Molecular marker related to length of hypocotyl of Chinese cabbage and application of molecular marker
The use of PCR primer pairs to identify and screen hypocotyl length in Chinese cabbage solved the problem of a lack of long hypocotyl materials, enabling rapid and accurate breeding screening, improving breeding efficiency, and adapting to mechanized production.
Patent Information
- Application Number
- CN202511320213.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-16
- Publication Date
- 2025-12-16
AI Technical Summary
The current lack of long hypocotyl materials in Chinese cabbage breeding leads to high losses during mechanized harvesting and makes it difficult to guarantee marketability. Traditional breeding methods are also unable to quickly screen out varieties with long and robust hypocotyls.
We provide molecular markers related to hypocotyl length in Chinese cabbage, amplify Chinese cabbage genomic DNA using PCR primer pairs (forward and reverse primers), identify hypocotyl length using PCR product type, and design highly specific and stable molecular markers for breeding assistance.
It enables rapid and accurate screening of long hypocotyl Chinese cabbage, improves breeding efficiency, adapts to the needs of mechanized production, and simplifies the breeding process.
Smart Images

Figure BDA0005598260540000051 
Figure BDA0005598260540000061 
Figure BDA0005598260540000071
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to molecular markers related to the hypocotyl length of Chinese cabbage and their applications. Background Technology
[0002] Rising labor costs are constantly squeezing farmers' profit margins, and the vegetable industry is facing a crisis of declining comparative benefits. Full mechanization is an inevitable trend for the development of the vegetable industry. Low comparative benefits are the main limiting factor for large-scale cabbage production, making the development and breeding of crop varieties suitable for mechanized production and harvesting crucial. Therefore, breeding cabbage varieties suitable for simplified, intensive, and mechanized production has become an important breeding goal.
[0003] The development of the hypocotyl is directly related to plant morphogenesis. To prevent seedlings from being easily damped off, traditional Chinese cabbage breeding often selects varieties with short hypocotyls. As a result, the hypocotyls of currently cultivated Chinese cabbage and fast-growing bok choy varieties tend to be short, leading to high losses during mechanized harvesting and difficulty in guaranteeing marketability. Mechanized harvesting requires Chinese cabbage varieties with long and robust hypocotyls and upright plants. However, long-term breeding selection has resulted in a growing scarcity of materials with long hypocotyls. Therefore, cultivating Chinese cabbage with long and robust hypocotyls is one of the important target traits in Chinese cabbage breeding. Summary of the Invention
[0004] To quickly screen Chinese cabbage with long hypocotyls, this invention first provides molecular markers related to the hypocotyl length of Chinese cabbage.
[0005] To address the aforementioned technical problems, this invention first provides the application of molecular markers related to the hypocotyl length of Chinese cabbage, or substances that detect molecular markers related to the hypocotyl length of Chinese cabbage, in the identification or auxiliary identification of the hypocotyl length of Chinese cabbage. The molecular marker related to the hypocotyl length of Chinese cabbage (abbreviated as 52) refers to the sequence segment difference between positions 49-420 of SEQ ID No. 1 and positions 49-155 of SEQ ID No. 2.
[0006] In the above applications, the substance used to detect the molecular markers related to the hypocotyl length of the Chinese cabbage may contain PCR primers that amplify genomic DNA fragments of Chinese cabbage containing the molecular markers related to the hypocotyl length of the Chinese cabbage.
[0007] Furthermore, the PCR primers may be primer pairs, which consist of a forward primer and a reverse primer. The forward primer is a single-stranded DNA that specifically binds upstream of the double-stranded DNA shown in positions 49-420 of SEQ ID No. 1 or positions 49-155 of SEQ ID No. 2 in the genomic DNA of Chinese cabbage. The reverse primer is a single-stranded DNA that specifically binds downstream of the double-stranded DNA shown in positions 49-420 of SEQ ID No. 2 or positions 49-155 of SEQ ID No. 2 in the genomic DNA of Chinese cabbage.
[0008] Furthermore, the forward primer may specifically be a single-stranded DNA with a sequence as shown in SEQ ID No. 3, and the reverse primer may specifically be a single-stranded DNA with a sequence as shown in SEQ ID No. 4.
[0009] This invention also provides a method for identifying or assisting in the identification of the hypocotyl length of Chinese cabbage, comprising the following steps:
[0010] (1) Using the genomic DNA of the Chinese cabbage material to be identified as a template, PCR amplification was performed using the primer pair to obtain PCR products;
[0011] (2) Identify the hypocotyl length of Chinese cabbage based on the type of PCR product:
[0012] If the PCR product is only a DNA fragment of 477 bp in length (between 250 bp and 500 bp), then its type is aa;
[0013] If the PCR product is only a DNA fragment of 212 bp in length (between 100 bp and 250 bp), then its type is AA;
[0014] The PCR product containing both a 477bp DNA fragment (between 250bp and 500bp) and a 212bp DNA fragment (between 100bp and 250bp) is classified as type Aa.
[0015] The hypocotyl length of the Chinese cabbage to be identified, in which the PCR product type is aa, is longer than or can be longer than that of the Chinese cabbage to be identified, in which the PCR product type is Aa or AA.
[0016] The hypocotyl length of the Chinese cabbage to be identified, in which the PCR product is of type Aa, is longer than or candidate to be longer than that of the Chinese cabbage to be identified, in which the PCR product is of type AA.
[0017] Furthermore, the PCR amplification program can be as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 sec, 58℃ annealing for 15 sec, 72℃ extension for 30 sec; 72℃ final extension for 5 min.
[0018] The molecular markers related to the hypocotyl length of Chinese cabbage are also within the scope of protection of this invention.
[0019] This invention also provides the application of substances that detect molecular markers related to hypocotyl length in Chinese cabbage in the analysis of Chinese cabbage germplasm resources or molecular marker-assisted breeding.
[0020] The goal of the breeding program may be to select varieties with longer hypocotyls to adapt to mechanized production.
[0021] The breeding objective can also be to select varieties with shorter hypocotyls to meet consumer preferences.
[0022] This invention also provides the application of PCR primers containing molecular markers related to the hypocotyl length of the Chinese cabbage in the analysis of Chinese cabbage germplasm resources or molecular marker-assisted breeding.
[0023] In this invention, the cabbage can be a hybrid offspring of a long hypocotyl inbred line R31 and a short hypocotyl inbred line R32. The hybrid offspring can be F1, F2, or higher generations, or BC1F2, etc.
[0024] Experiments have shown that this invention has the following advantages compared with the prior art:
[0025] (1) The molecular markers related to the hypocotyl length of Chinese cabbage in this invention have high accuracy and good stability. They are simple, convenient, economical and efficient to detect and do not require complex steps such as enzyme digestion. The polymorphism of the molecular markers related to the hypocotyl length of Chinese cabbage in this invention is directly expressed in the form of DNA. They can be detected in various tissues and developmental stages of Chinese cabbage. They can be screened in the seedling stage of Chinese cabbage, which accelerates the selection and breeding process of Chinese cabbage.
[0026] (2) The molecular marker primer pair related to the hypocotyl length of Chinese cabbage in this invention has stable amplification products, strong specificity, and high sensitivity in the identification process. It can be widely used in the analysis of Chinese cabbage germplasm resources and / or molecular assisted genetic breeding. Attached Figure Description
[0027] Figure 1 This is a partial single-plant locus typing electrophoresis image of the F2 population in Example 1 of this application.
[0028] Figure 2 This is a correlation diagram between genotype and hypocotyl length of 365 individual plants from the F2 population in Example 1 of this application. In the diagram, * represents a significance analysis result of P<0.05, and *** represents a significance analysis result of P<0.001. Detailed Implementation
[0029] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0030] In the quantitative experiments described below, three replicate experiments were conducted, and the average value of the results was taken.
[0031] Unless otherwise specified, the experimental methods described in the following examples are conventional methods.
[0032] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0033] The long hypocotyledonous Chinese cabbage inbred line R31 described in the following examples is described in non-patent literature “Wang, J., Zheng, M., Su, T., Zhang, B., Ma, T., Liu, X., ... & Yu, S. (2025). BrHDA6 mediates non-histone deacetylation of BrSOT12 to positively regulate downy mildewresistance in Brassica rapa. Horticulture Research, uhaf136.” (see line 184 in the text), which is available to the public from the applicant to repeat the experiments of the present invention.
[0034] The short hypocotyl Chinese cabbage inbred line R32 described in the following examples is described in non-patent literature “Wang, J., Zheng, M., Su, T., Zhang, B., Ma, T., Liu, X., ... & Yu, S. (2025). BrHDA6 mediates non-histone deacetylation of BrSOT12 to positively regulate downy mildewresistance in Brassica rapa. Horticulture Research, uhaf136.” (see line 184 in the text), which is available to the public from the applicant for repeating the experiments of the present invention.
[0035] Example 1
[0036] 1. Obtaining molecular markers
[0037] The experimental materials were the long hypocotyl inbred line R31 and the short hypocotyl inbred line R32, which were independently bred by the Chinese cabbage genetics and breeding research group of the Vegetable Research Institute of Beijing Academy of Agricultural and Forestry Sciences, as well as the F1 population constructed with them and the F2 segregating population (containing 997 individual plants) obtained by self-pollination of F1.
[0038] The experiment was conducted in a greenhouse at the Vegetable Research Institute of the Beijing Academy of Agricultural and Forestry Sciences in 2021. The planting process was as follows: seedlings were raised in plug trays after germination, and the hypocotyl length of the parent plants and the entire population was measured on the 10th day after sowing.
[0039] The results showed that, according to field surveys, among the 997 individual plants in the F2 segregating population, the distribution ratio of short hypocotyl (hypocotyl length ≤ 1.5 cm): intermediate type (hypocotyl length > 1.5 cm, < 2.5 cm): long hypocotyl (hypocotyl length ≥ 2.5 cm) was 265:519:213, consistent with a single-gene incomplete dominance segregation ratio of 1:2:1. (χ²) 2 =3.74, P>0.05). The above results indicate that the hypocotyl length in Chinese cabbage is controlled by a pair of incompletely dominant genes.
[0040] QTL mapping was used to identify key QTL regions controlling hypocotyl elongation in Chinese cabbage, and candidate genes were identified within these regions. Based on sequence differences of these candidate genes between long and short-length materials, relevant molecular markers were developed.
[0041] This invention relates to a molecular marker called 52 associated with the hypocotyl of Chinese cabbage. This molecular marker is located on chromosome A02 of Chinese cabbage, specifically at position 7309207 on chromosome A02, upstream of the BraHB52 promoter.
[0042] 2. Detection methods for molecular markers
[0043] For the molecular marker named 52, a PCR primer pair consisting of upstream primer F and downstream primer R was designed.
[0044] F: 5'-CTAGTCCAGTAGTCCTAGTTCA-3' (as shown in SEQ ID No. 3, the sequence of positions 1-22 is the same as that of SEQ ID No. 1, and the sequence of positions 1-22 is the same as that of SEQ ID No. 2);
[0045] R: 5'-GGAAGTGCTTTAAACTACC-3' (as shown in SEQ ID No. 4, it is the reverse complementary sequence of positions 459-477 of SEQ ID No. 1 and the reverse complementary sequence of positions 194-212 of SEQ ID No. 2).
[0046] The 477bp sequence obtained by PCR amplification is shown in SEQ ID No. 1, and the 212bp sequence obtained by amplification is shown in SEQ ID No. 2. The difference between the two sequences is positions 49-420 of SEQ ID No. 1 and positions 49-155 of SEQ ID No. 2.
[0047] SEQ ID No.1
[0048] CTAGTCCAGTAGTCCTAGTTCATTCTTTTGAATAGTAAGTGGGTCCATAAAGAACAGTTAGTTGGGCTTTGGGCCCCAAAGCTTTGATTCTTGTTGGTTTCACACCTCCATCTTGTGTTCTATCCATTTTTTTTCTCTATTTCTCCCATAATTTAAGATTTTTCAAACCAGAAACTTCATTTGTGGAAGCACCGTAGCCTATTGGTTAAGATTTAAAAACTTCTACACTCAGATCTTGG GTTCAAATCCCAGACTATGCAATTTATTACAGATTACAGGAAATCCAGGTTTCAAGTCCCGGAGAGAGCGGTTTATTACTGCAGAGCGGTTTATTGCAGAGGAGACATGTAGTATTGTCGGTTGTCGAATCGTCTATGTAATATTTCCTATATCATAATTGTAAGATCATAATAAATCAGCGTTAAAAAAAAACAAAAAACTTCACTTGTACAAAGTTATTAACAACAAAATTTTGGTAGTTTAAAGCACTTCC
[0049] SEQ ID No.2
[0050] CTAGTCCAGTAGTCCTAGTTCATTCTTTTGAATAGTAAGTGGGTCCATTGGGCTTTGGGCCCCAAAGCTTTGATTCTTGTTGGTTTCACACCTCCATCTTGTGTTCTATCCATTTTTTTTCTCTATTTTCCCATAATTTAAGATTTTTTAAACAAGAAACTTCACTTGTACAAAGTTATTAACAACAAAATTTTGGTAGTTTAAAGCACTTCC
[0051] The specific steps for identifying and assisting in the identification of hypocotyl length in Chinese cabbage using the aforementioned molecular marker 52 are as follows:
[0052] DNA was extracted from each Chinese cabbage sample using the CTAB method. The purity and integrity of the DNA in each sample were analyzed by agarose gel electrophoresis. The purity requirement was OD. 260 / 280 Between 1.8 and 2.0, DNA concentration >20 ng / μL.
[0053] Using DNA from various Chinese cabbage samples as templates, PCR amplification was performed using the primer pair F and R described above. The 20 μL reaction system included 0.25 μM upstream primer F, 0.25 μM downstream primer R, 10 μL of 2×Taq enzyme mix, 100 ng of DNA template, and ddH2O to bring the total volume to 20 μL. The reaction program was as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 sec, 58℃ annealing for 15 sec, 72℃ extension for 30 sec, and 72℃ final extension for 5 min.
[0054] The PCR products were identified by agarose gel electrophoresis, with the agarose gel concentration being 1%.
[0055] A homozygous genotype of Chinese cabbage with an amplification product consisting of only a 477bp DNA fragment (DNA band) (between 250bp and 500bp) is called aa, and is expected to exhibit a long hypocotyl; a homozygous genotype of Chinese cabbage with an amplification product consisting of only a 212bp DNA fragment (DNA band) (between 100bp and 250bp) is called AA, and is expected to exhibit a short hypocotyl; a heterozygous genotype of Chinese cabbage with an amplification product consisting of a 477bp DNA fragment (DNA band) (between 250bp and 500bp) and a 212bp DNA fragment (DNA band) (between 100bp and 250bp) is called Aa, and is expected to exhibit a medium-length hypocotyl.
[0056] 3. Validation of the effectiveness of molecular marker detection
[0057] In the F2 population of the Chinese cabbage group whose hypocotyl length had been investigated in the field, 365 materials were randomly selected for molecular marker detection. The results are shown in Table 1 and 2. Figure 1 :
[0058] Table 1. Molecular marker detection results and hypocotyl length of the F2 population.
[0059]
[0060]
[0061]
[0062]
[0063] Table 1 shows that genotype segregation occurred in the F2 population at the aforementioned points. Correlation analysis between genotype and hypocotyl length is shown in the table below. Figure 2 This indicates that the average hypocotyl length of a single plant with genotype aa is longer than that of Aa, and the average hypocotyl length of a single plant with genotype Aa is longer than that of AA, meaning that the locus 52 is linked to hypocotyl length.
[0064] In summary, the molecular markers of this invention can be used to assist breeding, accelerate the breeding process of new Chinese cabbage varieties with long hypocotyls, and significantly improve breeding efficiency.
[0065] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. The application of molecular markers related to the hypocotyl length of Chinese cabbage, or substances that detect molecular markers related to the hypocotyl length of Chinese cabbage, in the identification or auxiliary identification of the hypocotyl length of Chinese cabbage, characterized in that: The molecular marker related to the hypocotyl length of Chinese cabbage refers to the sequence difference between positions 49-420 of SEQ ID No. 1 and positions 49-155 of SEQ ID No.
2.
2. The application according to claim 1, characterized in that, The substance used to detect the molecular markers related to the hypocotyl length of the Chinese cabbage may contain PCR primers that amplify genomic DNA fragments of Chinese cabbage containing the molecular markers related to the hypocotyl length of the Chinese cabbage.
3. The application according to claim 2, characterized in that, The PCR primers are primer pairs, each consisting of a forward primer and a reverse primer. The forward primer is a single-stranded DNA that specifically binds upstream of the double-stranded DNA shown in positions 49-420 of SEQ ID No. 1 or positions 49-155 of SEQ ID No. 2 in the genomic DNA of Chinese cabbage. The reverse primer is a single-stranded DNA that specifically binds downstream of the double-stranded DNA shown in positions 49-420 of SEQ ID No. 2 or positions 49-155 of SEQ ID No. 2 in the genomic DNA of Chinese cabbage.
4. The application according to claim 3, characterized in that, The forward primer is a single-stranded DNA with the sequence shown in SEQ ID No. 3, and the reverse primer is a single-stranded DNA with the sequence shown in SEQ ID No.
4.
5. A method for identifying or assisting in the identification of the hypocotyl length of Chinese cabbage, characterized in that, Includes the following steps: (1) Using the genomic DNA of the Chinese cabbage material to be identified as a template, PCR amplification was performed using any of the primer pairs described in claims 3-4 to obtain PCR products; (2) Identify the hypocotyl length of Chinese cabbage based on the type of PCR product: If the PCR product consists of only a 477bp DNA fragment, its type is aa. If the PCR product consists of only a 212bp DNA fragment, then its type is AA; If the PCR product contains both a 477bp DNA fragment and a 212bp DNA fragment, then its type is Aa. The hypocotyl length of the Chinese cabbage to be identified, in which the PCR product type is aa, is longer than or can be longer than that of the Chinese cabbage to be identified, in which the PCR product type is Aa or AA. The hypocotyl length of the Chinese cabbage to be identified, in which the PCR product is of type Aa, is longer than or candidate to be longer than that of the Chinese cabbage to be identified, in which the PCR product is of type AA.
6. The method according to claim 5, characterized in that, The PCR amplification program is as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 sec, 58℃ annealing for 15 sec, 72℃ extension for 30 sec; 72℃ final extension for 5 min.
7. The molecular marker related to the hypocotyl length of Chinese cabbage as described in claim 1.
8. The application of the molecular markers related to hypocotyl length of Chinese cabbage as described in claim 1 in the analysis of Chinese cabbage germplasm resources or molecular marker-assisted breeding.
9. The application of the primers described in any one of claims 2-4 in the analysis of Chinese cabbage germplasm resources or in molecular marker-assisted breeding.