has good survival ability during high-temperature Daqu fermentation.

[0012] According to the second aspect of the present invention, the present invention further provides a starter culture comprising the Cyperus rotundus strain DQ-1 as described in the first aspect of the present invention.

[0013] In some embodiments of the present invention, the fermentation agent comprises living cells and / or dry bacteria and / or wet bacteria and / or immobilized cells and / or liquid bacterial agent and / or solid bacterial agent of the Epicococcus strain DQ-1.

[0014] According to the third aspect of the present invention, the present invention further provides a use of the Echinococcus sp. strain DQ-1 as described in the first aspect of the present invention or the starter as described in any one of the second aspects of the present invention in the field of liquor brewing.

[0015] According to the fourth aspect of the present invention, the present invention also provides a use of the Echinococcus strain DQ-1 as described in the first aspect of the present invention or the fermentation agent as described in any one of the second aspects of the present invention in fermentation to produce alcohol and / or acid and / or ester substances.

[0016] According to the fifth aspect of the present invention, the present invention also provides a method for increasing the content of alcohols and / or acids and / or esters, wherein the method uses the Echinococcus sp. strain DQ-1 described in the first aspect of the present invention as a fermentation agent to increase the content of alcohols and / or acids and / or esters during the fermentation process.

[0017] In some embodiments of the present invention, the fermentation is carried out using sorghum juice medium as the fermentation medium, and the sorghum juice medium is made from common glutinous sorghum as raw material. After washing, soaking, cleaning and boiling, saccharifying enzyme is added for saccharification, and sorghum juice supernatant is obtained after filtering and centrifugation.

[0018] In some embodiments of the present invention, the sugar content of the sorghum juice medium is 8-12°Bx. Specifically, the sugar content of the sorghum juice medium can be 8°Bx, 9°Bx, 10°Bx, 11°Bx, 12°Bx, or a range consisting of any two of the above values.

[0019] In some embodiments of the present invention, the preparation method of the sorghum juice culture medium includes: weighing common glutinous sorghum, quickly washing it, and soaking it in deionized water overnight; removing the soaking water, washing it with clean deionized water, adding deionized water in a ratio of 1:8-12 to boil it, boiling it until the sorghum is soft, and when the temperature drops to 55-65°C, adding saccharifying enzyme for saccharification, filtering it with gauze, filtering the sorghum residue, centrifuging it at 8000-15000r / min for 3-7min, collecting the sorghum juice supernatant, adjusting the sorghum juice supernatant to 8-12°Bx with a handheld sugar meter, sterilizing it under high pressure, and cooling it to obtain the sorghum juice culture medium. Specifically, the method for preparing the sorghum juice culture medium includes: weighing 150-250g of common glutinous sorghum, quickly washing it, and soaking it in 150-250mL of deionized water overnight; removing the soaking water, washing it with clean deionized water for 1-3 times, adding deionized water in a ratio of 1:8-12 to boil it, boiling it until the sorghum is soft, and when the temperature drops to 55-65°C, adding 2-6g of saccharifying enzyme for saccharification for 0.5-1.5h, filtering it with 5-7 layers of gauze, filtering the sorghum residue, centrifuging it at 8000-15000r / min for 3-6min, collecting the sorghum juice supernatant, adjusting the sorghum juice supernatant to 8-12°Bx with a handheld sugar meter, sterilizing it under high pressure at 115-125°C for 10-20min, and cooling it to obtain the sorghum juice culture medium.

[0020] In some embodiments of the present invention, the fermentation is carried out using malt wort medium as the fermentation medium, and the malt wort medium is made from malt extract as a raw material, and the malt wort supernatant is obtained by adding water and centrifuging.

[0021] In some embodiments of the present invention, the sugar content of the wort medium is 8-12°Bx. Specifically, the sugar content of the wort medium can be 8°Bx, 9°Bx, 10°Bx, 11°Bx, 12°Bx or a range consisting of any two of the above values.

[0022] In some embodiments of the present invention, the method for preparing the malt wort culture medium comprises: taking malt extract, adding deionized water to mix, centrifuging at 8000-15000 r / min for 3-7 min, collecting the supernatant, adjusting the sugar content of the supernatant to 8-12° Bx, cooling, and obtaining the malt wort culture medium.

[0023] In some embodiments of the present invention, during the fermentation process, the inoculation amount of the fermentation agent is 3%-20%. Specifically, the inoculation amount of the fermentation agent can be 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20% or a range consisting of any two of the above values.

[0024] In some embodiments of the present invention, the fermentation conditions in the fermentation process are: 40-55°C, 150-220r / min, and constant temperature culture for 2-5d. Specifically, the fermentation temperature in the fermentation process can be 40°C, 41°C, 42°C, 43°C, 44°C, 45°C, 46°C, 47°C, 48°C, 49°C, 50°C, 51°C, 52°C, 53°C, 54°C, 55°C, or a range consisting of any two of the above values. Specifically, the fermentation speed in the fermentation process can be 150r / min, 155r / min, 160r / min, 165r / min, 170r / min, 175r / min, 180r / min, 185r / min, 190r / min, 195r / min, 200r / min, 205r / min, 210r / min, 215r / min, 220r / min, or a range consisting of any two of the above values. Specifically, the fermentation time in the fermentation process can be 2d, 3d, 4d, 4d, 5d or a range consisting of any two of the above values.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] The invention screens and separates a high temperature (55°C) and acid and alkali (PH value of 3 and PH value of 10) resistant Epicoccum thailandicum strain DQ-1 from high temperature Daqu used in the brewing process of Maotai-flavor liquor. The Epicoccum thailandicum strain DQ-1 can significantly increase the content of flavor substances such as ethyl heptanoate, acetic acid, 2,3-butanediol, isovaleric acid and ethyl phenylacetate after high temperature culture on sorghum juice and malt juice culture medium, and the high temperature resistance and acid resistance of the strain can adapt to the high temperature and high acid fermentation environment in the fermentation process of liquor, which is of great significance for the subsequent application of the strain to improve the flavor and quality of liquor, and is of great significance to the brewing field of Maotai-flavor liquor. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is a strain culture morphology diagram obtained by inoculating strain DQ-1 on red Bengal medium for cultivation in Example 1 of the present invention;

[0028] Figure 2 This is a strain culture morphology diagram obtained by inoculating strain DQ-1 on PDB medium in Example 1 of the present invention;

[0029] Figure 3 This is a microscopic image (microscope 40x objective) of the strain DQ-1 obtained by inoculating it on a red Bengal medium and culturing it in Example 1 of the present invention;

[0030] Figure 4 This is a microscopic image of the strain DQ-1 in Example 1 of the present invention obtained by inoculating it on a red Bengal medium for cultivation (photographed at macro distance under a 40x objective lens of a microscope).

[0031] Figure 5 This is the phylogenetic tree of the molecular biological identification of strain DQ-1 in Example 1 of the present invention. DETAILED DESCRIPTION

[0032] The technical solution of the present invention is further described below by specific embodiments, which do not limit the protection scope of the present invention. Some non-essential modifications and adjustments made by others based on the concept of the present invention still fall within the protection scope of the present invention.

[0033] The strain (Epicoccum thailandicum) DQ-1 used in the embodiment of the present invention is a new strain of the genus Epicoccum (Epicoccum thailandicum) screened and isolated from high-temperature Daqu used for brewing Maotai-flavor liquor. The strain DQ-1 has been deposited in the China Center for Type Culture Collection (CCTCC) on October 17, 2024, and the strain collection number is: CCTCC NO: M 20242249, and the collection address is: Wuhan University Collection Center, Wuhan, China, and the specific collection address is: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the classification name of the strain is: Epicoccum thailandicum XJ-MDETH001-1.

[0034] Example 1 Strain Screening and Identification

[0035] 1. Strain Isolation and Screening

[0036] (1) taking a high-temperature Daqu sample used for brewing Maotai-flavor liquor, and grinding the high-temperature Daqu sample into powder using a pulverizer to obtain high-temperature Daqu powder;

[0037] (2) Weigh 10 g of the Daqu powder obtained in step (1) and mix it with 90 mL of sterile water, and incubate it on a constant temperature shaker at 25° C. and 180 r / min for 30 min; the sterile water used is prepared by filling 90 mL of pure water into a conical flask and sterilizing it at 121° C. for 20 min;

[0038] (3) dilute the bacterial suspension obtained in step (2) to 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 Five concentration gradients, 100 μL of each gradient dilution was respectively applied on a sterilized ISP2 solid medium (including 4.0 g yeast extract, 10.0 g malt extract, 4.0 g glucose, 15.0 g agar, and 1.0 L distilled water, pH = 7.3), and cultured in a 45°C constant temperature incubator for 72 hours to obtain colonies; wherein the formula of the ISP2 solid medium used is as follows: 4.0 g yeast extract, 10.0 g malt extract, 4.0 g glucose, 15.0 g agar, and 1.0 L distilled water, pH = 7.3;

[0039] (4) The pure bacterial colonies in step (3) were selected and inoculated into PDB medium for separation and purification to obtain the pure strain DQ-1.

[0040] 2. Strain morphology observation

[0041] The strain DQ-1 isolated in step 1 was inoculated into red Bengal and PDB solid culture media by dot-grafting method, and the colony morphology was observed after culturing for 72 hours. The culture morphology of the strain cultured on red Bengal medium was as follows: Figure 1 As shown, the culture morphology of the strain cultured on PDB medium is as follows Figure 2 At the same time, the strain DQ-1 was inoculated on Bengal red medium and cultured under a microscope to obtain the microscopic image as shown in Figure 3 , Figure 4 shown.

[0042] according to Figure 1 The results shown in the figure show that the aerial hyphae of DQ-1 strain on Bengal red medium are well developed and white, the colony structure is tree-like, and the middle part of the colony is pink dots; Figure 2 The results shown in the figure show that the hyphae of DQ-1 strain on PDB medium are shorter and white, and the colony structure is round with wrinkles in the middle. Figure 3 , Figure 4 The results shown show that the DQ-1 strain appears as a filamentous fungus under a microscope. The hyphae are long tubular branched filamentous structures, and obvious diaphragms can be seen in the long tubular structures of the hyphae.

[0043] 3. Molecular Biological Identification

[0044] After the strain DQ-1 obtained above was purified, genomic DNA was extracted: the genomic DNA was extracted according to the SK8259 (fungus) kit;

[0045] PCR amplification and sequencing: The universal primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) for amplifying the rDNA sequence of DQ-1 strain were used for PCR amplification. The PCR amplification system was as follows: Template (genomic DNA 20-50 ng / μl) 0.5 μL, 10× Buffer (with Mg 2+ ) 2.5μL, dNTP (each 2.5mM) 1μL, enzyme 0.2μL, F (10uM) 0.5μL, R (10uM) 0.5μL, double distilled H2O to 25μL; PCR amplification program: 94℃ pre-denaturation for 4min, 30 cycles including 94℃ denaturation for 45sec, 55℃ denaturation for 45sec, 72℃ denaturation for 1min, 72℃ repair extension for 10min, and then 4℃ termination reaction;

[0046] The PCR product obtained by the above PCR amplification was detected by 1% agarose gel electrophoresis and then sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing to obtain the ITS sequence of strain DQ-1 (as shown in SEQ ID NO.1). The obtained ITS sequence of strain DQ-1 (as shown in SEQ ID NO.1) was logged into the NCBI (www.ncbi.nlm.gov / blast / ) website for BLAST homology analysis and construction of a phylogenetic tree. The specific steps are as follows:

[0047] Click Nucleotide BLAST on the NCBI website, enter the ITS sequence of strain DQ-1 (as shown in SEQ ID NO.1), and select Sequences from TYPE material to compare the model bacterial sequences. After the comparison results are listed, select the model strain whose name ends with TYPE matarial. It is found that strain DQ-1 has the highest similarity with Epicoccum thailandicum, with a specific homology of 99.41%. Then, the related model bacterial sequences with high similarity are derived, and a phylogenetic tree is drawn using Mega11. The phylogenetic tree is shown in the figure. Figure 5 As shown, it is shown that the DQ-1 strain isolated by screening is Epicoccum thailandicum. Epicoccum thailandicum is a fungus published in "Mycosphere" by Mae Fah Luang University, Thailand.

[0048] Example 2 Evaluation of the physicochemical properties of strain DQ-1

[0049] 1. Carbon source utilization test

[0050] Using sugar-free Czapek medium as the basic medium, different carbon sources were added respectively. The carbon sources for the test were: fructose, glucose, lactose, L-rhamnose, β-glucan, oligoxylose, and mannan. The addition amount was 3%. The prepared medium was placed in a triangular flask and sterilized at 121℃ for 20 minutes, and then poured into a plate for later use. The strain DQ-1 stored at room temperature was inoculated and cultured. Each carbon source was repeated 3 times. The growth was recorded after culturing at 45℃ for 3 days. The results are shown in Table 1.

[0051] Table 1 Effects of different carbon sources on strain growth

[0052]

[0053] Note: “+++” (good growth), “++” (relatively good growth), “+” (average growth), “-” (no growth).

[0054] According to the results shown in Table 1, strain DQ-1 can utilize fructose, glucose, lactose, L-rhamnose, β-glucan, xylo-oligosaccharide and mannan well.

[0055] 2. Nitrogen source utilization test

[0056] The Czapek medium without NaNO3 was used as the basic medium. Different nitrogen sources were added to the basic medium. The nitrogen sources tested were ammonium sulfate, peptone, beef extract, yeast powder and urea. The addition amount was 0.3%. The prepared medium was placed in a conical flask and sterilized at 121℃ for 20 minutes. The plate was poured for standby use. The strain DQ-1 stored at room temperature was inoculated and cultured. Each nitrogen source was repeated 3 times. The growth was recorded after culturing at 45℃ for 3 days. The results are shown in Table 2.

[0057] Table 2 Effects of different nitrogen sources on strain growth

[0058]

[0059] Note: “+++” (good growth), “++” (relatively good growth), “+” (average growth), “-” (no growth).

[0060] According to the results shown in Table 2, strain DQ-1 can utilize peptone, beef extract and yeast powder well, followed by ammonium sulfate and urea.

[0061] 3. Temperature tolerance

[0062] Using ordinary PDA as the culture medium, strain DQ-1 was inoculated and cultured at constant temperatures of 20, 25, 30, 35, 40, 45, 50, 55, and 60°C, respectively. Each temperature was repeated 3 times, and the growth was recorded after 3 days of culture. The results are shown in Table 3.

[0063] Table 3 Effects of different culture temperatures on strain growth

[0064]

[0065] Note: “+++” (good growth), “++” (relatively good growth), “+” (average growth), “-” (no growth).

[0066] According to the results shown in Table 3, strain DQ-1 is a thermotolerant fungus that cannot grow at 20-35°C, but can grow well at 40-55°C. The brewing process of Maotai-flavor liquor is a high-temperature fermentation process, the maximum temperature of Daqu can reach 65°C, and the maximum temperature of fermented grains can reach 50°C. Therefore, this thermotolerant strain has good survival ability in the liquor brewing process.

[0067] 4. PH tolerance

[0068] The pH values ​​of the PDA medium were adjusted to 2, 3, 4, 5, 6, 7, 8, 9, and 10 with 1 mol / L HCl and 1 mol / L NaOH. The strain DQ-1 was inoculated at the center of the PDA medium with different pH values ​​and cultured at 45°C for 3 days. The growth was recorded. The results are shown in Table 4.

[0069] Table 4 Effect of different culture pH on strain growth

[0070]

[0071] Note: “+++” (good growth), “++” (relatively good growth), “+” (average growth), “-” (no growth).

[0072] According to the results shown in Table 4, strain DQ-1 is an acid-resistant and alkali-resistant strain. It can still grow well at pH 3, does not grow at pH 2, and can still grow well at pH 10. In the high-temperature Daqu used in the brewing process of Maotai-flavor liquor, microorganisms produce abundant enzymes to hydrolyze raw materials under high temperature conditions, and at the same time produce a large amount of organic acids in the metabolic process, which increases the acidity of Daqu. The acidity of Daqu used for brewing is generally between 0.10 and 0.35 mmol / g, that is, the pH is between 3.46 and 4.00. Therefore, strain DQ-1 has good survival ability during high-temperature Daqu fermentation.

[0073] Example 4 Ability of strain DQ-1 to produce flavor substances by fermentation

[0074] This example further explores the ability of strain DQ-1 to produce flavor substances by fermentation, as follows:

[0075] (1) Seed solution preparation

[0076] The obtained pure strain DQ-1 colony was picked and inoculated into 100 mL PDB liquid culture medium, and cultured in a constant temperature shaker at 45°C and 180 r / min for 72 h to prepare the strain DQ-1 seed solution;

[0077] (2) Preparation of liquid culture medium

[0078] Sorghum culture medium: Weigh 200 g of common glutinous sorghum, wash it quickly, and soak it in 200 mL of deionized water overnight; remove the soaking water, wash it twice with clean deionized water, add 4 L of deionized water in a ratio of 1:10 to boil, boil until the sorghum is soft, wait until the temperature drops to 60°C, add 4 g of saccharifying enzyme for 1 hour, filter it with 6 layers of gauze, filter the sorghum residue, centrifuge it at 10000 min for 5 min, collect the sorghum juice supernatant, adjust the sorghum juice supernatant to 10°Bx with a handheld sugar meter, sterilize it at 121°C under high pressure for 15 min, and cool it to obtain a sorghum liquid culture medium;

[0079] Malt extract medium: weigh 70 g of malt extract, add 400 mL of deionized water, centrifuge at 10000 r / min for 5 min, collect the wort supernatant, adjust the wort supernatant to 10° Bx with a handheld sugar meter, sterilize at 121°C for 15 min, and cool to obtain a malt extract liquid medium;

[0080] (3) inoculating the seed liquid prepared in step (1) into 100 mL of sorghum liquid medium and malt extract liquid medium at an inoculum rate of 5%, and directly taking 100 mL of sorghum liquid medium and malt extract liquid medium without inoculation as a blank control group, and shaking and culturing on a constant temperature shaker at 45° C. and 180 r / min for 72 h to obtain sorghum fermentation liquid, malt extract fermentation liquid, sorghum blank (fermentation liquid obtained without inoculation of strain), and malt blank (fermentation liquid obtained without inoculation of strain);

[0081] (4) Analysis of flavor components in fermentation broth

[0082] The flavor components in the sorghum fermentation broth, malt juice fermentation broth, sorghum blank, and malt blank obtained by fermentation in step (3) are analyzed respectively; wherein the conditions for gas chromatography analysis include: centrifuging the obtained fermentation broth at 4° C. for 10 min, filtering the supernatant with a 0.22 μm sterile water membrane, taking 1 mL of the filtrate, adding 4 μL of a mixed internal standard preparation solution (tert-amyl alcohol: 323.6 mg / L, n-amyl acetate: 351.2 mg / L, 2-ethylbutyric acid: 368.2 mg / L), Mix well and inject; GC conditions include: DB-WAX column (30m×0.2mm×0.25μm); injection port temperature 240℃; injection volume: 1μL; split ratio: 30:1 carrier gas: nitrogen (purity ≥99.999%); column flow rate: 1mL / min; heating program: start at 35℃, hold for 3min, increase to 100℃ at 3℃ / min, do not hold; then increase to 200℃ at 7℃ / min, hold for 16min; hydrogen flame ionization detector temperature 250℃. Repeat the experimental operation 3 times under the same conditions, and the results are mg / L. The results are shown in Tables 5 and 6.

[0083] Table 5 Fermentation results of malt extract liquid medium (unit: mg / L)

[0084] Flavor ingredients Malt Blank Malt fermentation liquid Yield Growth rate Aroma description Ethyl heptanoate 85.54 165.62 80.08 94％ Fruity Butyl hexanoate 13.85 43.04 29.19 211％ Fruity Acetic acid 335.67 679.85 344.18 103％ sour taste Propionic acid 0.00 14.84 14.84 / sour taste 2,3-Butanediol 152.98 766.05 613.07 401％ Sweetness 1,2-Propanediol 0.00 40.19 40.19 / Mellow Butyric acid 15.85 62.88 47.03 297％ Fruity Isovalerate 1331.31 5198.69 3867.38 290％ Cheese flavor Ethyl phenylacetate 446.36 991.06 544.7 122％ Floral scent β-Phenylethanol 0.00 9.69 9.69 / Rose scent Heptanoic acid 76.02 209.68 133.66 176％ sour taste Isoamyl acetate 0 0 0 / Fruity Isobutanol 0 0 0 / Fruity

[0085] "Sauce aroma, floral and fruity aroma, and baking aroma" are typical aroma characteristics of sauce-flavor liquor. According to the results shown in Table 5, the flavor substances such as ethyl heptanoate, butyl hexanoate, and butyric acid, whose contents increased significantly after fermentation by strain DQ-1, mainly showed fruity aroma; ethyl phenylacetate and β-phenylethanol mainly showed floral aroma. Studies have shown that they can assist in the formation of elegant and mellow flavors of the wine. The difference in ethyl phenylacetate content is one of the main reasons for the large differences in floral and fruity aromas in the fermented grains of brewed liquor; the increase in isovaleric acid content was also significant, the most It can be increased to 3867.38mg / L, which mainly presents cheese flavor. It contributes greatly to the flavor of base wine in each round of sauce-flavor liquor and is one of the key flavor substances; the right amount of polyols can make the wine sweet and soft, 2,3-butanediol presents obvious sweetness, which is a kind of polyol. After fermentation by strains, its content increases significantly; after fermentation by strains, acetic acid and heptanoic acid increase significantly, and propionic acid increases slightly, which presents sour taste. Acids are important flavor compounds in liquor, and also have prebiotic functions such as anti-oxidation and maintaining intestinal health. At the same time, according to the results shown in Table 5, isopentyl acetate and isobutanol were not detected in the malt extract fermentation liquid obtained by fermenting the malt extract medium with strain DQ-1.

[0086] Table 6 Sorghum juice fermentation results (unit: mg / L)

[0087]

[0088]

[0089] As a saccharifying agent for wine fermentation, high-temperature Daqu is widely used in the fermentation stage of fermented mash, and sorghum is the main raw material for fermentation of fermented mash. The results shown in Table 6 show that by inoculating strain DQ-1 to ferment sorghum culture medium, the contents of fruity flavor substances: ethyl heptanoate, butyl hexanoate, butyric acid; floral flavor substances: ethyl phenylacetate, β-phenylethanol; cheese flavor substances: isovaleric acid; and sour flavor substances: acetic acid and heptanoic acid in the sorghum fermentation liquid obtained were increased.

[0090] It is to be understood that the present invention is described by some embodiments, and it is known to those skilled in the art that various changes or equivalent substitutions may be made to these features and embodiments without departing from the spirit and scope of the present invention. In addition, under the teachings of the present invention, these features and embodiments may be modified to adapt to specific circumstances and materials without departing from the spirit and scope of the present invention. Therefore, the present invention is not limited by the specific embodiments disclosed herein, and all embodiments falling within the scope of the claims of the present invention are within the scope of protection of the present invention.

[0091]

[0092]

Claims

1. An Epicoccum thailandicum strain DQ-1 was deposited in the China Center for Type Culture Collection on October 17, 2024, and the strain deposit number is: CCTCC NO: M 20242249.

2. A starter culture comprising the Cyperus rotundus strain DQ-1 according to claim 1.

3. The leavening agent according to claim 2, characterized in that The method comprises living cells and / or dry bacteria and / or wet bacteria and / or immobilized cells and / or liquid bacterial agent and / or solid bacterial agent of the Epicococcus strain DQ-1.

4. Use of the Epicococcus strain DQ-1 as claimed in claim 1 or the leavening agent as claimed in any one of claims 2 to 3 in the field of liquor brewing.

5. Use of the Epicococcus strain DQ-1 according to claim 1 or the starter according to any one of claims 2 to 3 in fermentation to produce alcohols and / or acids and / or esters.

6. A method for increasing the content of alcohols and / or acids and / or esters, characterized in that: The Echinococcus sp. strain DQ-1 described in claim 1 is used as a fermentation agent to increase the content of alcohols and / or acids and / or esters during the fermentation process.

7. The method according to claim 6, characterized in that The fermentation is carried out using sorghum juice medium as the fermentation medium, wherein the sorghum juice medium is made of common glutinous sorghum as raw material, after washing, soaking, cleaning, boiling, adding saccharifying enzyme for saccharification, filtering, centrifuging to obtain sorghum juice supernatant; and / or The sugar content of the sorghum juice supernatant is 8-12° Bx.

8. The method according to claim 6, characterized in that The fermentation is carried out using a malt extract medium as a fermentation medium, wherein the malt extract medium is made from malt extract as a raw material, and a malt extract supernatant is obtained by adding water and centrifuging; and / or The sugar content of the wort medium is 8-12° Bx.

9. The method according to any one of claims 7 or 8, characterized in that: During the fermentation process, the inoculation amount of the fermentation bacteria agent is 3%-20%.

10. The method according to any one of claims 7 or 8, characterized in that: The fermentation conditions in the fermentation process are: 40-55°C, 150-220r / min, and constant temperature culture for 2-5 days.

Images