Recombinant microorganisms expressing saccharifying enzyme and lysophospholipase simultaneously and construction method and application thereof

Abstract

The present invention belongs to the field of microorganisms, and specifically relates to a recombinant microorganism that simultaneously expresses a saccharifying enzyme and a lysophospholipase, and a construction method and application thereof. The recombinant microorganism contains a coding gene for a saccharifying enzyme and a coding gene for a lysophospholipase; wherein the expression of the lysophospholipase is driven by a gpdA promoter, a tpi promoter or a trpC promoter derived from Aspergillus nidulans. The present invention finds that by optimizing the promoter that drives the expression of the lysophospholipase, the expression amount of the lysophospholipase can be significantly increased in the recombinant microorganism that simultaneously expresses the saccharifying enzyme and the lysophospholipase, and when it is applied to the starch saccharification process, the starch saccharification hydrolyzate filtration speed can be significantly increased, which is of great significance for reducing the production cost and simplifying the production process in the industrial production of starch sugar.

Description

[0001] Cross-reference information

[0002] This application claims priority to Chinese patent application No. 2023118461162 filed on December 28, 2023, the entire contents of which are incorporated herein by reference. Technical Field

[0003] The invention belongs to the field of microorganisms, and in particular relates to a recombinant microorganism that simultaneously expresses saccharifying enzyme and lysophospholipase, and a construction method and application thereof. Background Art

[0004] Glucoamylase (EC.3.2.1.3), also known as glucoamylase, is one of the earliest important enzymes to be industrialized, and is still one of the most widely used and largest-yield enzyme preparations to date. It is widely used in food, medicine, fermentation and other industries, has high application value, and is highly valued by scholars at home and abroad.

[0005] Commercially, saccharifying enzymes are used to convert corn starch that has been partially hydrolyzed with α-amylase into glucose. The most commonly used saccharifying enzymes are those derived from Talaromyces emersonii and Aspergillus niger.

[0006] When saccharifying enzymes are used in starch sugar processing, when corn raw materials are deteriorated or wheat is used as raw materials, more phospholipids will be contained. These substances have emulsifying properties, which usually make it difficult to filter the hydrolyzed starch syrup, and additional lysophospholipase needs to be added to improve the filtration speed.

[0007] After being hydrolyzed by phospholipase A1 (PLA1), phospholipase A2 (PLA2), phospholipase B (PLB), etc., phospholipids become hydrolyzed phospholipids, also known as lysophospholipids. Lysophospholipase (EC 3.1.1.5) not only has the activity of phospholipase B, but also can specifically decompose the ester bonds of lysophospholipids and remove fatty acid chains. When the phospholipid content in the syrup raw material increases, the addition of lysophospholipase can destroy the inherent emulsification ability of lysophospholipids, effectively improve the vacuum drum filtration speed of the syrup and the clarity of the filtered syrup. However, the additional addition of lysophospholipase in the starch sugar processing process is bound to increase production costs and make the production process more complicated. Therefore, it is of great significance to simplify the starch sugar production process and reduce production costs. Summary of the invention

[0008] The first object of the present invention is to provide a recombinant microorganism, which contains: a gene encoding a saccharifying enzyme; and a gene encoding a lysophospholipase; wherein the expression of the lysophospholipase is driven by a gpdA promoter, a tpi promoter or a trpC promoter derived from Aspergillus nidulans.

[0009] As a preferred embodiment, the expression of the lysophospholipase is driven by the trpC promoter derived from Aspergillus nidulans.

[0010] As a preferred embodiment, the gpdA promoter derived from Aspergillus nidulans comprises the nucleotide sequence shown in SEQ ID No.12, or comprises a nucleotide sequence having at least 90% homology to the sequence shown in SEQ ID No.12; the tpi promoter derived from Aspergillus nidulans comprises the nucleotide sequence shown in SEQ ID No.13, or comprises a nucleotide sequence having at least 90% homology to the sequence shown in SEQ ID No.13; the trpC promoter derived from Aspergillus nidulans comprises the nucleotide sequence shown in SEQ ID No.14, or comprises a nucleotide sequence having at least 90% homology to the sequence shown in SEQ ID No.14.

[0011] As a preferred embodiment, the lysophospholipase is derived from Aspergillus niger.

[0012] As a preferred embodiment, the lysophospholipase comprises an amino acid sequence as shown in SEQ ID No.11, or comprises an amino acid sequence having at least 90% homology with the sequence shown in SEQ ID No.11.

[0013] As a preferred embodiment, the gene encoding the lysophospholipase comprises the nucleotide sequence shown in SEQ ID No.10, or comprises a nucleotide sequence having at least 90% homology with the sequence shown in SEQ ID No.10.

[0014] As a preferred embodiment, the saccharifying enzyme is derived from Talaromyces emersonii.

[0015] As a preferred embodiment, the saccharifying enzyme comprises the amino acid sequence shown in SEQ ID No. 2, or comprises an amino acid sequence having at least 90% homology with the sequence shown in SEQ ID No. 2.

[0016] As a preferred embodiment, the gene encoding the saccharifying enzyme comprises the nucleotide sequence shown in SEQ ID No.1, or comprises a nucleotide sequence having at least 90% homology with the sequence shown in SEQ ID No.1.

[0017] As a preferred embodiment, the recombinant microorganism contains a saccharifying enzyme expression cassette, and the saccharifying enzyme expression cassette contains a promoter, a saccharifying enzyme encoding gene, and a terminator.

[0018] As a preferred embodiment, the promoter in the saccharifying enzyme expression cassette is the fungal amylase NA2 promoter derived from Aspergillus niger.

[0019] As a preferred embodiment, the promoter in the saccharifying enzyme expression cassette comprises the nucleotide sequence shown in SEQ ID No.3, or comprises a nucleotide sequence having at least 90% homology with the sequence shown in SEQ ID No.3.

[0020] As a preferred embodiment, the terminator in the saccharifying enzyme expression cassette is a glaA gene terminator derived from Aspergillus niger.

[0021] As a preferred embodiment, the terminator in the saccharifying enzyme expression cassette comprises the nucleotide sequence shown in SEQ ID No.4, or comprises a nucleotide sequence having at least 90% homology with the sequence shown in SEQ ID No.4.

[0022] As a preferred embodiment, the recombinant microorganism contains a saccharifying enzyme expression vector, and the saccharifying enzyme expression vector contains the saccharifying enzyme expression cassette and a selection marker expression cassette; the selection marker expression cassette contains a promoter, a marker gene and a terminator.

[0023] As a preferred embodiment, the marker gene is the amdS gene derived from Aspergillus nidulans.

[0024] As a preferred embodiment, the selection marker expression cassette comprises the nucleotide sequence shown in SEQ ID No.5, or comprises a nucleotide sequence having at least 90% homology with the sequence shown in SEQ ID No.5.

[0025] As a preferred embodiment, the recombinant microorganism is Aspergillus niger.

[0026] As a preferred embodiment, the recombinant microorganism is Aspergillus niger after the fungal amylase gene and the acid amylase gene are knocked out.

[0027] As a preferred embodiment, the recombinant microorganism is constructed by using the Aspergillus niger CBS513.88 strain with the fungal amylase gene and the acid amylase gene knocked out as the starting strain.

[0028] The second object of the present invention is to provide a method for constructing the recombinant microorganism, which comprises: in a microorganism containing a gene encoding a saccharifying enzyme and a gene encoding a lysophospholipase, replacing the promoter driving the expression of the lysophospholipase with a gpdA promoter, a tpi promoter or a trpC promoter derived from Aspergillus nidulans.

[0029] As a preferred embodiment, the construction method includes: using a microorganism containing a gene encoding a lysophospholipase as a starting strain, introducing a saccharifying enzyme expression vector, and replacing the promoter driving the expression of the lysophospholipase with a gpdA promoter, a tpi promoter or a trpC promoter derived from Aspergillus nidulans.

[0030] As a preferred embodiment, the starting strain is Aspergillus niger, preferably Aspergillus niger with the fungal amylase gene and the acid amylase gene knocked out, more preferably Aspergillus niger CBS513.88 strain with the fungal amylase gene and the acid amylase gene knocked out.

[0031] As a preferred embodiment, the promoter driving the expression of lysophospholipase is replaced with the gpdA promoter, tpi promoter or trpC promoter derived from Aspergillus nidulans by gene site-directed integration.

[0032] The third object of the present invention is to provide a fermentation product obtained by fermentation of the recombinant microorganism.

[0033] The fourth object of the present invention is to provide the use of the recombinant microorganism or the fermentation product in the simultaneous production of saccharifying enzyme and lysophospholipase.

[0034] The present invention finds that by optimizing the promoter driving the expression of lysophospholipase, the expression level of lysophospholipase can be significantly increased in a recombinant microorganism that simultaneously expresses saccharifying enzyme and lysophospholipase. When it is applied to a starch saccharification process, the filtration rate of the starch saccharification hydrolyzate can be significantly increased, which is of great significance for reducing the production cost and simplifying the production process in the industrial production of starch sugar. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0036] Figure 1 This is the plasmid map of the plasmid pUC57-TeGA-amdS in the examples of the present invention.

[0037] Figure 2 1 is the plasmid map of the plasmid PgpdA-PLB in the embodiment of the present invention.

[0038] Figure 3 1 is the plasmid map of the plasmid PtrpC-PLB in the embodiment of the present invention.

[0039] Figure 4 This is the plasmid map of the plasmid Ptpi-PLB in the examples of the present invention.

[0040] Figure 5 The results are the effects of different strains on the filtration rate of starch saccharification and hydrolyzate in the examples of the present invention. DETAILED DESCRIPTION

[0041] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention. Those skilled in the art may make various modifications and changes to the present invention without departing from the scope or spirit of the present invention. For example, a feature described or illustrated as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0042] Unless otherwise indicated, the meaning of all terms (including technical and scientific terms) used to disclose the present invention is the same as that commonly understood by those of ordinary skill in the art to which the present invention belongs. By way of further guidance, the following definitions are used to better understand the teachings of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0043] The terms "and / or", "or / and", and "and / or" used in this article include any one of two or more related listed items, and also include any and all combinations of related listed items, and the arbitrary and all combinations include any two related listed items, any more related listed items, or a combination of all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in this application, the technical solution undoubtedly includes technical solutions that are all connected by "logical and", and undoubtedly includes technical solutions that are all connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution that is all connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the combination of four of A, B, C, and D (that is, the technical solution that is all connected by "logical AND").

[0044] As used herein, the terms "comprising", "including" and "comprising" are synonymous and are inclusive or open-ended and do not exclude additional, unrecited members, elements or method steps.

[0045] Numerical ranges expressed as endpoints herein include all numbers and fractions subsumed within the range, as well as the recited endpoints.

[0046] The present invention relates to concentration values, and its meaning includes fluctuations within a certain range. For example, it can fluctuate within the corresponding accuracy range. For example, 2% can allow fluctuations within the range of ±0.1%. For values ​​that are large or do not require too fine control, its meaning is also allowed to include greater fluctuations. For example, 100mM can allow fluctuations within the range of ±1%, ±2%, ±5%, etc. Involving molecular weight, its meaning is allowed to include fluctuations of ±10%.

[0047] In the present invention, descriptions such as "plurality" and "multiple" refer to quantities greater than or equal to 2 unless otherwise specified.

[0048] In the present invention, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0049] In the present invention, “preferred”, “better”, “more preferred” and “suitable” are only used to describe implementation methods or examples with better effects. It should be understood that they do not constitute limitations on the scope of protection of the present invention.

[0050] In the present invention, "optionally", "optional", "optionally", "optionally", "optional", "optional", "optional" means optional, that is, it means to be selected from any one of the two parallel schemes of "yes" or "no". If multiple "optional" or "optional" appear in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction, each "optional" or "optional" is independent.

[0051] In the present invention, the term "saccharifying enzyme" is also called glucoamylase (Glucoamylase, EC.3.2.1.3), which can hydrolyze the α-1.4 glucosidic bond of starch from the non-reducing end to produce glucose, and can also slowly hydrolyze the α-1.6 glucosidic bond to convert it into glucose; it can also hydrolyze the non-reducing ends of dextrin and glycogen to release β-D-glucose.

[0052] In the present invention, the term "lysophospholipase (EC 3.1.1.5)" is sometimes referred to as phosphatase B (PLB), but it not only has the activity of phospholipase B but also can specifically decompose the ester bond of lysophospholipid to remove fatty acid chain.

[0053] In the present invention, "a sequence having at least 90% homology to the sequence shown in SEQ ID No..." refers to a sequence that has a small sequence difference compared with the compared sequence but still exerts the same or similar function.

[0054] In an amino acid sequence, the above-mentioned "small amount of sequence differences" typically refers to the deletion or substitution of one or more (the upper limit is, for example, 3, 5, 7 or 10) amino acids constituting the amino acid sequence, or the addition or insertion of one or more (the upper limit is, for example, 3, 5, 7 or 10) amino acids, or a combination of these to produce mutations in the amino acid sequence, preferably conservative substitutions of amino acids. The "conservative substitution" mentioned herein is also referred to as substitution by "homologous" amino acid residues, and refers to substitutions in which the amino acid residues are replaced by amino acid residues having similar side chains, for example, amino acids with basic side chains (such as lysine, arginine and histidine), amino acids with acidic side chains (such as aspartic acid, glutamic acid), non-charged polar side chain amino acids (such as glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chain amino acids (such as alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chain amino acids (such as threonine, valine, isoleucine) and aromatic side chain amino acids (such as tyrosine, phenylalanine, tryptophan, histidine). Conservative amino acid substitutions usually have little effect on the activity of the resulting protein.

[0055] In a nucleotide sequence, the above-mentioned “small sequence differences” are typically base sequences containing substitutions, deletions, insertions, additions, or inversions of one or more bases, but still encode proteins with the same functions, or still achieve the same functions.

[0056] Recombinant bacteria

[0057] The present invention relates to a recombinant microorganism, which contains: a gene encoding a saccharifying enzyme; and a gene encoding a lysophospholipase; wherein the expression of the lysophospholipase is driven by a gpdA promoter, a tpi promoter or a trpC promoter derived from Aspergillus nidulans.

[0058] The present invention unexpectedly discovered that in a recombinant microorganism containing a gene encoding a saccharifying enzyme and a gene encoding a lysophospholipase, by replacing the promoter driving the expression of the lysophospholipase with a gpdA promoter, a tpi promoter or a trpC promoter derived from Aspergillus nidulans, the expression effect of the lysophospholipase can be significantly improved, thereby significantly improving the effect of improving the filtration rate of the starch saccharification hydrolyzate when it is applied to the starch saccharification process.

[0059] In some embodiments, the expression of the lysophospholipase is driven by the trpC promoter derived from Aspergillus nidulans. When the expression of the lysophospholipase is driven by the promoter, not only the expression amount of the lysophospholipase can be significantly improved, but also the expression amount of the saccharifying enzyme is not significantly affected, thus having a better comprehensive expression effect and application effect.

[0060] In some embodiments, the gpdA promoter derived from Aspergillus nidulans comprises the nucleotide sequence shown in SEQ ID No.12, or comprises a nucleotide sequence having at least 90%, preferably at least 95%, more preferably at least 97%, further preferably at least 98%, and most preferably at least 99% homology to the sequence shown in SEQ ID No.12.

[0061] In some embodiments, the tpi promoter derived from Aspergillus nidulans comprises the nucleotide sequence shown in SEQ ID No.13, or comprises a nucleotide sequence having at least 90%, preferably at least 95%, more preferably at least 97%, further preferably at least 98%, and most preferably at least 99% homology to the sequence shown in SEQ ID No.13.

[0062] In some embodiments, the trpC promoter derived from Aspergillus nidulans comprises a nucleotide sequence as shown in SEQ ID No. 14, or comprises a nucleotide sequence having at least 90%, preferably at least 95%, more preferably at least 97%, further preferably at least 98%, and most preferably at least 99% homology to the sequence shown in SEQ ID No. 14.

[0063] In some embodiments, the lysophospholipase is derived from Aspergillus niger.

[0064] In some embodiments, the lysophospholipase comprises an amino acid sequence as shown in SEQ ID No.11, or comprises an amino acid sequence having at least 90%, preferably at least 95%, more preferably at least 97%, further preferably at least 98%, and most preferably at least 99% homology to the sequence shown in SEQ ID No.11.

[0065] In some embodiments, the gene encoding the lysophospholipase comprises a nucleotide sequence as shown in SEQ ID No. 10, or comprises a nucleotide sequence having at least 90%, preferably at least 95%, more preferably at least 97%, further preferably at least 98%, and most preferably at least 99% homology to the sequence shown in SEQ ID No. 10.

[0066] In some embodiments, the saccharifying enzyme is derived from Talaromyces emersonii.

[0067] In some embodiments, the saccharifying enzyme comprises an amino acid sequence as shown in SEQ ID No.2, or comprises an amino acid sequence having at least 90%, preferably at least 95%, more preferably at least 97%, further preferably at least 98%, and most preferably at least 99% homology to the sequence shown in SEQ ID No.2.

[0068] In some embodiments, the gene encoding the saccharifying enzyme comprises a nucleotide sequence as shown in SEQ ID No.1, or comprises a nucleotide sequence having at least 90%, preferably at least 95%, more preferably at least 97%, further preferably at least 98%, and most preferably at least 99% homology to the sequence shown in SEQ ID No.1.

[0069] In some embodiments, the recombinant microorganism contains a saccharifying enzyme expression cassette, which contains a promoter, a gene encoding a saccharifying enzyme, and a terminator.

[0070] In some embodiments, the promoter in the saccharifying enzyme expression cassette is a fungal amylase NA2 promoter derived from Aspergillus niger.

[0071] In some embodiments, the promoter in the saccharifying enzyme expression cassette comprises a nucleotide sequence as shown in SEQ ID No.3, or comprises a nucleotide sequence having at least 90%, preferably at least 95%, more preferably at least 97%, further preferably at least 98%, and most preferably at least 99% homology to the sequence shown in SEQ ID No.3.

[0072] In some embodiments, the terminator in the saccharifying enzyme expression cassette is a glaA gene terminator derived from Aspergillus niger.

[0073] In some embodiments, the terminator in the saccharifying enzyme expression cassette comprises a nucleotide sequence as shown in SEQ ID No.4, or comprises a nucleotide sequence having at least 90%, preferably at least 95%, more preferably at least 97%, further preferably at least 98%, and most preferably at least 99% homology to the sequence shown in SEQ ID No.4.

[0074] In some embodiments, the recombinant microorganism contains a saccharifying enzyme expression vector, and the saccharifying enzyme expression vector contains the saccharifying enzyme expression cassette and a selection marker expression cassette; the selection marker expression cassette contains a promoter, a marker gene and a terminator.

[0075] In some embodiments, the marker gene is the amdS gene from Aspergillus nidulans.

[0076] In some embodiments, the selection marker expression cassette comprises a nucleotide sequence as shown in SEQ ID No.5, or comprises a nucleotide sequence having at least 90%, preferably at least 95%, more preferably at least 97%, further preferably at least 98%, and most preferably at least 99% homology to the sequence shown in SEQ ID No.5.

[0077] In some embodiments, the recombinant microorganism is Aspergillus niger.

[0078] In some embodiments, the recombinant microorganism is Aspergillus niger after knocking out the fungal amylase gene and the acid amylase gene.

[0079] In some embodiments, the recombinant microorganism is constructed by knocking out the Aspergillus niger CBS513.88 strain (available from commercial sources) after knocking out the fungal amylase gene and the acid amylase gene as the starting strain. When this strain is used as the starting strain, it is more conducive to the expression of saccharifying enzyme and lysophospholipase, but the effect of the present invention does not depend on the starting strain. The recombinant microorganism constructed according to the scheme of the present invention has the effect mentioned in the present invention by using a microorganism known in the art that can be used for the expression of saccharifying enzyme and lysophospholipase as the starting strain.

[0080] In specific implementation, those skilled in the art can combine the above-described embodiments with common sense to obtain preferred embodiments of the recombinant microorganism of the present invention.

[0081] Construction method

[0082] The present invention also provides a method for constructing a recombinant microorganism as described in any of the aforementioned schemes, comprising: in a microorganism containing a gene encoding a saccharifying enzyme and a gene encoding a lysophospholipase, replacing the promoter driving the expression of the lysophospholipase with a gpdA promoter, a tpi promoter or a trpC promoter derived from Aspergillus nidulans.

[0083] In some embodiments, the construction method includes: using a microorganism containing a gene encoding a lysophospholipase as a starting strain, introducing a saccharifying enzyme expression vector, and replacing the promoter driving the expression of the lysophospholipase with a gpdA promoter, a tpi promoter, or a trpC promoter derived from Aspergillus nidulans.

[0084] Among them, the steps of "introducing a saccharifying enzyme expression vector" and "replacing the promoter driving the expression of lysophospholipase with a gpdA promoter, a tpi promoter or a trpC promoter derived from Aspergillus nidulans" have no particular order of precedence, and those skilled in the art may adjust the order of precedence during specific implementation.

[0085] In some embodiments, the starting strain is Aspergillus niger, preferably Aspergillus niger with the fungal amylase gene and the acid amylase gene knocked out, more preferably Aspergillus niger CBS513.88 strain with the fungal amylase gene and the acid amylase gene knocked out.

[0086] In some embodiments, the promoter driving the expression of lysophospholipase is replaced with a gpdA promoter, a tpi promoter or a trpC promoter derived from Aspergillus nidulans by a gene site-directed integration method.

[0087] In some more preferred embodiments, the promoter driving the expression of lysophospholipase is replaced with the trpC promoter derived from Aspergillus nidulans.

[0088] In specific implementation, based on the above description of the implementation methods of the recombinant microorganism, those skilled in the art can confirm the specific scheme for constructing the corresponding recombinant microorganism, including confirming the starting strain, the coding gene of the saccharifying enzyme, the coding gene of the lysophospholipase, and the specific sequence of the control elements related to their expression, etc.

[0089] Related Products

[0090] The present invention further provides a bacterial agent, which contains the recombinant microorganism described in any of the above schemes.

[0091] In some specific embodiments, the bacterial agent also contains a culture medium and additives for maintaining the activity of the recombinant microorganism.

[0092] In some specific embodiments, the bacterial agent also contains other functional microorganisms related to the application scenario.

[0093] The present invention also provides a fermentation product obtained by fermentation of the recombinant bacteria described in any of the above schemes.

[0094] In some embodiments, the fermentation product is the fermentation broth supernatant and / or bacterial cells obtained after fermentation of the recombinant bacteria.

[0095] In some embodiments, the fermentation product is a fermentation broth supernatant and / or an extract or extract of the bacterial cell obtained after fermentation of the recombinant bacteria. Generally, the extract or extract is a composition containing a higher concentration (compared to before extraction or extraction) of saccharifying enzyme and lysophospholipase.

[0096] The invention also provides a composition, which contains the fermentation product and one or more enzymes selected from amylase, cellulase, hemicellulase, isomerase, lipase, phytase and protease.

[0097] In some embodiments, the amylase is at least one enzyme selected from α-amylase, pullulanase, and isoamylase.

[0098] In some embodiments, the cellulase is at least one enzyme selected from β-glucosidase, cellobiohydrolase, and endoglucanase.

[0099] application

[0100] The present invention also provides the use of the recombinant microorganism, the bacterial agent, or the fermentation product in the simultaneous production of saccharifying enzyme and lysophospholipase.

[0101] The present invention also provides the use of the fermentation product or the composition in any of the following aspects: 1) hydrolysis of starch; 2) hydrolysis of dextrin; 3) hydrolysis of glycogen; 4) hydrolysis of phospholipids; 5) hydrolysis of a composition containing at least one substance selected from starch, dextrin, glycogen and phospholipids.

[0102] In some embodiments, the fermentation product or the composition is used to hydrolyze a composition containing starch and phospholipids.

[0103] In some embodiments, based on its superior hydrolysis effect on starch, dextrin, glycogen, and phospholipids, the fermentation product or the composition can also be used in any of the following aspects: (1) food processing; (2) feed processing; (3) paper preparation.

[0104] The present invention further provides a starch sugar processing method, which comprises: contacting a starch liquefaction product with one selected from the fermentation product and the composition to saccharify the starch liquefaction product into soluble sugar.

[0105] In some embodiments, the starch liquefaction product contains phospholipids.

[0106] In the present invention, liquefaction is the process of adding starch raw materials (such as wheat, corn, potatoes, etc.) to hot water and then treating them with amylase (usually α-amylase). Amylase can degrade the internal connections of starch molecules and decompose starch molecules into shorter starch chains and starch fragments, i.e., the starch liquefaction product described in the present invention. Liquefaction can make starch more fluid at high temperatures, which is convenient for subsequent processing steps.

[0107] In the present invention, saccharification refers to the process of adding saccharifying enzyme to liquefied starch raw material and further treating it. Saccharifying enzyme can further degrade liquefied starch chains and starch fragments and convert them into glucose. The saccharification process is usually carried out at a relatively low temperature to maintain the activity and efficiency of saccharifying enzyme. This process often takes a period of time to ensure that starch molecules are converted into glucose as completely as possible.

[0108] In some specific embodiments, the saccharification conditions are: pH 4.0-4.5, temperature 50-70°C.

[0109] In some specific embodiments, the saccharification time is 45 to 55 hours.

[0110] In some embodiments, the starch liquefaction product can be obtained through commercial routes.

[0111] In some embodiments, the starch sugar processing method further comprises: using amylase (such as α-amylase) to liquefy a starch-containing substrate (such as wheat, corn, potato, etc.), and then subjecting the starch liquefaction product to the saccharification.

[0112] In some specific embodiments, the starch-containing substrate (such as wheat, corn, potato, etc.) can be ground before the aforementioned liquefaction step.

[0113] In some embodiments, the starch sugar processing method further comprises: after the saccharification is completed, filtering the hydrolyzate and then collecting the filtrate.

[0114] In some specific embodiments, the filtration specifically comprises: mixing the hydrolyzate with perlite, and then filtering in a Buchner funnel.

[0115] Example

[0116] Embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are preferably referred to the guidance provided in the present invention, and can also be based on the experimental manual or normal conditions in this area, and can also be based on other experimental methods known in the art, or according to the conditions recommended by the manufacturer.

[0117] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0118] Example 1 Construction of saccharifying enzyme expression plasmid

[0119] The saccharifying enzyme expression plasmid pUC57-TeGA-amdS contains the following components:

[0120] (1) Fragment obtained after EcoRI-HindIII double digestion of pUC57 plasmid;

[0121] (2) Glucoamylase gene expression cassette: synthesized by GenScript; the glycoamylase gene is from Talaromyces emersonii, referred to as TeGA (DNA sequence see SEQ ID No. 1, amino acid sequence see SEQ ID No. 2); the promoter uses the endogenous fungal amylase NA2 promoter of Aspergillus niger (sequence see SEQ ID No. 3), and the terminator uses the endogenous glaA gene terminator of Aspergillus niger (sequence see SEQ ID No. 4);

[0122] (3) The selection marker amdS expression cassette was synthesized by GenScript and derived from Aspergillus nidulans (sequence see SEQ ID No. 5). The amdS expression cassette comprises a promoter (1 bp to 649 bp), an amdS gene coding sequence (650 bp to 2549 bp), and a terminator sequence (2550 bp to 2724 bp).

[0123] First, primers TeGA_F and TeGA_R, amdS-F and amdS-R were used to amplify the GA gene and amdS gene with recombination arms by PCR, and then the pUC57 EcoRI-HindIII enzyme digested linear recovery fragment with terminal complementary sequence was recombined by ClonEZ method to obtain pUC57-TeGA-amdS plasmid. The constructed plasmid map is shown in Figure 1 The primers for plasmid construction are shown in Table 1. The plasmid was added with HindIII sites upstream of the TeGA expression cassette and downstream of the amdS expression cassette, respectively, so that it can be used for protoplast transformation after linearization.

[0124] Table 1 Primer names and sequences

[0125] Primer name Primer sequence (5'→3') amdS-F cttgctctgctgatatcactgtcattcaatgcatctggaaacgcaaccctgaagg (SEQ ID No. 6) amdS-R gaaacagctatgaccatgattacgccaagcttctagatctacgccaggaccgagc(SEQ ID No.7) TeGA-F Agtcacgacgttgtaaaacgacggccagtgaattcaagctttaaatttttatatggcgggtggtgggcaac(SEQ ID No.8) TeGA-R Aaaggaagaatcccttcagggttgcgtttccagatgcattgaatgacagtgatatcagcag(SEQ ID No.9)

[0126] Example 2 Construction and screening of high-expression strains of saccharifying enzymes

[0127] The starting strain of this example is Aspergillus niger 2014BSJ, which is obtained by knocking out the fungal amylase gene and the acid amylase gene of the Aspergillus niger CBS513.88 (An09g01240) strain.

[0128] Preparation of protoplasts: Aspergillus niger 2014BSJ mycelium was cultured in TZ liquid medium (beef extract powder 0.8%; yeast extract 0.2%; peptone 0.5%; NaCl 0.2%; sucrose 3%; pH 5.8). The mycelium was filtered from the culture medium through mira-cloth (Calbiochem) and washed with 0.7M NaCl (pH 5.8). The mycelium was filtered and transferred to an enzymatic solution containing 1% cellulase (Sigma), 1% snail enzyme (Sigma) and 0.2% lysozyme (Sigma). The enzymatic solution was hydrolyzed at 30°C and 65rpm for 2.5-3h. The enzymatic solution containing protoplasts was then placed on ice and filtered with four layers of lens paper. The obtained filtrate was centrifuged at 3000 rpm and 4°C for 10 min, and the supernatant was discarded; the protoplasts attached to the tube wall were washed once with STC solution (1M D-sorbitol, 50mM CaCl2, 10mM Tris-HCl, pH7.5), and finally the protoplasts were resuspended in an appropriate amount of STC solution.

[0129] Transformation of protoplasts: 10ug pUC57-TeGA-amdS plasmid HindIII linearized DNA (5731bp) was added to 100ul protoplast suspension, mixed and placed at room temperature for 25min; then 900ul PEG solution (60% PEG4000, 10mM CaCl2, 10mM TrisHCl, pH7.5) was added three times, mixed and placed at room temperature for 25min; 3000rpm, centrifuged at room temperature for 10min, protoplasts were collected, and finally the protoplasts were resuspended in 1ml STC solution. The suspension was mixed with amdS medium (0.05% potassium chloride, 0.1% dipotassium hydrogen phosphate, 0.2% cesium chloride, 20% sucrose, 0.7% agar) with acetamide as the sole nitrogen source which had been cooled to about 45°C in advance and spread on a plate; after the plate solidified, it was placed in a 34°C incubator and cultured for 4-5 days. The transformants that grew out of the surface of the culture medium were positive transformants.

[0130] 120 positive transformants were randomly selected and cultured in a shake flask with 50 ml YPM medium (2 g / L yeast extract, 2 g / L peptone, 20 g / L maltose) at 34°C and 220 rpm in a shaker for six days. The saccharifying enzyme activity of the supernatant was tested according to the national standard method, and finally a high-expression saccharifying enzyme strain was obtained, named AMG-47.

[0131] Example 3 Construction of Lysophospholipase Enhanced Expression Integration Plasmid

[0132] The expression of lysophospholipase was improved by replacing promoters of different strengths based on the high-expression saccharifying enzyme strain AMG-47 obtained in Example 2. The lysophospholipase gene (hereinafter referred to as PLB, DNA sequence see SEQ ID No. 10, amino acid sequence see SEQ ID No. 11) comes from Aspergillus niger CBS513.88 (An09g01240), and three promoters from Aspergillus nidulans were tested: gpdA promoter (SEQ ID No. 12), tpi promoter (SEQ ID No. 13), trpC promoter (SEQ ID No. 14) to enhance the expression of lysophospholipase.

[0133] The method for constructing the Aspergillus niger gpdA promoter integration plasmid is as follows: the pHphtk plasmid is linearized by vector-F and vector-R primers; the genome of the AMG-47 strain is used as a template, and the 5' and 3' sequences flanking the PLB gene promoter are amplified by PLB-5'-F and PLB-5'gpdA-R, PLB-3'gpdA-F and PLB-3'-R, respectively, and each fragment is 1500bp long. The synthesized gpdA promoter (synthesized by Genscript) is amplified by PgpdA-F and PgpdA-R. The linearized pHphtk vector, the 5' fragment and 3' fragment flanking the PLB gene promoter, and the gpdA promoter fragment are recombined by the Gibson Master Mix Kit (E2611, New England Biolabs) to obtain the integration plasmid PgpdA-PLB. The plasmid map is shown in Figure 2 .

[0134] The method for constructing the Aspergillus niger trpC promoter integration plasmid is as follows: the pHphtk plasmid is linearized using vector-F and vector-R primers; the genome of the AMG-47 strain is used as a template, and the 5' and 3' sequences flanking the PLB gene promoter are amplified using PLB-5'-F and PLB-5'trpC-R, PLB-3'trpC-F and PLB-3'-R, respectively, with each fragment being 1500 bp long. The synthesized trpC promoter (synthesized by Genscript) is amplified using PtrpC-F and PtrpC-R. The linearized pHphtk vector, the 5' fragment and 3' fragment flanking the PLB gene promoter, and the trpC promoter fragment are recombined using the Gibson Master Mix Kit to obtain the integration plasmid PtrpC-PLB. The plasmid map is shown in Figure 3 .

[0135] The method for constructing the Aspergillus niger tpi promoter integration plasmid is as follows: the pHphtk plasmid is linearized using vector-F and vector-R primers; the genome of the AMG-47 strain is used as a template, and the 5' and 3' sequences flanking the PLB gene promoter are amplified using PLB-5'-F and PLB-5'tpi-R, PLB-3'tpi-F and PLB-3'-R, respectively, with each fragment being 1500 bp long. The synthesized tpi promoter (synthesized by Genscript) is amplified using Ptpi-F and Ptpi-R. The linearized pHphtk vector, the 5' fragment and 3' fragment flanking the PLB gene promoter, and the tpi promoter fragment are recombined using the Gibson Master Mix Kit to obtain the integration plasmid Ptpi-PLB. The plasmid map is shown in Figure 4 .

[0136] The relevant primer sequences are shown in Table 2.

[0137] Table 2 Primer names and sequences

[0138]

[0139] Example 4 Construction of Lysophospholipase Enhanced Expression Strain

[0140] The method for site-specific integration of Aspergillus niger genes can refer to Example 5 of Patent CN 107353327 A. The strains obtained after site-specific integration of three different promoters, gpdA, trpC, and tpi, into the PLB gene locus of AMG-47 strain were named: BSJ-TeGA-PgpdA-PLB strain, BSJ-TeGA-PtrpC-PLB strain, and BSJ-TeGA-Ptpi-PLB strain.

[0141] Example 5 Shake flask fermentation of lysophospholipase-enhanced strain

[0142] The BSJ-TeGA-PgpdA-PLB strain, BSJ-TeGA-PtrpC-PLB strain, BSJ-TeGA-Ptpi-PLB strain and control strain AMG-47 constructed in the above Example 4 were cultured in 50 ml YPM medium (2 g / L yeast extract, 2 g / L peptone, 20 g / L maltose) mentioned in Example 2 in a shake flask at 34°C and 220 rpm in a shaker for six days, with 3 shake flasks for each strain. After 6 days, the fermentation broth sample was centrifuged at 12000 rpm for 10 min and the supernatant was taken to detect the activities of saccharifying enzyme and lysophospholipase. The saccharifying enzyme activity was detected according to the method in GB8276-2006 "Food Additive saccharifying enzyme preparations"; the lysophospholipase activity was detected using the commercial kit LabAssay TMNEFA (manufacturer: Wako Japan Wako Pure Chemical Industries, Ltd., catalog number: 294-63601) was used for testing. The experimental results are shown in Table 3.

[0143] Table 3 Lysophospholipase enhanced strain shake flask fermentation results

[0144] Strain name Calculated saccharifying enzyme activity Lysophospholipase activity BSJ-TeGA-PgpdA-PLB strain-1 18 17 BSJ-TeGA-PgpdA-PLB strain-2 22 15 BSJ-TeGA-PgpdA-PLB strain-3 17 16 BSJ-TeGA-PtrpC-PLB strain-1 28 14 BSJ-TeGA-PtrpC-PLB strain-2 31 12 BSJ-TeGA-PtrpC-PLB strain-3 30 12 BSJ-TeGA-Ptpi-PLB strain-1 24 16 BSJ-TeGA-Ptpi-PLB strain-2 26 15 BSJ-TeGA-Ptpi-PLB strain-3 27 13 Control strain AMG-47-1 30 0 Control strain AMG-47-2 27 0 Control strain AMG-47-3 32 0

[0145] From the results in Table 3, compared with the control strain AMG-47, the BSJ-TeGA-PgpdA-PLB strain has the best effect in enhancing the expression of lysophospholipase, but it will lead to a significant decrease in the expression of glucoamylase; the BSJ-TeGA-Ptpi-PLB strain can also significantly enhance the expression of lysophospholipase but will lead to a decrease of about 13.5% in the expression of glucoamylase; the BSJ-TeGA-PtrpC-PLB strain can significantly enhance the expression of lysophospholipase and has no obvious effect on the expression of glucoamylase.

[0146] Example 4 Application Test

[0147] The pH of the starch liquefaction solution was adjusted to 4.3, and 0.30 kg / TDS of BSJ-TeGA-PgpdA-PLB, BSJ-TeGA-PtrpC-PLB, BSJ-TeGA-Ptpi-PLB strains and AMG-47 negative control were added to the fermentation supernatant, and the mixture was placed in a water bath at 60°C for 48 hours. 50 g of the hydrolyzate was mixed with 0.1 g of perlite, poured into a Buchner funnel for filtration, and the time taken for complete filtration of the hydrolyzate was recorded and the filtration rate was calculated. The experimental results are shown in Figure 5 .

[0148] from Figure 5 It can be seen that the fermentation supernatants of BSJ-TeGA-PgpdA-PLB, BSJ-TeGA-PtrpC-PLB and BSJ-TeGA-Ptpi-PLB strains can significantly increase the filtration rate of starch saccharification hydrolysate. Among them, the expression of saccharifying enzyme did not change significantly while the expression of lysophospholipase was enhanced in BSJ-TeGA-PtrpC-PLB strain, which is of great significance for reducing production costs and simplifying production processes in the industrial production of starch sugar.

[0149] The above-mentioned embodiments only express several implementation methods of the present invention, and the description is relatively specific and detailed, but it cannot be understood as limiting the scope of the invention patent. It should be pointed out that for ordinary technicians in this field, several modifications and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. A recombinant microorganism comprising: Genes encoding glycoamylase and genes encoding lysophospholipase; in, The expression of the lysophospholipase is driven by the gpdA promoter, the tpi promoter or the trpC promoter from Aspergillus nidulans.

2. The recombinant microorganism according to claim 1, wherein The expression of the lysophospholipase is driven by the trpC promoter from Aspergillus nidulans.

3. The recombinant microorganism according to claim 1, wherein The gpdA promoter derived from Aspergillus nidulans comprises the nucleotide sequence shown in SEQ ID No. 12, or comprises a nucleotide sequence having at least 90% homology to the sequence shown in SEQ ID No. 12; The tpi promoter derived from Aspergillus nidulans comprises the nucleotide sequence shown in SEQ ID No. 13, or comprises a nucleotide sequence having at least 90% homology to the sequence shown in SEQ ID No. 13; The trpC promoter derived from Aspergillus nidulans comprises the nucleotide sequence shown in SEQ ID No.14, or comprises a nucleotide sequence having at least 90% homology to the sequence shown in SEQ ID No.

14.

4. The recombinant microorganism according to claim 1, wherein The lysophospholipase is derived from Aspergillus niger; Preferably, the lysophospholipase comprises the amino acid sequence shown in SEQ ID No.11, or comprises an amino acid sequence having at least 90% homology to the sequence shown in SEQ ID No.

11.

5. The recombinant microorganism according to claim 4, wherein The coding gene of the lysophospholipase comprises the nucleotide sequence shown in SEQ ID No. 10, or comprises a nucleotide sequence having at least 90% homology with the sequence shown in SEQ ID No.

10.

6. The recombinant microorganism according to claim 1, wherein The saccharifying enzyme is derived from Talaromyces emersonii; Preferably, the saccharifying enzyme comprises the amino acid sequence shown in SEQ ID No. 2, or comprises an amino acid sequence having at least 90% homology to the sequence shown in SEQ ID No.

2.

7. The recombinant microorganism according to claim 6, wherein The gene encoding the saccharifying enzyme comprises the nucleotide sequence shown in SEQ ID No. 1, or comprises a nucleotide sequence having at least 90% homology with the sequence shown in SEQ ID No.

1.

8. The recombinant microorganism according to claim 1 or 6, wherein The recombinant microorganism contains a saccharifying enzyme expression cassette, wherein the saccharifying enzyme expression cassette contains a promoter, a saccharifying enzyme coding gene, and a terminator; The promoter in the saccharifying enzyme expression cassette is a fungal amylase NA2 promoter derived from Aspergillus niger. Preferably, the promoter in the saccharifying enzyme expression cassette comprises a nucleotide sequence as shown in SEQ ID No. 3, or comprises a nucleotide sequence having at least 90% homology to the sequence as shown in SEQ ID No. 3; The terminator in the saccharifying enzyme expression cassette is a glaA gene terminator from Aspergillus niger. Preferably, the terminator in the saccharifying enzyme expression cassette comprises a nucleotide sequence as shown in SEQ ID No.4, or comprises a nucleotide sequence having at least 90% homology to the sequence shown in SEQ ID No.

4.

9. The recombinant microorganism according to claim 8, wherein The recombinant microorganism contains a saccharifying enzyme expression vector, and the saccharifying enzyme expression vector contains the saccharifying enzyme expression cassette and a selection marker expression cassette; The selection marker expression cassette contains a promoter, a marker gene and a terminator; Preferably, the marker gene is the amdS gene from Aspergillus nidulans. More preferably, the selection marker expression cassette comprises the nucleotide sequence shown in SEQ ID No.5, or comprises a nucleotide sequence having at least 90% homology to the sequence shown in SEQ ID No.

5.

10. The recombinant microorganism according to claim 1, wherein The recombinant microorganism is Aspergillus niger, preferably Aspergillus niger after knocking out the fungal amylase gene and the acid amylase gene, and more preferably the recombinant microorganism is constructed using the Aspergillus niger CBS513.88 strain after knocking out the fungal amylase gene and the acid amylase gene as the starting strain.

11. A method for constructing a recombinant microorganism according to any one of claims 1 to 10, comprising: In a microorganism containing a gene encoding a saccharifying enzyme and a gene encoding a lysophospholipase, the promoter driving the expression of the lysophospholipase is replaced with a gpdA promoter, a tpi promoter or a trpC promoter derived from Aspergillus nidulans.

12. The method for constructing a recombinant microorganism according to claim 11, comprising: A microorganism containing a gene encoding lysophospholipase is used as a starting strain, a saccharifying enzyme expression vector is introduced, and the promoter driving the expression of lysophospholipase is replaced with a gpdA promoter, a tpi promoter or a trpC promoter derived from Aspergillus nidulans.

13. The method for constructing a recombinant microorganism according to claim 12, wherein: The starting strain is Aspergillus niger, preferably Aspergillus niger with the fungal amylase gene and the acid amylase gene knocked out, more preferably Aspergillus niger CBS513.88 strain with the fungal amylase gene and the acid amylase gene knocked out.

14. The method for constructing a recombinant microorganism according to any one of claims 11 to 13, wherein: The promoter driving the expression of lysophospholipase was replaced with the gpdA promoter, tpi promoter or trpC promoter derived from Aspergillus nidulans by site-directed integration.

15. A fermentation product obtained by fermentation of the recombinant microorganism according to any one of claims 1 to 10.

16. Use of the recombinant microorganism according to any one of claims 1 to 10 or the fermentation product according to claim 15 in the simultaneous production of saccharifying enzyme and lysophospholipase.

Images