Bacillus aerophilus and application thereof in preparation of micromolecular polyglutamic acid

Abstract

The invention relates to the technical field of bioengineering, in particular to bacillus aerophilus and application of the bacillus aerophilus in preparation of micromolecular polyglutamic acid. The bacillus aerophilus disclosed by the invention is classified and named as bacillus aerophilus, the strain number of the bacillus aerophilus is NQPG-1, the bacillus aerophilus is preserved in the China General Microbiological Culture Collection Center on May 24, 2024, and the preservation number of the bacillus aerophilus is CGMCC No. 30770. The bacillus aerophilus can be used for synthesizing polyglutamic acid with different molecular weights in a range of 20-400kDa by taking glucose, cane sugar, glycerol and molasses as carbon sources. Under the condition of a 100L fermentation tank, crude glycerol and cane sugar are used as carbon sources, and 80.72 g / L of polyglutamic acid can be produced by fed-batch fermentation for 48 hours, so that the method has the potential of industrial production.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, and in particular to an aerophilic bacillus and application thereof in preparing small molecule polyglutamic acid. Background Art

[0002] γ-Polyglutamic acid (γ-PGA for short) is a high value-added natural polyamino acid. It is an anionic polypeptide compound polymerized by microorganisms using L-type or D-type glutamic acid through γ-amide bonds, and the relative molecular weight can reach 100-2000kDa. γ-PGA of different molecular weights is suitable for different fields: high molecular weight (>700kDa) γ-PGA can be used as a flocculant and fertilizer enhancer in the fields of environmental protection and agriculture respectively; when used as a daily chemical raw material, high molecular weight (2000kDa) γ-PGA has a film-forming skin care effect; low molecular weight γ-PGA (10-100kDa) can also be used as a drug carrier, cryoprotectant and probiotic protectant; ultra-low molecular weight small molecule γ-PGA (1-10kDa) plays a transdermal moisturizing role.

[0003] At present, the regulation of γ-PGA molecular weight in industry mainly relies on acid-base hydrolysis, which has poor controllability and causes pollution to the environment. Therefore, how to achieve efficient biosynthesis of γ-PGA with different molecular weights is an urgent problem to be solved. At present, the biosynthesis of small molecular weight γ-PGA is mainly affected by two factors: wild strains and microbial degradation enzyme regulation. Compared with cutting γ-PGA into small molecular fragments through the extracellular secreted degradation enzyme pgds, screening and obtaining strains that can efficiently produce small molecular γ-PGA can solve this problem more directly.

[0004] In order to solve the acid-base pollution problem caused by the synthesis of small molecule polyglutamic acid in industrial production, the present invention intends to screen a strain that can efficiently produce small molecule polyglutamic acid, thereby reducing the process and cost of industrial production of small molecule polyglutamic acid. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide an aerophilic Bacillus strain in view of the deficiency of the prior art in lacking a strain capable of industrially synthesizing small molecule polyglutamic acid.

[0006] The technical problem that the present invention needs to solve is to provide the use of the above-mentioned aerophilic bacillus in the preparation of small molecule polyglutamic acid.

[0007] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:

[0008] A strain of aerophilic Bacillus, classified and named Bacillus aerophilus, with strain number NQPG-1, was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on May 24, 2024, with the deposit number CGMCC No.30770, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0009] Wherein, the screening process of the aerophilic bacillus is as follows:

[0010] (1) Dissolve soil or other environmental samples with sterile water, dilute them in gradients, and spread them on LB solid culture medium plates. Incubate at 32°C for 24 h to obtain single colonies.

[0011] (2) Design and synthesize two pairs of highly targeted and conserved PCR primers for amplifying the target gene fragment;

[0012] (3) Pick a single colony (known genus / unknown genus) for PCR reaction to amplify the target gene fragment;

[0013] (4) Analyzing the PCR products by agarose gel electrophoresis to screen out strains containing the γ-PGA synthase gene;

[0014] (5) Based on the isolated strains, the γ-PGA synthesis ability of the strains was further detected, and the γ-PGA content in the fermentation broth was detected using high performance liquid chromatography and gpc chromatography columns to determine whether the strains had the synthesis ability.

[0015] Among them, the specific information of two pairs of highly targeted and conserved PCR primers is as follows, and primer-2 group is preferred.

[0016] Primer-1 set: F-1: ATGATTTATTGGGATACACC; R: TATAAATCTGATCCGAACAT.

[0017] Primer-2 set: F-2: ATGGATGTCATGGGGCCGAC; R: TATAAATCTGATCCGAACAT.

[0018] Among them, whether the strain contains γ-PGA synthase is determined based on whether there is an obvious band at the 750bp marker on the agarose gel after a single colony PCR reaction. Different species of spore strains with the ability to synthesize γ-PGA that have been screened, isolated and identified are used as method validation.

[0019] Among them, the strain producing the smallest molecular weight γ-PGA was classified and identified as Bacillus aerophilus, classified and named Bacillus aerophilus, with the strain number NQPG-1. It was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on May 24, 2024, with the deposit number CGMCC No.30770, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0020] Specifically, the morphological characteristics of the aerophilic Bacillus aerophilus NQPG-1 are as follows:

[0021] After culturing at 32°C for 12 h on LB solid medium, the colonies were white and transparent with rounded edges and smooth raised surfaces, and the colonies formed were small.

[0022] After culturing at 32°C for 24 h on LB solid medium, the colonies were white and opaque, with serrated edges, a rough surface without protrusions, and a large colony area.

[0023] Specifically, the 16S rRNA sequencing result of the aerophilic Bacillus aerophilus NQPG-1 is shown in SEQ ID No: 1.

[0024] A microbial agent containing the aerophilic bacillus is also within the scope of protection of the present invention.

[0025] The application of the aerophilic bacillus in the preparation of small molecule polyglutamic acid is also within the scope of protection of the present invention.

[0026] Wherein, the weight average molecular weight Mw of the small molecule polyglutamic acid is 20 to 400 kDa.

[0027] Specifically, the activated aerophilic bacillus is inoculated into a fermentation medium for fermentation culture to prepare the small molecule polyglutamic acid.

[0028] Wherein, the fermentation medium consists of a carbon source, a nitrogen source, glutamate, an inorganic salt, an organic acid and water;

[0029] Specifically, the carbon source is any one or a combination of glucose, sucrose, glycerol or molasses;

[0030] The nitrogen source is ammonium sulfate;

[0031] The glutamate is glutamic acid or sodium glutamate;

[0032] The inorganic salt includes any one or a combination of potassium ions, calcium ions and zinc ions;

[0033] The organic acid is citric acid.

[0034] Preferably, the concentration of the carbon source is 30-100 g / L; the concentration of the ammonium sulfate is 5-20 g / L; the concentration of the glutamate is 10-80 g / L; the inorganic salts and their corresponding concentrations are: dipotassium hydrogen phosphate trihydrate 1-20 g / L, potassium dihydrogen phosphate 0.05-2 g / L, calcium chloride 0.05-2 g / L, zinc sulfate 0-2 g / L; the concentration of the organic acid is 0.5-5 g / L.

[0035] in,

[0036] (I) When glucose is used as the carbon source, the molecular weight of the small molecule polyglutamic acid is 20 to 50 kDa;

[0037] (II) when molasses is used as the carbon source, the molecular weight of the small molecule polyglutamic acid is 50 to 200 kDa;

[0038] (III) When glycerol and sucrose are used as carbon sources, the molecular weight of the small molecule polyglutamic acid is 200-400 kDa.

[0039] in,

[0040] (i) When the fermentation culture is carried out in a shake flask, the fermentation culture is carried out under the following conditions: 25-40° C., 100-300 rpm, and culture for 24-96 hours;

[0041] (ii) When fermentation culture is carried out in a 5-7.5 L fermenter, the fermentation culture conditions are: 25-40° C., 700 rpm, flow rate 5-6 L / min, pH 6.4-7.5, dissolved oxygen ≥ 20%; when the consumption rate of sodium glutamate is greater than 0.5 g / L / h, the first feed medium is added.

[0042] (iii) When fermentation is carried out in a 40-100 L fermenter, the fermentation conditions are: 25-40° C., rotation speed: 80-100 rpm, ventilation volume: 750-2000 m 3 / h, pH 6.4-7.0, dissolved oxygen ≥20%; when the residual sugar is less than 30g / L, the second feed culture medium is added.

[0043] Specifically, the first feed culture medium is 500 g / L sucrose and 500 g / L sodium glutamate.

[0044] Specifically, the second feed medium is 500 g / L sucrose, which is added at a constant rate of 300 L / h.

[0045] Beneficial effects:

[0046] In view of the lack of strains capable of industrially synthesizing small molecular weight polyglutamic acid in the prior art, the present invention develops a PCR-based rapid γ-PGA synthesis strain screening method to avoid the missed screening of small molecular weight γ-PGA synthesis strains; based on this method, a strain of aerophilic Bacillus aerophilusNQPG-1 capable of producing small molecular weight γ-PGA was isolated and identified, and the strain was deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration on May 24, 2024, with a deposit number of CGMCC No.30770. The aerophilic Bacillus can synthesize polyglutamic acid of different molecular weights in the range of 20 to 400 kDa using glucose, sucrose, glycerol, and molasses as carbon sources. Through fermentation optimization, the yield of γ-PGA produced in a 5L fermenter reached 54.70 g / L; using crude glycerol and sucrose to produce γ-PGA in a 100L fermenter, the maximum yield reached 80.72 g / L. This strain has the potential for industrial production, which provides support for reducing the production cost of small molecule γ-PGA for enterprises. It is more environmentally friendly and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] The present invention will be further described in detail below with reference to the accompanying drawings, and the above and / or other advantages of the present invention will become more clear.

[0048] Figure 1 Two designed γ-PGA synthase specific primers were used for PCR verification of different species of Bacillus. Among them, subtilis is Bacillus subtilis, lycolytic is Bacillus amyloliquefaciens, lichen is Bacillus licheniformis, mega is Bacillus megaterium, breve is Bacillus brevis, aerogenes is Bacillus aerogenes, and upland is Bacillus upland.

[0049] Figure 2 This is a liquid chromatogram of γ-PGA produced by Bacillus aerophilus NQPG-1. The red line is the chromatogram of the fermentation liquid of the strain, and the black line is the chromatogram of the γ-PGA standard product with a molecular weight of 500 kDa.

[0050] Figure 3 This is a microscopic morphology of Bacillus aerophilus NQPG-1.

[0051] Figure 4 The colony morphology of Bacillus aerophilus NQPG-1 is shown in the figure on the left after 12 hours of cultivation, and the colony morphology of Bacillus aerophilus NQPG-1 is shown in the figure on the right after 24 hours of cultivation.

[0052] Figure 5This is the process curve of OD and γ-PGA of Bacillus aerophilus NQPG-1 in shake flask fermentation.

[0053] Figure 6 The process curves of OD, pH, residual glutamate and γ-PGA of Bacillus aerophilus NQPG-1 in a 5L fermenter

[0054] Figure 7 This is the process curve of OD, pH, residual glutamate and γ-PGA of Bacillus aerophilus NQPG-1 in a 100L fermenter. DETAILED DESCRIPTION

[0055] The present invention will be further described in detail below in conjunction with specific implementations, and the above and / or other advantages of the present invention will become more clear.

[0056] The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and materials described are commercially available unless otherwise specified.

[0057] In the following examples, the primers were synthesized by GenScript Biotech Co., Ltd., and the genome extraction reagents, PCR polymerase and other molecular reagents were purchased from GenScript Biotech Co., Ltd.

[0058] In the following examples, the Bacillus subtilis NX-2, Bacillus amyloliquefaciens NBC, Bacillus licheniformis 2-SD, Bacillus megaterium 2a-20, Bacillus pumilus 2a3, Bacillus aerophilus CD21 and Bacillus altaica T11 strains were isolated, identified and stored in the laboratory.

[0059] In the following embodiments, the aerophilic Bacillus NQPG-1 is isolated from the laboratory, classified and named as aerophilic Bacillus Bacillus aerophilus, with a strain number of NQPG-1, and deposited in the General Microbiological Center of the China Microbiological Culture Management Committee on May 24, 2024, with a deposit number of CGMCC No. 30770, and a deposit address of No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0060] Example 1: Screening and obtaining a strain producing small molecule polyglutamic acid

[0061] 1. Sample processing and strain isolation

[0062] Soil or other environmental samples were collected and mixed with sterile water to ensure that the samples were fully dissolved. After being bathed in a 60°C water bath for 10 min, LB (Luria-Bertani) liquid culture medium was added and cultured at 32°C for 12 h to obtain a mixed solution. The mixed solution was gradiently diluted in the range of 10 -1 to 10 -7 The diluted bacterial solution was spread on LB solid culture medium plates, with an appropriate amount of bacterial solution spread on each plate; the plates were cultured at 32°C for 24 hours to allow the colonies to grow fully. After separation and purification, morphologically specific strains were selected and streaked for preservation. A total of 120 strains were isolated and obtained.

[0063] 2. Screening of strains containing γ-PGA synthase

[0064] The γ-PGA synthase sequences of various representative bacterial genera were retrieved from the NCBI database, as shown in Table 1. Further targeting the highly conserved region of the γ-PGA synthase gene, two pairs of highly specific PCR nucleotide primers were designed and synthesized. The specific information of the two pairs of primers is as follows:

[0065] Primer-1 set: F-1: ATGATTTATTGGGATACACC; R: TATAAATCTGATCCGAACAT.

[0066] Primer-2 set: F-2: ATGGATGTCATGGGGCCGAC; R: TATAAATCTGATCCGAACAT.

[0067] The genomes of seven bacterial species preserved in the laboratory, including Bacillus subtilis NX-2, Bacillus amyloliquefaciens NBC, Bacillus licheniformis 2-SD, Bacillus megaterium 2a-20, Bacillus brevis 2a3, Bacillus aerophilus CD21 and Bacillus eutrophus CT11, were extracted using a genome extraction kit. The extracted genomes were used as templates and two pairs of designed primers were used for PCR amplification screening. The PCR products were then analyzed by agarose gel electrophoresis to check whether there was an obvious band at the 750bp marker.

[0068] The PCR amplification system is: 2×Phanta Max Master Mix 25μL, template 2μL, upstream primer 2μL, downstream primer 2μL, ddH2O 19μL; the amplification program is: 95℃ pre-denaturation for 5min, 95℃ denaturation for 15s, 58℃ annealing for 15s, 72℃ extension for 1min, 30 cycles; 72℃ extension for 5min.

[0069] Table 1 γ-PGA synthetic sequences from different sources retrieved from NCBI database

[0070] strain NCBI accession number Sequence Range Bacillus subtilis strain HJ0-6 CP016894.1 3710528to 3713344 Bacillus amyloliquefaciens strain GKT04 CP072120.1 1324500to 1327319 Bacillus licheniformis strain SCDB 14 CP014842.1 643620to 646448 Priestia megaterium strain ATCC 14581 CP069288.1 1000210to 1001857 Bacillus pumilus strain FUA2115 CP154906.1 3243453to 3246284

[0071] The experimental results are as follows Figure 1 As shown in the figure, it can be seen that primers F-2 and R of primer-2 group have better specificity. This pair of primers is only specific to strains containing γ-PGA synthetase, and is not specific to strains that do not contain γ-PGA synthetase. They can be better used for screening synthetase strains.

[0072] The 120 isolated and purified strains were lysed and the lysate was used as a template to perform PCR reaction using primers F-2 and R of primer-2 group. The results of agarose gel electrophoresis showed that 40 strains with γ-PGA synthase gene were screened.

[0073] 3. Detection of γ-PGA synthesis ability of strains

[0074] The 40 strains containing the γ-PGA synthase gene were taken out from the glycerol tube and streaked for activation, and then a single strain was selected and placed in LB liquid culture medium. After culturing at 32°C overnight, it was inoculated into the fermentation medium at a rate of 1% v / v. After culturing at 32°C for 72 hours, the γ-PGA content in the fermentation broth was detected by high performance liquid chromatography (HPLC) and gpc chromatographic column.

[0075] Among them, the method of detecting γ-PGA through liquid phase is: dilute the fermentation broth by an appropriate multiple and then use a 0.22μm filter membrane to remove the bacteria. Use HPLC method, ultraviolet detector, chromatographic column: Shodex Ohpak SB-806M HQ, mobile phase: 0.2MNa2SO4 solution, flow rate 1.0mL / min, pH=4.0. The peak spectrum of the sample is compared with the γ-PGA standard to determine the yield and molecular weight of the product γ-PGA. The fermentation test results show that a total of 30 strains have the ability to synthesize γ-PGA, including two strains that produce small molecule γ-PGA; among them, the lowest molecular weight of γ-PGA is produced by the NQPG-1 strain. Figure 2 As shown, the liquid phase peak time of the fermentation broth sample of the NQPG-1 strain producing the lowest molecular weight γ-PGA is 21.226 min, and when glucose is used as the carbon source, the estimated molecular weight is 20-50 kDa. Example 2: Identification of the small molecule γ-PGA synthesizing strain NQPG-1 based on morphological characteristics and 16S rRNA

[0076] 1. Observation of strain morphological characteristics

[0077] After the NQPG-1 strain was fixed and stained, its morphological characteristics were observed under an optical microscope. Figure 3As shown, strain NQPG-1 is a Gram-negative strain with a rod shape. Strain NQPG-1 was cultured on LB solid medium at 32°C for 12 hours, and the colonies were observed to be white, transparent, with rounded edges and smooth convex surfaces. The colonies formed were small ( Figure 4 Left panel); after culturing on LB solid medium at 32°C for 24 hours, the colonies were white, opaque, with jagged edges, a rough surface without protrusions, and a large colony area ( Figure 4 right picture).

[0078] 2. 16S rRNA sequencing results

[0079] The genome of the NQPG-1 strain was extracted using a genome extraction kit, and PCR amplification was performed with primers 27F: AGAGTTTGATCCTGGCTCAG and 1492R: GGTTACCTTGTTACGACTT. 5 μL of the PCR amplification product was detected on a 1.5% agarose gel, and the remaining PCR amplification product was sent to GenScript Biotech Co., Ltd. for sequencing. The sequence of 16S rRNA was measured to be 2479 bp, as shown in SEQ ID No: 1.

[0080] The measured sequence was compared with related species in the GeneBank database, and combined with the morphological characteristics of the strain, it was identified that the small molecule γ-PGA synthesis strain NQPG-1 was Bacillus aerophilus.

[0081] 3. Strain preservation

[0082] The aerophilic Bacillus NQPG-1 obtained after screening and identification was sent for preservation, classified and named Bacillus aerophilus, with the strain number NQPG-1. It was deposited in the General Microbiology Center of China Microbiological Culture Management Committee on May 24, 2024, with the deposit number CGMCC No.30770, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0083] Example 3: Shake flask experiment of small molecule γ-PGA synthesis strain using glucose as substrate

[0084] The aerophilic Bacillus NQPG-1 strain frozen in a glycerol tube in a -80°C refrigerator was inoculated onto an LB solid medium and streaked for separation, and then cultured at 32°C overnight to activate the aerophilic Bacillus NQPG-1 strain. The activated single colony was picked and added to the LB seed medium, cultured at 32°C overnight, and then inoculated at a 5% v / v inoculum into a shake flask fermentation medium containing 100 mL of 50 g / L glucose as a carbon source, and cultured at 32°C and 200 rpm for 72 hours. The γ-PGA yield and molecular weight were detected by liquid phase. The results are as follows: Figure 5 As shown, when the fermentation broth OD 600 When =7.05, the content of γ-PGA is the highest, which is 15.7g / L, and the molecular weight is about 20~50kDa.

[0085] The shake flask fermentation medium has a formula of: 50 g / L glucose, 40 g / L sodium glutamate, 5 g / L ammonium sulfate, 5 g / L dipotassium hydrogen phosphate trihydrate, 1 g / L potassium dihydrogen phosphate, 1 g / L calcium chloride, 1.5 g / L zinc sulfate, 1 g / L citric acid monohydrate, and a natural pH value. Each 100 mL is dispensed into a 500 mL shake flask.

[0086] Example 4: Shake flask experiment of small molecule γ-PGA synthesis strain using molasses as substrate

[0087] The aerophilic Bacillus NQPG-1 strain frozen in a glycerol tube in a -80℃ refrigerator was inoculated on LB solid medium and streaked, and then cultured at 32℃ overnight to activate the aerophilic Bacillus NQPG-1 strain. The activated single colony was picked and added to the LB seed medium, cultured at 32℃ overnight, and then inoculated at a 5% v / v inoculum into 100mL of a shake flask fermentation medium containing 60g / L molasses as a carbon source, and cultured at 32℃ and 200rpm for 72h. It was determined that when the fermentation broth OD 600 When =22.5, the highest content of γ-PGA is 13.5g / L, and the molecular weight is about 50~200kDa.

[0088] The shake flask fermentation medium has a formula of: molasses 60 g / L, sodium glutamate 40 g / L, ammonium sulfate 5 g / L, dipotassium hydrogen phosphate trihydrate 5 g / L, potassium dihydrogen phosphate 1 g / L, calcium chloride 1 g / L, zinc sulfate 1.5 g / L, citric acid monohydrate 1 g / L, pH = 7. Each 100 mL is dispensed into a 500 mL shake flask.

[0089] Example 5: 5L fermentation tank experiment of synthesizing γ-PGA by small molecule γ-PGA synthesis strain

[0090] Aerophilic Bacillus NQPG-1 was inoculated into the primary seed culture medium, and cultured at 37°C and 200rpm for 12h to obtain the primary seed liquid. The primary seed liquid was inoculated into the secondary seed culture medium at an inoculum of 8% v / v, and cultured at 37°C and 200rpm for 7h to obtain the secondary seed liquid. The cultured secondary seed liquid was then inoculated into the tertiary fermentation medium at an inoculum of 8% v / v, and the culture conditions were 37°C, 700rpm, flow rate 6L / min, 2M sodium hydroxide solution to adjust the pH to 6.4-7.5, control the dissolved oxygen to not less than 20%, and regularly sample and test. During the fermentation process, 500g / L of sterilized sucrose and 500g / L sodium glutamate were used as feed liquids, and the feed was supplemented four times (based on the evaluation of the consumption rate of sodium glutamate, the feed was supplemented at 18h, 26h, 48h, and 56h), and sucrose and sodium glutamate were supplemented at 23g / L respectively. When the fermentation culture reaches 96 hours, the fermentation liquid is tanked.

[0091] The first-level seed culture medium has a formula of 25 g / L glucose, 10.5 g / L sodium glutamate, 1 g / L dipotassium hydrogen phosphate, 5 g / L fish meal peptone, 0.5 g / L magnesium sulfate heptahydrate, and a natural pH. Each 50 mL is dispensed into a 250 mL flat-bottomed triangular flask.

[0092] The secondary seed culture medium has the following formula: crude glycerol 50 g / L, sucrose 50 g / L, sodium glutamate 40 g / L, ammonium sulfate 5 g / L, dipotassium hydrogen phosphate trihydrate 5 g / L, potassium dihydrogen phosphate 1 g / L, calcium chloride 1 g / L, zinc sulfate 1.5 g / L, citric acid monohydrate 1 g / L, pH = 7. Each 100 mL is dispensed into a 500 mL conical flask.

[0093] The tertiary fermentation medium has the following formula: 50 g / L crude glycerol, 50 g / L sucrose, 40 g / L sodium glutamate, 5 g / L ammonium sulfate, 5 g / L dipotassium hydrogen phosphate trihydrate, 1 g / L potassium dihydrogen phosphate, 1 g / L calcium chloride, 1.5 g / L zinc sulfate, 1 g / L citric acid monohydrate, pH=7.

[0094] The results were as follows Figure 6 As shown, the biomass OD in the fermentation broth 600 It increased rapidly within 12 to 48 hours, and began to slowly decline after 75 hours; the γ-PGA in the fermentation broth maintained an increasing trend within 24 to 75 hours, and began to degrade and decline after 75 hours; a total of 50 g / L of crude glycerol was used in the fermentation, and no residue was left after fermentation; a total of 73 g / L of sucrose was added during the fermentation, and 17 g / L of sucrose remained, with a total consumption of 56 g / L; a total of 63 g / L of precursor sodium glutamate was added during the fermentation, and 8.4 g / L of sodium glutamate remained, with a total consumption of 54.6 g / L. When the fermentation reached 75 hours, OD 600It is 13.82, at this time the γ-PGA content is the highest, which is 54.70g / L, and the γ-PGA molecular weight is 200-300kDa.

[0095] Example 6: 100L fermentation tank experiment of synthesizing γ-PGA by small molecule γ-PGA synthesis strain

[0096] Inoculate aerophilic Bacillus NQPG-1 into the primary seed medium, and culture at 37°C and 200rpm for 12h to obtain the primary seed solution. Inoculate the cultured primary seed solution into the secondary seed medium at an inoculation rate of 8% v / v, and culture at 37°C and 200rpm for 7h to obtain the secondary seed solution. Inoculate the cultured secondary seed solution into the tertiary fermentation medium at an inoculation rate of 8% v / v, and the culture conditions are 37°C, rotation speed: 0-8h, 80rpm; 8-48h, 100rpm, and initial ventilation volume 750m 3 / h, gradually increasing to 2000m3 in the middle of fermentation 3 / h, take samples regularly for testing, adjust the pH to not less than 6.4 with 2M sodium hydroxide solution, control the dissolved oxygen to not less than 20%, when the fermentation reaches 16h (when the residual sugar is less than 30g / L), add the feed culture medium to the fermentation system, control the flow acceleration to 300L / h, when the fermentation reaches 48h, the obtained fermentation liquid is tanked.

[0097] The primary seed culture medium has a formula of 25 g / L glucose, 10.5 g / L sodium glutamate, 1 g / L dipotassium hydrogen phosphate, 5 g / L fish meal peptone, and 0.5 g / L magnesium sulfate heptahydrate, with a pH of 6.5 to 7.0. Each 50 mL is dispensed into a 250 mL flat-bottomed conical flask.

[0098] The secondary seed culture medium has the following formula: crude glycerol 50 g / L, sucrose 50 g / L, sodium glutamate 40 g / L, ammonium sulfate 5 g / L, dipotassium hydrogen phosphate trihydrate 5 g / L, potassium dihydrogen phosphate 1 g / L, calcium chloride 1 g / L, zinc sulfate 1.5 g / L, citric acid monohydrate 1 g / L, pH = 7. Each 100 mL is dispensed into a 500 mL conical flask.

[0099] The tertiary fermentation medium has the following formula: 50 g / L crude glycerol, 50 g / L sucrose, 40 g / L sodium glutamate, 5 g / L ammonium sulfate, 5 g / L dipotassium hydrogen phosphate trihydrate, 1 g / L potassium dihydrogen phosphate, 1 g / L calcium chloride, 1.5 g / L zinc sulfate, 1 g / L citric acid monohydrate, pH=7.

[0100] Feed medium: prepare 500 g / L sucrose feed solution and sterilize at 121°C for 20 min.

[0101] The results were as follows Figure 7As shown in the figure, when the fermentation reached 48h, the residual sugar content was less than 10g / L, the residual sodium glutamate content was less than 10g / L, and the OD 600 is 15.22, so the γ-PGA content is 80.72 g / L and the γ-PGA molecular weight is 200-400 kDa.

[0102] The present invention provides a strain of aerophilic Bacillus and a method for using the same in the preparation of small molecule polyglutamic acid. There are many methods and approaches to implement the technical solution. The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be considered as the scope of protection of the present invention. All components not specified in this embodiment can be implemented using existing technologies.

Claims

1. A strain of aerophilic Bacillus, classified and named Bacillus aerophilus, with strain number NQPG-1, was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on May 24, 2024, with the deposit number CGMCC No.30770.

2. A microbial agent, characterized in that: Contains the aerophilic Bacillus according to claim 1.

3. Use of the aerophilic bacillus according to claim 1 in the preparation of small molecule polyglutamic acid.

4. The use according to claim 3, characterized in that: The small molecule polyglutamic acid has a weight average molecular weight Mw of 20 to 400 kDa.

5. The use according to claim 3, characterized in that: The activated aerophilic bacillus is inoculated into a fermentation medium for fermentation culture to prepare the small molecule polyglutamic acid.

6. The use according to claim 5, characterized in that: The fermentation medium consists of a carbon source, a nitrogen source, glutamate, an inorganic salt, an organic acid and water; Wherein, the carbon source is any one or a combination of glucose, sucrose, glycerol or molasses; The nitrogen source is ammonium sulfate; The glutamate is glutamic acid or sodium glutamate; The inorganic salt includes any one or a combination of potassium ions, calcium ions and zinc ions; The organic acid is citric acid.

7. The use according to claim 6, characterized in that: The concentration of the carbon source is 30-100 g / L; the concentration of the nitrogen source is 5-20 g / L; the concentration of the glutamate is 10-80 g / L; the inorganic salts and their corresponding concentrations are: dipotassium hydrogen phosphate trihydrate 1-20 g / L, potassium dihydrogen phosphate 0.05-2 g / L, calcium chloride 0.05-2 g / L, zinc sulfate 0-2 g / L; the concentration of the organic acid is 0.5-5 g / L.

8. The use according to claim 7, characterized in that: (I) When glucose is used as the carbon source, the molecular weight of the small molecule polyglutamic acid is 20 to 50 kDa; (II) when molasses is used as the carbon source, the molecular weight of the small molecule polyglutamic acid is 50 to 200 kDa; (III) When glycerol and sucrose are used as carbon sources, the molecular weight of the small molecule polyglutamic acid is 200-400 kDa.

9. The use according to claim 5, characterized in that: (i) When the fermentation culture is carried out in a shake flask, the fermentation culture is carried out under the following conditions: 25-40° C., 100-300 rpm, and culture for 24-96 hours; (ii) When fermentation culture is carried out in a 5-7.5 L fermenter, the fermentation culture conditions are: 25-40° C., 700 rpm, flow rate 5-6 L / min, pH 6.4-7.5, dissolved oxygen ≥ 20%; when the consumption rate of sodium glutamate is greater than 0.5 g / L / h, the first feed medium is added. (iii) When fermentation is carried out in a 40-100 L fermenter, the fermentation conditions are: 25-40° C., rotation speed: 80-100 rpm, ventilation volume: 750-2000 m 3 / h, pH 6.4-7.0, dissolved oxygen ≥20%; when the residual sugar is less than 30g / L, the second feed culture medium is added.

10. The use according to claim 9, characterized in that: The first feed medium is 500 g / L sucrose and 500 g / L sodium glutamate; the second feed medium is 500 g / L sucrose, which is added at a constant rate of 300 L / h.

Images