Trichoderma brevicompactum 6311 with phytophthora capsici biological control capability and application

Abstract

The invention belongs to the technical field of microorganisms, and discloses a Trichoderma brevicompactum 6311 with phytophthora capsici biological control ability, the name of the Trichoderma brevicompactum 6311 is 6311, the classification name of the Trichoderma brevicompactum is Trichoderma brevicompactum 6311, the preservation number of the Trichoderma brevicompactum 6311 is CGMCC No.41489, the preservation date of the Trichoderma brevicompactum 6311 is August 13, 2024, and the preservation unit of the Trichoderma brevicompactum 6311 is China General Microbiological Culture Collection Center, No. 3, No.1 Yard, Beichen West Road, Chaoyang District, Beijing. The fermentation liquor of the trichoderma 6311 has the capability of inhibiting the growth of phytophthora hyphae on a flat plate, and the inhibition rate reaches 100%. The germination rate, radicle and hypocotyl length, growth index and fresh weight of the pepper seeds soaked in the 6311 fermentation liquor are improved. The research shows that the trichoderma brevicompactum 6311 has biological control potential and provides a theoretical basis for application of the trichoderma brevicompactum 6311 as a biological bactericide.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, in particular to a strain of Trichoderma brevisdens 6311 with biological control capability of Phytophthora capsici and its application. Background Art

[0002] Pepper Phytophthora capsici is a fungal pathogen that can cause rot and wilt of many crops. Pepper cultivation is extremely vulnerable to Phytophthora capsici, and the disease often occurs rapidly in a short period of time, resulting in severe reduction in pepper yield or even total crop failure. The sporangium of pepper Phytophthora capsici can directly germinate and invade plant cells or produce zoospores. These zoospores are released into the water, attached to the roots of the plant, and produce reproductive tubes that penetrate plant cells to cause pepper wilt. Pepper blight is one of the most common soil-borne fungal diseases in the world. It occurs at all stages of pepper growth and exists in the soil in various forms, such as thick-walled spores, zoosporangia and oospores, and causes serious pollution to the soil environment. Pepper Phytophthora capsici can survive in the soil for a long time, so soil contaminated by pepper Phytophthora capsici is the main cause of pepper blight.

[0003] Chemical pesticides are currently the most common method for controlling pepper blight. Long-term application of pesticides can easily cause pepper phytophthora to develop resistance. For this reason, it is proposed to use biocontrol bacteria and their metabolites as alternatives to traditional chemical pesticides. Trichoderma can inhibit the growth of phytophthora, improve plant resistance to pathogens, and promote plant growth. It has been successfully developed for commercial biological control agents and can effectively control a variety of pathogens such as phytophthora, Fusarium, and Pythium. Trichoderma antagonizes pathogens through a variety of direct and indirect mechanisms. The direct mechanism of Trichoderma biocontrol includes competition for space and nutrients, fungal parasitism, secretion of lytic enzymes and antibiotics, etc. For example, the hyphae of Trichoderma spinulosa surrounds and penetrates the hyphae of pepper phytophthora, causing the hyphae to collapse. At the same time, it can also use spores to enter the oospores of pepper phytophthora, develop hyphae and produce conidia, resulting in the decomposition of pepper oospores. The "gliovirin" antibiotic produced by Trichoderma viride can inhibit the growth of phytophthora, and the incidence rate is significantly reduced by 62.64%. The indirect mechanism is mainly to induce plant resistance, increase plant resistance to stress and root growth. For example, after the lilac seedlings were treated with Trichoderma.afroharzianum T52 biofertilizer, the number of lateral roots increased significantly and the incidence of the plants was reduced by 12.28% compared with the control; Trichoderma ghaniana and Trichoderma citri inhibited cucumber diseases caused by Pythium.

[0004] Although Trichoderma has been used as a biocontrol strain for a long time, the existing literature has not studied the biocontrol of Trichoderma brevicompactum in pepper Phytophthora, especially its metabolites. A highly effective disease-resistant and growth-promoting Trichoderma brevicompactum was isolated from the rhizosphere soil of peppers grown continuously for a long time in Handan and Baoding, Hebei Province, China. After research, it was found that its sterile fermentation liquid can promote the germination of pepper seeds; the 5-day inhibition rate of its fermentation liquid on Phytophthora hyphae reached 100%. The present invention measured the relative concentration of Trichoderma brevicompactum iron carriers for the first time: it was found to be much higher than other Trichoderma (72.88%). It provides support for effectively preventing and controlling pepper blight and promoting sustainable production of pepper. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a Trichoderma brevis 6311 with the ability to biologically control Phytophthora capsici and its application.

[0006] The technical solution adopted by the present invention to solve its technical problem is:

[0007] A strain of Trichoderma brevicompactum 6311 with biological control ability of pepper phytophthora, its name is: 6311, the classification name is: Trichoderma brevicompactum, the preservation number is: CGMCC No.41489, the preservation date is: August 13, 2024, the preservation unit is: General Microbiology Center of China Microbiological Culture Collection Administration, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0008] Furthermore, the colony and bacterial characteristics of the strain are as follows: on the PDA plate, the aerial mycelium is well developed, the colony is fluffy to felt-like, white, thick and fluffy, with protrusions and obvious concentric circles, and after 5 days, the PDA plate is covered with a large number of dark green or yellow-green spores, and the back is yellow-brown.

[0009] Furthermore, the strain has biocontrol potential.

[0010] Furthermore, the fermentation liquid of Trichoderma brevis 6311 can inhibit the growth of Phytophthora mycelium, and the inhibition rate reaches 100%;

[0011] The short dense Trichoderma 6311 has a heavy parasitic effect on pepper phytophthora. 6311 has the highest activity in the iron carrier experiment, and can produce the growth hormone IAA with a yield of 14.56 mg / L, indicating that 6311 has the potential to inhibit disease and promote growth. In the in vitro fruit test, 6311 has an inhibitory effect on the growth of phytophthora on pepper fruits. At the same time, the fermentation liquid of Trichoderma 6311 has the ability to inhibit the growth of phytophthora hyphae on the plate, and the inhibition rate reaches 100%. The germination rate, radicle hypocotyl length, growth index and fresh weight of pepper seeds soaked in 6311 fermentation liquid are all improved.

[0012] The invention discloses an application of the Trichoderma brevisdens 6311 in preparing a biocontrol agent for Phytophthora capsici.

[0013] The advantages and positive effects achieved by the present invention are:

[0014] 1. The present invention isolates 60 strains from the rhizosphere soil of pepper, and obtains a biocontrol bacterium with high antagonistic activity against pepper phytophthora. Through morphological and molecular identification, all strains belong to the genus Trichoderma, including a strain of Trichoderma brevicompactum. The inhibition rate of Trichoderma brevicompactum 6311 on the growth of phytophthora hyphae is as high as 82.22% (Trichoderma brevicompactum). Microscope and scanning electron microscope (SEM) observations showed that 6311 had a heavy parasitic effect on pepper phytophthora. 6311 had the highest activity in the iron carrier experiment and could produce the growth hormone IAA (14.56 mg / L), indicating that 6311 has the potential to inhibit disease and promote growth. In the in vitro fruit test, 6311 had an inhibitory effect on the growth of phytophthora on pepper fruits. At the same time, the fermentation liquid of Trichoderma 6311 has the ability to inhibit the growth of phytophthora hyphae on the plate, and the inhibition rate reaches 100%. The germination rate, radicle and hypocotyl length, growth index and fresh weight of pepper seeds soaked in 6311 fermentation liquid were improved. This study showed that Trichoderma brevisdens 6311 has the potential for biological control and provides a theoretical basis for its application as a biofungicide.

[0015] 2. In July and September 2023, a large number of pepper plants died from pepper wilt in Hebei Province, China. The present invention collected rhizosphere soil from a small number of healthy pepper plants to determine whether there are biocontrol bacteria that can inhibit pepper wilt around their rhizosphere. The present invention isolated the highly effective antagonistic Trichoderma 6311 from it, and evaluated their inhibitory effects and mechanisms on pepper wilt on plates and fruits, and explored the disease inhibition and growth promotion functions of different Trichoderma fermentation broths. In summary, this study screened out the highly effective disease inhibition and growth promotion biocontrol bacteria Trichoderma brevis 6311, which provides a basis for the prevention and long-term effective control of pepper wilt by biocontrol bacteria, as well as reducing the use of fungicides and ensuring environmental safety. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The experimental diagram of the inhibition of Phytophthora by different confrontation treatments after 5 days in the present invention; wherein, (a) Phytophthora control culture; (b) 6311 and Phytophthora confrontation culture; (c) 6311 hyphae entangled with Phytophthora hyphae under a 400x optical microscope; (d) The inhibition rate of 6 biocontrol bacteria on Phytophthora; (e) 6311 hyphae entangled with Phytophthora hyphae;

[0017] Figure 2 The morphological and molecular identification diagrams of the biocontrol bacteria in the present invention; wherein, (a) the morphological characteristics of Trichoderma 2221; (b) the conidia of Trichoderma 6311 under a microscope; (c) the developmental tree of 6311, the above two developmental trees are constructed based on its sequences and closely related phylogenetic species (type cultures) obtained using the NCBIBLAST search tool. The sequences were aligned using the clusterW sequence alignment tool in the mega11 software; the GenBank accession numbers of the isolates and closely related species are in brackets;

[0018] Figure 3 The growth of peppers 4 days after the inoculation of Phytophthora in the present invention; wherein the first row of left pictures is the 6311 treatment group; the first row of right pictures is the Phytophthora treatment group; the second row is the inhibition rate of mycelial growth of Phytophthora on pepper fruits by the five Trichoderma treatment groups;

[0019] Figure 4 The figure is a measurement diagram of the ability of Trichoderma to produce siderophores under double-layer plate culture in the present invention; wherein, (a) 6311; (b) relative concentrations of siderophores in the 6 Trichoderma treatment groups;

[0020] Figure 5 The experimental diagram of the inhibition of Phytophthora by fermentation broth treated with different methods after 5 days in the present invention; wherein, (a) 6311; (b) Phytophthora control; (c) inhibition rate of 6 kinds of Trichoderma fermentation broth on the growth of Phytophthora hyphae;

[0021] Figure 6 It is an index diagram of the treatment group inoculated with 6 kinds of Trichoderma fermentation broth in the present invention; wherein, the left figure of the first row is the germination potential (5d) and germination rate (10d) of different treatments after inoculation with fermentation broth; the right figure of the first row is the germination index of different treatments after inoculation with fermentation broth 5d; the left figure of the second row is the hypocotyl and radicle length of different treatments after inoculation with fermentation broth 10d; the right figure of the second row is the fresh weight of different treatments after inoculation with fermentation broth 10d. DETAILED DESCRIPTION

[0022] The present invention will be further described below in conjunction with the embodiments. The following embodiments are descriptive rather than restrictive, and the protection scope of the present invention cannot be limited by the following embodiments.

[0023] The various experimental operations involved in the specific embodiments are all routine techniques in the art. For parts not specially annotated in this document, ordinary technicians in the art can implement them by referring to various commonly used reference books, scientific and technological literature or related instructions, manuals, etc. before the filing date of this invention.

[0024] A strain of Trichoderma brevicompactum 6311 with biological control ability of pepper phytophthora, its name is: 6311, the classification name is: Trichoderma brevicompactum, the preservation number is: CGMCC No.41489, the preservation date is: August 13, 2024, the preservation unit is: General Microbiology Center of China Microbiological Culture Collection Administration, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0025] Preferably, the colony and bacterial characteristics of the strain are: on the PDA plate, the aerial mycelium is well developed, the colony is fluffy to felt-like, white, thick and fluffy, with protrusions and obvious concentric circles, and after 5 days, the PDA plate is covered with a large number of dark green or yellow-green spores, and the back is yellow-brown.

[0026] Preferably, the strain has biological control potential.

[0027] Preferably, the fermentation liquid of Trichoderma brevis 6311 can inhibit the growth of Phytophthora mycelium, and the inhibition rate reaches 100%;

[0028] The short dense Trichoderma 6311 has a heavy parasitic effect on pepper phytophthora. 6311 has the highest activity in the iron carrier experiment, and can produce the growth hormone IAA with a yield of 14.56 mg / L, indicating that 6311 has the potential to inhibit disease and promote growth. In the in vitro fruit test, 6311 has an inhibitory effect on the growth of phytophthora on pepper fruits. At the same time, the fermentation liquid of Trichoderma 6311 has the ability to inhibit the growth of phytophthora hyphae on the plate, and the inhibition rate reaches 100%. The germination rate, radicle hypocotyl length, growth index and fresh weight of pepper seeds soaked in 6311 fermentation liquid are all improved.

[0029] The invention discloses an application of the Trichoderma brevisdens 6311 in preparing a biocontrol agent for Phytophthora capsici.

[0030] Specifically, the following examples illustrate the technical solutions of the present invention from the perspectives of isolation and identification of strains, etc. The specific contents are as follows.

[0031] 2. Materials and Methods

[0032] 2.1 Collection of pathogenic bacteria strains and soil samples

[0033] Capsicum frutescens was kindly provided by the Institute of Plant Protection, Hebei Academy of Agriculture and Forestry Sciences. Trichoderma strains were collected from rhizosphere soils of pepper planting areas in Handan and Baoding, Hebei Province, China. The collected soils were stored at 4°C for the isolation of biocontrol bacteria.

[0034] 2.2 Isolation and screening of biocontrol bacteria

[0035] Weigh 5 g of rhizosphere soil, place it in 45 mL of sterile water, and shake it on a shaker (28°C, 180 r / min) for 1 h. Use the stepwise dilution method to dilute the soil samples into 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 100 μL of soil suspension was spread on potato dextrose agar (PDA) plates, repeated 3 times, cultured at 28°C for 3 days and observed. Single colonies were picked with an inoculation loop, transferred to PDA plates for further purification, cultured at 28°C, repeated 5 times, until pure colonies were obtained, numbered and stored at 4°C.

[0036] 2.3 Dual culture experiment

[0037] Punch holes at the edge of the colony of Phytophthora capsici that had been cultured for 5 days with a 5mm radius puncher. Inoculate a 5mm bacterial cake on the right side of the PDA plate. Inoculate the 6 isolated Trichoderma biocontrol fungi at a symmetrical position away from the Phytophthora fungi. The distance between the two fungi was 5 cm. Each plate was sealed with a sealing film and incubated in the dark at 28°C. Each treatment group was replicated three times. Only the Phytophthora fungi cake was inoculated on the PDA plate as a control. After inverted culture for 7 days, the antibacterial rate was calculated using the cross method, see formula (1).

[0038]

[0039] Wherein, D: the diameter of Phytophthora hyphae in the control group, d: the diameter of Phytophthora hyphae in the treatment group.

[0040] 2.4 Identification of biocontrol strains

[0041] 2.4.1 Morphological studies

[0042] The strain to be identified was inoculated onto a PDA plate and cultured at a constant temperature of 28°C. The colony morphology and color were observed after 5 days, and a slide was made to observe the morphological characteristics of conidia and conidiophores under an optical microscope.

[0043] 2.4.2 Molecular Biology Research

[0044] Quickly grind the mycelium (0.5g) of 5 biocontrol bacteria into fine powder in liquid nitrogen. Transfer the frozen fine powder to a 50mL centrifuge tube in time, add 15mL extraction buffer, and gently rotate to mix. Add 1mL of 20% sodium dodecyl sulfate (SDS) (pH7.2), mix well, keep warm in a 65℃ water bath for 20-30min, and mix gently frequently. Add 5mL of 5mol / L potassium acetate (KAC), mix well, ice bath for 20-30min, and centrifuge at 10000r / min, 4℃ for 10min. Take the supernatant, add an equal volume of chloroform / isoamyl alcohol (volume ratio of 24:1), mix well, and centrifuge at 10000r / min, 4℃ for 10min. Take the aqueous phase, accurately add 0.6 times the volume of isopropanol, gently mix, place on ice for 10 minutes, centrifuge at 7000r / min, 4℃ for 10 minutes, wash the precipitate with 70% ethanol, dissolve in sterile double distilled water after centrifugation. Add 30μl DNase-freeRNase (10mg / mL) and incubate at 37℃ for 30min. Add an equal volume of phenol / chloroform, mix, centrifuge at 10000r / min, 4℃ for 10min. Take the aqueous phase, add 0.6 times the volume of isopropanol to precipitate DNA, wash with 70% ethanol, air dry slightly, and dissolve in TE buffer. Internal transcribed spacer ITS4: 5'-TCC TCC GCT TAT TGA TATGC-3', ITS5: 5'-GGA AGT AAA AGT CGT AAC AAG G-3'. Then sent to Beijing Baojieluo Biological Company for polymerase chain reaction (PCR) amplification and internal transcribed spacer (ITS) sequencing.

[0045] 2.4.3 Phylogenetic analysis

[0046] In order to study the relationship between the antibacterial agents, the obtained ITS sequences were used to construct a phylogenetic tree together with other Trichoderma sequences downloaded from the GenBank database of NCBI. The phylogenetic tree was constructed using the neighbor-joining method in the MEGA11 program. Our Trichoderma ITS sequences have been submitted to the GenBank database of NCBI (National Center for Biotechnology Information).

[0047] 2.5 Siderophore production assessment

[0048] 2.5.1 Qualitative evaluation

[0049] After the 6 isolated Trichoderma strains were cultured on PDA plates at 28°C for 7 days, the CAS test medium cooled to below 60°C was poured onto the PDA plates with colonies and left for 24 hours to observe the color changes of each plate. Each treatment group was repeated three times.

[0050] 2.5.2 Quantitative Evaluation

[0051] The strain stored at 4°C was inoculated on a PDA medium plate and cultured in a biochemical incubator at 28°C for 3-5 days. The mycelium was then picked up and transferred to 100 mL of PDB medium. The culture was continued at 28°C and 120 r / min for 5 days. After filtering through four layers of lens paper, the mixture was centrifuged at 5000 r / min for 10 min, the supernatant was discarded, the bacteria were washed with sterile water, and centrifuged at 5000 r / min for 10 min. The supernatant was discarded again. The washing was repeated three times, and the bacteria were collected to prepare a spore suspension.

[0052] Inoculate the bacterial liquid in PDB medium at an inoculum size of 5% (volume fraction), culture at 28°C and 120r / min for 5 days, and centrifuge at 8000r / min for 15min to obtain the supernatant. Prepare several PC tubes, add 3mL of CAS detection solution to each PC tube, and then add the supernatant to be tested, mix well and let stand for 1h, and then detect its absorbance A1 at 630nm. Take another 3mL of uninoculated PDB medium and 3mL of CAS detection solution and mix them thoroughly. Use the same method to determine its absorbance as the reference value A0. The calculation formula for the iron carrier synthesis rate is:

[0053]

[0054] 2.6 Antagonistic effect of Trichoderma strains on Phytophthora hyphae

[0055] After the pepper phytophthora pathogen was cultured on the PDA plate at 28℃ for 5 days, a hole was punched at the edge of the colony with a 5mm radius puncher. A 5mm phytophthora cake was inoculated on the right side of the PDA plate, and the Trichoderma strain was inoculated at the symmetric position of the phytophthora cake, with 3 replicates for each strain. Under a constant temperature of 28℃, the plate was inverted and cultured for 4 days. The colony junction was cut off with a sterile blade, and observed and recorded with an optical microscope; the junction was collected and fixed with a 1.5mL centrifuge tube, and 1mL of 2.5% glutaraldehyde solution was added. The glutaraldehyde fixative was filled to the centrifuge tube so that the sample was completely immersed in the fixative, and the sample was rinsed three times with 0.1M, pH7.0 phosphate buffer for 15 minutes each time; the sample was fixed with a 1% mass concentration of osmium acid solution for 1-2 hours; the osmium acid waste liquid was carefully removed, and the sample was rinsed three times with 0.1M, pH7.0 phosphate buffer for 15 minutes each time. The samples were dehydrated with ethanol solutions of gradient mass concentrations (including 30%, 50%, 70%, 80%, 90% and 95%, each concentration was treated for 15 minutes, and then treated twice with 100% ethanol, each time for 20 minutes. The samples were treated with a mixture of ethanol and isoamyl acetate (V / V=1 / 1, volume ratio) for 30 minutes, and then treated with pure isoamyl acetate for 1 hour or left overnight. Critical point drying, coating, and the treated samples were observed in SEM.

[0056] 2.7 Biological control test on pepper fruit

[0057] Select peppers that are disease-free, wound-free, and have basically the same maturity and size. Soak them in a 2% sodium hypochlorite solution for 5 minutes, rinse them three times with sterile water, and dry them naturally for later use. Use a sterile puncher to make a wound with a diameter of 5mm and a depth of 1mm on the waist of the fruit, and inoculate the wound with Trichoderma biocontrol bacteria cakes. Place absorbent paper soaked with sterile water on the wound, and then put the fruit into a sterilized plastic basin covered with film to keep warm and moisturizing. After culturing at room temperature for 24 hours, remove the Trichoderma cake, and then inoculate the Phytophthora cake into the wound for continued cultivation. Observe and take pictures every day, record the length of the disease on the 4th day, and repeat each treatment 3 times. The Phytophthora treatment is used as a positive control, and the sterile water treatment is used as a negative control. The inhibition rate calculation method is the same as 2.3.

[0058] 2.8 Preparation of Trichoderma fermentation broth

[0059] After activating 5 strains of Trichoderma on a PDA plate at 28°C for 5 days, a hole was punched at the edge of the colony with a 5mm radius puncher. Five Trichoderma blocks were placed in a conical flask filled with 100mL potato dextrose liquid medium (PDB), placed in a shaker at 180r / min, 28°C, and taken out of the conical flask after 7 days, filtered with 8 layers of sterile gauze, and the filtrate was filtered with a sterile syringe and a sterile 0.22μm filter membrane to obtain a sterile fermentation filtrate.

[0060] 2.9 Experiment on inhibition of Phytophthora by Trichoderma fermentation broth

[0061] Obtain the fermentation filtrate according to the method in 2.8, mix the fermentation filtrate at a volume ratio of (fermentation broth: PDA) = 1:3, pour into a 20mL sterile culture dish, and make a plate. Inoculate the center of the plate with fresh fungus cake (diameter 0.5cm) of Phytophthora, and use an equal volume PDA plate without adding fermentation broth as the control. Repeat each treatment 3 times. Place the inoculated plate in a 28℃ incubator for dark culture. After 4 days, measure the colony diameter of each treatment by the cross method, and calculate the inhibition rate. The calculation method is the same as 2.3.

[0062] 2.10 Experiment on promoting pepper growth by Trichoderma fermentation broth

[0063] The growth-promoting effect of antagonistic bacteria was determined by seed germination experiments. Healthy pepper seeds of uniform size were selected, and the seeds were sterilized with 5% NaClO for 5 minutes, rinsed with sterile water, and dried with sterile filter paper. The pepper seeds were placed in a 5-fold diluted volume of fermentation liquid (obtained according to method 2.8). After 24 hours, the seeds were evenly placed in a germination box with double-layer sterile germination paper, 50 seeds per dish, 3 replicates, and cultured at 28°C for 10 days. Sterile water was used as the control group, and the seed germination potential, germination rate, fresh weight, hypocotyl radicle length, and germination index were counted.

[0064] Germination rate (%) = number of seeds germinated in 10 days / total number of seeds (1);

[0065] Germination potential (%) = number of seeds germinated in 5 days / total number of seeds*100% (1);

[0066]

[0067] Gt is the number of germinations per day, Dt is the number of germination days, and ∑ is the total.

[0068] 2.10 IAA production by Trichoderma

[0069] In order to determine the production of IAA in the six isolated Trichoderma species, the six Trichoderma strains were activated on a PDA plate at 28°C for 5 days, and then a hole was punched at the edge of the colony with a 5 mm radius puncher. Five Trichoderma blocks were placed in 100 ml of potato dextrose broth medium, and the oscillator was grown at 28°C at a speed of 180 rpm / min. After 7 days, the conical flask was taken out and the culture was filtered with 8 layers of sterile gauze. The concentration of IAA produced by Trichoderma was determined by Salkowski reagent (Zhang, S.; Gan, Y.; Xu, B. Mechanisms of the Iaa and Acc-Deaminase Producing Strain of Trichoderma Longibrachiatum T6 in Enhancing Wheat Seedling Tolerance to Nacl Stress. BMC plant biology, 2019, 19 (1): 22.). The concentration of IAA was determined by comparing with the standard curve prepared in the IAA standard curve.

[0070] 2.11 Data Analysis

[0071] Excel 2019 was used for data statistics. SPSS 25 was used for one-way analysis of variance. Duncan's multiple comparisons were used to analyze the significance of differences, and P < 0.05 indicated a significant difference. Origin 9.1 software was used for graphics.

[0072] 3. Results

[0073] 3.1 In vitro antagonistic activity of biocontrol agents against Phytophthora capsici

[0074] The antagonistic activity of the isolated strains against Phytophthora was evaluated by plate confrontation test. Among the 60 isolated strains, 6 biocontrol strains had high antagonistic ability, and these 6 biocontrol strains were used for dual culture test. The pepper Phytophthora strains in the control group grew uniformly radially on PDA ( Figure 1a). In the Trichoderma treatment group, the hyphae of Phytophthora were inhibited by the biocontrol bacteria, and the colony stopped expanding, while Trichoderma continued to grow forward until it completely covered the Phytophthora colony and the entire plate ( Figure 1 b), the results showed that the inhibition rate of these five biocontrol bacteria on Phytophthora was more than 70% ( Figure 1 d), among which strain 6311 had the strongest antagonistic effect on Phytophthora hyphae (82.22%±0.01). To explore the mechanism of biocontrol bacteria antagonism against Phytophthora, optical microscopy and scanning electron microscopy (SEM) showed that the hyphae of biocontrol bacteria entangled and parasitized the hyphae of Phytophthora hyphae. They grew along the hyphae of Phytophthora, with a large number of branches entwined around the hyphae of Phytophthora hyphae. The extensive deformation of Phytophthora indicated that its hyphae was invaded by 6311 ( Figure 1 c, e).

[0075] 3.2 Identification of biocontrol bacteria

[0076] like Figure 2 As shown in the figure, at 28℃, after 5 days of culture, the biocontrol bacteria have covered the entire PDA plate. At the same time, conidia were observed in the culture medium. 6311 has well-developed aerial mycelium on the PDA plate, and the colonies are fluffy to felt-like, white, thick and fluffy, with protrusions and obvious concentric circles. After 5 days, the PDA plate is covered with a large number of dark green or yellow-green spores, and the back is yellow-brown. The fungal colonies of 7111 are white and light green, and turn dark green after 5 days.

[0077] The ITS sequence obtained from fungal isolate 6311 was deposited in the GenBank database with the accession number SUB144343276311PP770685. Molecular identification of the isolates by ITS4 and ITS5 showed that they were Trichoderma harzianum, Trichoderma breviscompactum and Trichoderma virens, respectively. Amplification of the internal transcribed spacer (ITS) region with primers ITS4 and ITS5 and BlastN search showed 100% identity with T. brevicompactum (KR094463.1) in NCBI GenBank.

[0078] 3.3 Effect of in vitro fruit protection

[0079] In order to study the potential of different Trichoderma for biological control of Phytophthora on postharvest pepper fruits, the pepper fruits were inoculated with Trichoderma, and the Trichoderma cake was removed after 24 hours and inoculated with Phytophthora cake. After 5 days, it was observed that there was no mycelial growth in the CK group. Compared with the mycelial diameter (7.43±0.05cm) on pepper fruits in the Phytophthora treatment group, the diameters of the six Trichoderma treatment groups were reduced, indicating that Trichoderma had an inhibitory effect on Phytophthora on pepper fruits ( Figure 3 ). Among them, the average diameter of the strains on the pepper fruits of the 6311 treatment group was 5.23±0.13cm. The inhibition rate was about 29% ( Figure 3 ).

[0080] 3.4 Trichoderma growth promotion and control effect

[0081] Observe the color changes of the five strains of Trichoderma on the double-layer plates and find that the plate color of the 6311 treatment group is the darkest ( Figure 4 a), indicating the highest level of iron carriers; among the relative concentration indicators of iron carriers produced by different Trichoderma strains, the relative concentration of iron carriers of Trichoderma brevisdens 6311 was the highest (72.88%) ( Figure 4 b), followed by 7111 (50.47%). In contrast, 5111 and 6321 produced only a small amount of siderophore, with relative concentrations of 33.36 and 8.54%, respectively, while no siderophore was detected in Trichoderma harzianum 2221.

[0082] In the fermentation broth inhibition experiment, the five strains of Trichoderma had different abilities to inhibit the growth of Phytophthora mycelium ( Figure 5 ). Among them, compared with the group treated with Phytophthora ( Figure 5 b), 5111 and 6311( Figure 5 The fermentation broth of strain a) had an inhibition rate of 100% on the mycelial growth of Phytophthora. The fermentation broth of strains 6321 and 7111 also significantly reduced the mycelial growth of Phytophthora, with inhibition rates of 69.72 and 27.52%. In contrast, the effect of the 2221 treatment group was much weaker, with an inhibition rate of only 4.59% ( Figure 5 c).

[0083] According to the fermentation broth growth promotion test, we found that the fermentation broth of 6 types of Trichoderma has a promoting effect on various growth indicators of seeds. In all Trichoderma treatment groups, the germination potential (40.67-57.33%) and germination rate (90.67-98.67%) of pepper seeds were greater than the germination rate (86.67%) and germination potential (38.00%) of the control group. Among them, 6311 had the best growth promotion effect, with germination potential and germination rate reaching 55.33% and 94.67%. Subsequently, the effects of different Trichoderma on the growth of radicles and hypocotyls of pepper seedlings were observed. The results showed that the fermentation broth of all Trichoderma had a significant growth-promoting effect on radicles and hypocotyls. Among them, the fermentation broth of 6311 had the best effect. Compared with the radicles (1.25±0.46cm) and hypocotyls (1.54±0.72cm) of the control group, the radicles and hypocotyls in the 6311 treatment group increased by 2.45 times and 2.21 times ( Figure 6 ). In the germination index, the germination index of the six Trichoderma treatment groups was much higher than that of the CK group (15%), of which 6311 was 42.62%. At the same time, the fermentation liquid of 6311 affected the fresh weight of pepper seedlings ( Figure 6 ), and the fresh weight of the 6311 treatment group increased by 42.86% compared with the CK group. The experiment showed that the Trichoderma fermentation liquid group improved the physiological indicators of pepper seedlings, among which Trichoderma brevisdens 6311 had a significant growth-promoting function.

[0084] 4 Discussion

[0085] Phytophthora is one of the most famous pathogens of fungal diseases, which has a serious negative impact on global crop yields, especially on peppers. Chemical fungicides seriously threaten human health and environmental safety. With the requirement of sustainable agricultural development, biological control is considered to be an environmentally friendly and economical alternative to fungicides. Trichoderma is a biological control fungus that has been found all over the world. Trichoderma has great practical value and potential in the field of biological plant disease control. The ability of Trichoderma to control plant diseases is being studied all over the world. Studies have shown that Trichoderma can effectively inhibit about 30 plant pathogenic fungi including Phytophthora. The present invention isolated 60 strains from pepper rhizosphere soil collected from 4 sampling points in Hebei Province, China, and isolated 5 biocontrol bacteria with strong antagonistic activity against Phytophthora through dual culture experiments, among which Trichoderma brevisdens 6311 has the highest inhibition percentage value on the growth of Phytophthora hyphae, reaching 82.22%, and the inhibition rate of the remaining 5 Trichoderma on Phytophthora hyphae is also more than 70%. Five strains of Trichoderma were identified by morphology and molecular methods. Among the five strains, two were T.harzianum, three were T.brevicompactum, and one was T.virens. Fungal parasitism is a key biocontrol measure for Trichoderma. Trichoderma can parasitize 18 different microorganisms such as Pythium, Phytophthora, and Rhizobium. They can invade or damage the mycelium, causing the pathogen cells to enlarge, twist, and rupture. We observed the mycelium of pathogenic fungi from the boundary of the inhibition zone using optical microscopy and scanning electron microscopy. The results showed that Trichoderma 6311 had a heavy parasitic effect on the mycelium of pepper Phytophthora, indicating that Trichoderma may attack the cell wall / cell membrane and inhibit the growth of Phytophthora mycelium by producing antifungal substances and competing for space and nutrients. In the fruit experiment, the reduction in the growth diameter of the mycelium also showed the ability of Trichoderma to inhibit the mycelium of Phytophthora, among which 6311 had the most significant inhibition rate, at 29%.

[0086] According to previous reports, Trichoderma produces a variety of compounds with antagonistic properties, including a series of enzymes and metabolites, such as cellulase, xylanase, pectinase and chitinase, and the fermentation broth can be used to study the antagonistic ability of Trichoderma metabolites. The fermentation broth of Trichoderma can cause pathogenic hyphae to be deformed, swollen, fragmented and twisted. The present invention found that the fermentation broth of Trichoderma brevis 6311 can inhibit the growth of Phytophthora hyphae, and the inhibition rate reached 100%, which is a result that has not appeared before. At the same time, Trichoderma can produce growth hormone IAA, siderophore and other plant growth promoting substances. In the present invention, it was detected that Trichoderma brevis 6311 can produce siderophore, and compared with the other 5 strains, it has the strongest ability to produce siderophore, indicating its potential to inhibit pathogens. At the same time, the present invention found for the first time that the fermentation broth inoculated with Trichoderma can significantly promote the development of pepper seedlings, among which Trichoderma brevis 6311 can significantly improve the radicle hypocotyl ( Figure 6 ), fresh weight( Figure 6 ), germination rate( Figure 6 ), 5-day germination index ( Figure 6 ), which is a new discovery that no one has explored before. This is related to previous studies reporting that Trichoderma can promote the growth of bitter melon, clove, Panax notoginseng, bayberry and tomato seedlings.

[0087] 5 Conclusion

[0088] In summary, the present invention isolated Trichoderma brevis 6311 from the rhizosphere soil of pepper, and proved that it can produce siderophores, secrete antibacterial substances and heavy parasitism to inhibit Phytophthora, and 6311 can also inhibit the growth of Phytophthora hyphae on fruits, and its secreted IAA and metabolites can promote the growth of pepper seedlings and inhibit pepper Phytophthora hyphae, thereby improving the disease resistance of pepper seedlings. The present invention provides a potential biological control agent for the biological control of pepper wilt, and provides a possible perspective for understanding the interaction mechanism between biological control agents and pathogens.

[0089] SEQ ID NO.1: Gene sequence of Trichoderma brevis 6311

[0090] TGGAAGTAAAAAAGCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATTTCTGCCCCGGGCGCGTCGCAGCCCCGGACCAAGGCGCCCGCCG GAGGACCAATTTACAAACTCTTTTGTATATCCCATCGCGGATTCTTTACATTCTGAGCTTTCTCGGCGCTCCTAGCGAGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGT AATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCACTTACCTGCCGGCCCCGAAATACA GTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCACCGGGAGCGCGGCGCGTCCACGGCCGTAAAACAACCCAAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAAAGGGGGGAGGGAA

[0091] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will appreciate that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. A strain of Trichoderma brevisdens 6311 having biological control capability against Phytophthora capsici, characterized in that: Its name is: 6311, the classification name is: Trichoderma brevicompactum, the preservation number is: CGMCC No.41489, the preservation date is: August 13, 2024, and the preservation unit is: General Microbiology Center of China Microbiological Culture Collection Administration, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

2. The Trichoderma brevis 6311 according to claim 1, characterized in that: The colony and bacterial characteristics of the strain are as follows: on the PDA plate, the aerial mycelium is well developed, the colony is villi-like to felt-like, white, thick and fluffy, with protrusions, and in obvious concentric circles. After 5 days, the PDA plate is covered with a large number of dark green or yellow-green spores, and the back is yellow-brown.

3. The Trichoderma brevis 6311 according to claim 1, characterized in that: The strain has biological control potential.

4. The Trichoderma brevis 6311 according to any one of claims 1 to 3, characterized in that: The fermentation liquid of Trichoderma brevis 6311 can inhibit the growth of Phytophthora mycelium, and the inhibition rate reaches 100%; The short dense Trichoderma 6311 has a heavy parasitic effect on pepper phytophthora; 6311 has the highest activity in the iron carrier experiment and can produce the growth hormone IAA with an output of 14.56 mg / L, indicating that 6311 has the potential to inhibit disease and promote growth; in the in vitro fruit test, 6311 has an inhibitory effect on the growth of phytophthora on pepper fruits; at the same time, the fermentation liquid of Trichoderma 6311 has the ability to inhibit the growth of phytophthora hyphae on the plate, and the inhibition rate reaches 100%. The pepper seeds soaked in the fermentation liquid of 6311 have improved germination rate, radicle hypocotyl length, growth index and fresh weight.

5. Use of the Trichoderma brevisdens 6311 as claimed in any one of claims 1 to 4 in the preparation of a biocontrol agent for Phytophthora capsici.

Images