Engineered microorganisms and methods for aromatic amino acid production

Abstract

The present disclosure provides engineered microorganisms capable of biologically producing aromatic amino acids with reduced production of unwanted by-products and / or increased yield or conversion of aromatic amino acids. Methods of making and using the engineered microorganisms, including methods for producing aromatic amino acids, are also provided.

Description

[0001] Cross-references

[0002] This application is based on a patent application with application number PCT / CN2024 / 070048 and application date January 2, 2024, and claims the priority of the PCT patent application. The entire content of the PCT patent application is hereby introduced into this application as a reference. Technical Field

[0003] The present disclosure provides engineered microorganisms capable of bioproducing aromatic amino acids with reduced production of unwanted byproducts and / or increased yield or conversion of aromatic amino acids. Methods of preparing and using the engineered microorganisms are also provided, including methods for producing aromatic amino acids. Background Art

[0004] Aromatic amino acids, including L-tryptophan (L-TRP), L-phenylalanine (L-PHE), and L-tyrosine (L-TYR), are essential amino acids that have a variety of applications in the food and medical industries, such as use as additives to animal feed and food and as ingredients in many drugs. Therefore, there is a high industrial demand for aromatic amino acids.

[0005] Aromatic amino acids are the end products of aromatic biosynthetic pathways, including the shikimic acid (SHK) pathway, which links central carbon metabolism (CCM) with the biosynthesis of chorismic acid (CHA). These pathways exist in bacteria and some eukaryotic organisms (e.g., fungi). However, such microorganisms do not usually naturally overproduce these compounds. In order to achieve production, it is necessary to functionally integrate heterologous pathways or genetically modify naturally occurring pathways.

[0006] Considering the high demand for aromatic amino acids, there remains a need in the art for alternative and improved methods for the bioproduction of aromatic amino acids while reducing the production of unwanted byproducts and / or increasing the efficiency of aromatic amino acid production. SUMMARY OF THE INVENTION

[0007] According to a first aspect, an engineered microbial cell for producing aromatic amino acids is provided, comprising increased carbon flux into a TCA cycle, thereby converting byproducts into CO2 to reduce byproducts.

[0008] In some embodiments, the engineered microbial cell comprises increased acetyl-CoA flux into the TCA cycle, such as comprising overexpression of citrate synthase, such as overexpression of an endogenous gltA gene or heterologous expression of an exogenous gltA gene.

[0009] In some embodiments, the engineered microbial cell further comprises an enhanced phosphoenolpyruvate (PEP) biosynthetic pathway.

[0010] In certain embodiments, the engineered microbial cell comprises increased activity of phosphoenolpyruvate synthase to enhance conversion of pyruvate to PEP, such as by overexpression of endogenous ppsA or heterologous expression of an exogenous ppsA gene.

[0011] In other embodiments, the engineered microbial cell comprises increased activity of pyruvate carboxylase and PEP carboxykinase to enhance the conversion of pyruvate to PEP, for example, by overexpression of an endogenous or exogenous pyc gene and a combination of an endogenous or exogenous pck gene, for example, by overexpression of endogenous pyc and pck genes or heterologous expression of exogenous pyc and pck genes, or, by overexpression of an endogenous pck gene and heterologous expression of an exogenous pyc gene (e.g., from Cytobacillus firmus).

[0012] In some embodiments, the engineered microbial cell further expresses a futile cycle. In some embodiments, the futile cycle comprises at least overexpression of fructose-1,6-bisphosphatase, such as overexpression of an endogenous fbp gene or heterologous expression of an exogenous fbp gene (e.g., from Drosophila melanogaster).

[0013] In some embodiments, the engineered microbial cell comprises overexpression of the gltA gene and heterologous expression of an exogenous fbp gene (eg, from Drosophila melanogaster), or overexpression of the gltA gene and overexpression of an endogenous fbp gene.

[0014] In some embodiments, the engineered microbial cell further comprises an acetic acid and / or lactic acid production pathway that is blocked or reduced. In some embodiments, the engineered microbial cell comprises an activity of a reduction of one or more enzymes selected from phosphate acetyltransferase, pyruvate dehydrogenase, lactate dehydrogenase or any combination thereof; For example, by deleting, knocking out or knocking down one or more genes selected from pta, poxB, ldhA or any combination thereof, or transforming or replacing pta, poxB, ldhA or any combination thereof to comprise rare codons to achieve.

[0015] In some embodiments, any of the foregoing engineered microbial cells described herein optionally may further comprise one or more additional genetic modifications that promote or optimize the biosynthesis of aromatic amino acids.

[0016] In some embodiments, the above-mentioned engineered microbial cell also comprises the oxaloacetate biosynthetic pathway of blocking or reducing.In some embodiments, the engineered microbial cell comprises the activity of the phosphoenolpyruvate carboxylase (phosphoenolpyruvate carboxylase) that reduces, for example, by deleting, knocking out or knocking down ppc or transforming or replacing endogenous ppc gene to realize to comprise rare codon.

[0017] In some embodiments, the engineered microbial cell further comprises an ineffective naturally occurring phosphotransferase transport (PTS) system. In some embodiments, the engineered microbial cell comprises a reduced activity of one or more PTS system proteins, for example, by deleting, knocking out or knocking down one or more genes selected from ptsH, ptsI, crr, ptsG or any combination thereof, or modifying or replacing endogenous ptsH, ptsI, crr, ptsG genes or any combination thereof to include rare codons. In some embodiments, the engineered microbial cell further comprises an increased activity of at least one non-PTS sugar transporter, for example, overexpression of endogenous non-PTS sugar transporters or heterologous expression of exogenous non-PTS sugar transporters such as glucose facilitator (Glf) (e.g., from Zymomonas mobilis). In some embodiments, the engineered microbial cell further comprises increased glucokinase activity, such as overexpression of an endogenous glk gene or heterologous expression of an exogenous glk gene (e.g., from Zymomonas mobilis). In some embodiments, the engineered microbial cell comprises: one or more gene deletions, knockouts, or knockdowns selected from ptsH, ptsI, crr, ptsG, or any combination thereof, or modification or replacement of endogenous ptsH, ptsI, crr, ptsG genes, or any combination thereof to include rare codons; and overexpression of an endogenous glf gene or heterologous expression of an exogenous glk gene (e.g., from Zymomonas mobilis).

[0018] In some embodiments, at least one or more optional modifications may be combined to obtain an engineered microbial cell with desired properties. Thus, in some embodiments, the engineered microbial cell comprises:

[0019] (i) overexpression of an endogenous gltA gene or heterologous expression of an exogenous gltA gene; and

[0020] (ii) overexpression of endogenous ppsA, pyc, pck genes or any combination thereof or heterologous expression of exogenous ppsA, pyc, pck genes or any combination thereof;

[0021] Optionally, the engineered microbial cell further comprises any of the following:

[0022] (iii) overexpression of endogenous fbp gene or heterologous expression of exogenous fbp gene;

[0023] (iv) deletion, knockout or knockdown of endogenous pta, poxB, ldhA or any combination thereof;

[0024] (v) deletion, knockout or knockdown of endogenous ppc gene;

[0025] (vi) deletion, knockout or knockdown of endogenous ptsH, ptsI, crr, ptsG or any combination thereof;

[0026] (vii) overexpression of endogenous glf gene or glk gene or heterologous expression of exogenous glf gene or glk gene;

[0027] (viii) Any combination of (iii)-(vii).

[0028] Any aforementioned engineered microbial cell described herein can be bacterium, fungi or yeast.In some embodiments, the engineered microbial cell is Escherichia coli (Escherichia coli), Corynebacterium glutamicum (Corynebacterium glutamicum), Bacillus subtilis (Bacillus subtilis) or Bacillus licheniformis (Bacillus licheniformi).

[0029] According to a second aspect, there is also provided use of any of the aforementioned engineered microbial cells described herein in the biosynthesis of aromatic amino acids.

[0030] According to a third aspect, a method for producing an aromatic amino acid is also provided, comprising culturing any of the aforementioned engineered microbial cells described herein in a culture medium. In some embodiments, the method further comprises recovering the aromatic amino acid from the culture.

[0031] According to a fourth aspect, there is also provided a method for reducing the production of by-products and / or increasing the yield or conversion rate of aromatic amino acids in aromatic amino acid biosynthesis, comprising introducing a genetic modification as defined in the first aspect into a microbial cell having an aromatic amino acid biosynthetic pathway.

[0032] Further features and advantages of certain embodiments of the present disclosure will become more apparent from the following description of the embodiments and their accompanying drawings, and from the claims.

[0033] BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 Overexpression of ppsA increased tryptophan production and decreased acetate accumulation.

[0035] Figure 2 Overexpression of ppsA and gltA increased tryptophan production and decreased acetate accumulation.

[0036] Figure 3 Overexpression of the pck and pyc genes converts the byproduct pyruvate into phosphoenolpyruvate.

[0037] Figure 4 Knockout of .pta and poxB genes increases the conversion rate of tryptophan. DETAILED DESCRIPTION OF THE INVENTION

[0038] definition

[0039] The genes disclosed in the present disclosure are all known in the art and their sequences are available from public databases. The following exemplary sequences of genes and gene products are provided.

[0040]

[0041]

[0042]

[0043] Abbreviations used herein have their conventional meanings in the fields of chemistry and biology. Some abbreviations used herein are as follows: aromatic amino acids (AAA), tryptophan (TRP), phenylalanine (PHE), tyrosine (TYR), phosphoenolpyruvate (phosphoenolpyruvate, PEP), chorismate (chorismate, CHA), pyruvic acid (PYR), erythrose-4-phosphate (erythrose-4-phosphate, E4P), pentose phosphate pathway (HMP), tricarboxylic acid cycle (TCA), phosphoenolpyruvate: sugar phosphotransferase system (phosphoenolpyruvate: sugar phosphotransferase system, PTS).

[0044] In the present disclosure, unless otherwise indicated, any concentration range, percentage range, ratio range or integer range should be understood to include the value of any integer in the range, and, where appropriate, fractions thereof. Unless otherwise indicated, the term "about" used herein refers to ±10% (e.g., ±5%, ±2% or ±1%) of the indicated range or value. It should be understood that the terms "one" and "a" used herein refer to "one or more / one or more" of the listed components. The use of alternatives (e.g., "or") should be understood to mean one, two, or any combination thereof in the alternatives.

[0045] In the present disclosure, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In order to better understand the present disclosure, the definitions and explanations of the terms are provided below.

[0046] As used herein, the term "aromatic amino acid" refers to tryptophan (TRP), phenylalanine (PHE) and tyrosine (TYR). In general, the amino acids synthesized by an organism can be in L-configuration. Therefore, in some embodiments of the present invention, tryptophan, phenylalanine and tyrosine are in L-configuration. In the examples herein, the advantages of the engineered microbial cells of the present invention are shown by taking tryptophan as an example. However, it is easy to understand that the engineered microbial cells of the present invention can also be used to produce other aromatic amino acids, such as phenylalanine (PHE) and tyrosine (TYR).

[0047] As used herein, the term "by-product" refers to other substances that are produced along with or simultaneously with the process (e.g., biosynthesis) of the target product. Typically, these other substances are undesirable or unwanted. For example, in the biosynthesis of aromatic amino acids, by-products may include organic acids (e.g., acetic acid, oxaloacetic acid) and / or their precursors (e.g., pyruvic acid).

[0048] As used herein, the term "futile cycle" refers to at least two metabolic cycles or pathways that, when run simultaneously in opposite directions, do nothing other than consume energy in the form of ATP hydrolysis.

[0049] As used herein, the term "endogenous" refers to a nucleic acid or protein present in or expressed in a wild-type or parental microorganism from which the engineered microorganism disclosed herein is derived. For example, an endogenous gene is a gene naturally present in a wild-type or parental microorganism from which the engineered microorganism disclosed herein is derived. In one embodiment, the expression of an endogenous gene can be controlled by an exogenous regulatory element, such as an exogenous promoter.

[0050] As used herein, the term "exogenous" refers to nucleic acids or proteins derived from the outside of the engineered microorganism disclosed herein. For example, an exogenous gene or enzyme can be artificially or recombinantly produced and introduced into the engineered microorganism disclosed herein or expressed therein. An exogenous gene or enzyme can also be separated from a heterologous microorganism and introduced into the engineered microorganism disclosed herein or expressed therein. Exogenous nucleic acids can be adapted to be integrated into the genome of the engineered microorganism disclosed herein or to maintain an extrachromosomal state in the engineered microorganism disclosed herein, for example, in a plasmid.

[0051] As used herein, the term "heterologous" refers to a nucleic acid or protein that is not present in the wild type or parent microorganism from which the engineered microorganism disclosed herein is derived. For example, a heterologous gene or enzyme can be derived from different strains or species and introduced into or expressed in the engineered microorganism disclosed herein. A heterologous gene or enzyme can be introduced into or expressed in the engineered microorganism disclosed herein in the form in which it appears in different strains or species. Alternatively, a heterologous gene or enzyme can be modified in some way, such as by optimizing its codon for expression in the engineered microorganism disclosed herein or by engineering it to change function, such as reversing the direction of enzymatic activity or changing substrate specificity.

[0052] As used herein, the term "heterologous expression" involves the introduction of a gene encoding a protein of interest from one species or cell into another species or cell, thereby allowing the host cell to express the foreign protein.

[0053] As used herein, the term "microbe," "microorganism," or "microbial cell" means any organism that exists in microscopic cellular form, including within the realms of archaea, bacteria, or eukaryotes. Thus, the term is intended to encompass prokaryotic or eukaryotic cells or organisms of microscopic size, and includes bacteria, archaea, and eubacteria of all species, as well as eukaryotic microorganisms such as yeast and fungi.

[0054] As used herein, the term "host" refers to a cell or microorganism that can be genetically modified, for example, by mutation, use of exogenous nucleic acid molecules, by knockout or a combination thereof, to improve the production of aromatic amino acids relative to an unmodified host cell. In certain embodiments, the host cell may optionally already have other genetic modifications that confer other desired properties.

[0055] As used herein, the term "parental cell" refers to a cell having the same genetic background as the host cell disclosed herein, except that it does not include a specific genetic modification (e.g., mutation or knockout of endogenous nucleic acids, introduction of exogenous or heterologous nucleic acids, or a combination thereof), and it serves as a starting point for introducing the genetic modification, resulting in the host cell disclosed herein. In addition, it is easy to understand that when describing a relative change (e.g., blocking, reducing, weakening, knocking down, enhancing, improving, increasing, etc.) of a substance such as a gene or protein or pathway, if no reference object is specified, the reference object can be a corresponding substance such as a gene or protein or pathway in a wild-type cell or a parental cell.

[0056] As used herein, the term "overexpression" refers to a level of gene expression or gene product in a non-natural or recombinant microorganism that is higher than that found in a parent or wild-type microorganism when grown under the same conditions. In certain embodiments, overexpression can occur at the transcriptional level, translational level, or both, which can be due to altered regulatory control (e.g., using a strong promoter) or an increase in copy number, or both.

[0057] As used herein, the terms "delete", "knockout", and "knock down" have the meanings commonly understood by those skilled in the art. The term "delete" refers to the removal or destruction of a specific gene in the genome of an organism so that the gene cannot be normally expressed, transcribed or translated. The term "knockout" refers to the complete deletion or inactivation of the DNA sequence of the target gene from a cell or organism, blocking its transcription and translation processes, and completely losing the function of the target gene. The deletion or knockout of endogenous genes can be achieved by any gene editing system known in the art, such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), or clustered regularly interspaced short palindromic repeats (CRISPR). The term "knock down" refers to reducing the expression level of a target gene by gene silencing in a cell or organism, resulting in a temporary change in expression. Exemplary gene silencing methods include, but are not limited to, RNA interference (RNAi), small interfering RNA (siRNA), or short hairpin RNA (shRNA), which is used to inactivate the messenger RNA of a specific gene and effectively inhibit the expression of the gene.

[0058] As used herein, the term "rare codon" refers to a codon encoding an amino acid that is used less frequently during gene expression in a particular species or cell. For example, when expressing a foreign gene in E. coli, the rare codons that are less used by E. coli will reduce the availability of cognate tRNA, thereby reducing the expression efficiency and level of the protein. For a particular species or cell, those skilled in the art can easily determine the rare codons using various analytical tools (e.g., bioinformatics tools).

[0059] As used herein, the term "vector" refers to a nucleic acid vector into which a polynucleotide can be inserted. When a vector allows expression of a protein encoded by a polynucleotide inserted therein, the vector is referred to as an expression vector. A vector may have genetic material elements carried and expressed in a host cell by transformation, transduction or transfection into a host cell. Vectors are well known to those skilled in the art, including but not limited to plasmids, bacteriophages, cosmids, artificial chromosomes such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC) or P1-derived artificial chromosomes (PAC); bacteriophages such as lambda phages or M13 phages and animal viruses. Animal viruses that can be used as vectors include but are not limited to retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (such as herpes simplex viruses), poxviruses, baculoviruses, papillomaviruses, papovaviruses (such as SV40). A vector may include multiple elements for controlling expression, including but not limited to promoter sequences, transcription initiation sequences, enhancer sequences, selection elements and reporter genes. In addition, a vector may include an origin of replication.

[0060] As used herein, the term "homolog" describes those nucleotide sequences that have sequence similarity and encode polypeptides that share at least one functional characteristic (e.g., biochemical activity), or those polypeptides that have sequence similarity and simultaneously have at least one functional similarity (e.g., biochemical activity).

[0061] As used herein, the term "ortholog" refers to a homologous gene or protein that is equivalent to a gene or protein function referenced in another species. Orthologous sequences are homologous sequences in different species, which are derived from the vertical descent of a single sequence of the last common ancestor, wherein the sequence and its primary function are conservative. Homologous sequences are sequences inherited by a common ancestor in two species. When referring to an amino acid or nucleotide / nucleic acid sequence from a given species, the term "ortholog" refers to the same amino acid or nucleotide / nucleic acid sequence from different species. It should be understood that when two sequences are derived from a common ancestor sequence by linear descent and / or are closely related in terms of their sequence and their biological function, they are orthologs to each other. Orthologs will generally have a high degree of sequence identity, but may not (and usually will not) have a total of 100% sequence identity.

[0062] As used herein, the term "paralog" describes a homologous sequence derived from a sequence duplication event. Paralogous sequences usually belong to the same species, but this is not essential. Paralogs can be divided into in-paralogs (paralogs to occur after the speciation event) and out-paralogs (paralogs to occur before the speciation event). Out-paralogs between species are paralogs to be present between two organisms due to duplication before speciation. Out-paralogs within species are paired paralogs present in the same organism, but their duplication events occur after speciation. Paralogs have identical or similar functions usually.

[0063] As used herein, the term "variant" is a polynucleotide or polypeptide that is different from a reference polynucleotide or polypeptide, but retains basic properties. Typical variants of polynucleotides are different from another reference polynucleotide in nucleotide sequence. Changes in the nucleotide sequence of the variant may or may not change the amino acid sequence of the polypeptide encoded by the reference polynucleotide. Typical variants of polypeptides are different from another reference polypeptide in amino acid sequence. In general, the difference is limited, so that the sequences of the reference polypeptide and the variant are generally very similar and are identical in many regions. Variant and reference polypeptide may differ in amino acid sequence due to one or more substitutions, additions, deletions in any combination. The variant of a polynucleotide or polypeptide may be naturally occurring, such as an allelic variant, or it may be an unknown naturally occurring variant. Non-naturally occurring variants of polynucleotides and polypeptides can be prepared by mutagenesis techniques, by direct synthesis, and by other recombinant methods known to those skilled in the art. Due to the retention of basic properties (or functional properties), variants are also referred to as functional variants or functional equivalent variants in this article.

[0064] As used herein, the term "identity" refers to a measure of similarity between nucleotide sequences or amino acid sequences. In general, sequences are aligned to obtain maximum matches. "Identity" has a meaning well known in the art and can be calculated by a disclosed algorithm (e.g., BLAST).

[0065] Engineering microorganisms to produce AAA

[0066] The present disclosure provides engineered microbial cells to promote or optimize the biosynthesis of aromatic amino acids. The engineered microbial cells may have modified or modified biosynthetic pathways, such as an increased TCA cycle, an enhanced PEP biosynthetic pathway, an enhanced or introduced ineffective cycle, a blocked or reduced acetic acid and / or lactic acid production pathway, a blocked or reduced oxaloacetate biosynthetic pathway, a modified PTS transport system, or any combination thereof.

[0067] 1. Increased TCA cycle

[0068] According to some embodiments, the present disclosure improves the production efficiency of aromatic amino acids by at least reducing byproducts by converting the byproducts into CO 2. The byproducts may include organic acids (e.g., acetic acid, oxaloacetic acid) and / or their precursors (e.g., pyruvic acid).

[0069] In certain aspects, provided herein are engineered microbial cells that produce aromatic amino acids, comprising an increased carbon flux into the TCA cycle, thereby converting byproducts to CO2 to reduce byproducts. The tricarboxylic acid cycle (TCA) is a series of biochemical reactions that produces energy in the form of ATP through the oxidation of acetyl-CoA derived from carbohydrates, fats, and proteins.

[0070] In some embodiments, the engineered microbial cell comprises an increased acetyl-CoA flux into the TCA cycle, for example, achieved by overexpression of citrate synthase. In some embodiments, the engineered microbial cell comprises overexpression of an endogenous gene encoding citrate synthase, the endogenous gene comprising a gltA gene or a species homolog thereof (e.g., an ortholog or paralog). In some embodiments where the microbial cell is Escherichia coli, the endogenous gltA gene is overexpressed.

[0071] As used herein, the term "by-product" refers to other substances that are produced along with or simultaneously with the process (e.g., biosynthesis) of the target product. Typically, these other substances are undesirable or unwanted. For example, in the biosynthesis of aromatic amino acids, by-products may include organic acids (e.g., acetic acid, oxaloacetic acid) and / or their precursors (e.g., pyruvic acid).

[0072] 2. Enhanced PEP biosynthetic pathway

[0073] In some embodiments, the engineered microbial cell with increased carbon flux into the TCA cycle may also comprise an enhanced phosphoenolpyruvate (PEP) biosynthetic pathway, for example from pyruvate and / or malate.

[0074] In some embodiments, the flux of carbon to phosphoenolpyruvate (PEP) can be enhanced to increase the availability of PEP for aromatic amino acid biosynthesis.

[0075] In some embodiments, the enhanced PEP biosynthetic pathway includes increased phosphoenolpyruvate synthase activity to enhance the conversion from pyruvate to PEP. The increased activity can be achieved, for example, by overexpression of endogenous genes encoding enzymes, the endogenous genes including ppsA genes or their species homologs (e.g., straight homologs or paralogs), or by heterologous expression of exogenous ppsA genes. In some embodiments where the microbial cell is Escherichia coli, the endogenous ppsA gene is overexpressed. In some embodiments where the microbial cell is Escherichia coli, the exogenous ppsA gene is heterologously expressed.

[0076] In some embodiments, the enhanced PEP biosynthetic pathway includes the increased activity of pyruvate carboxylase and PEP carboxykinase to enhance the conversion from pyruvate to PEP. The increased activity can be realized, for example, by the overexpression of endogenous or exogenous pyc gene and endogenous or exogenous pck gene combination, for example, by the overexpression of endogenous genes encoding enzymes, the endogenous genes include pyc and pck genes or their species homologues (such as orthologues or paralogues), or by the heterologous expression of exogenous pyc and pck genes (such as from the exogenous pyc gene of Bacillus firmus). For example, in some embodiments, the increased activity can be realized by the overexpression of endogenous genes pyc genes encoding pyruvate carboxylase or their species homologues (such as orthologues or paralogues), or by the heterologous expression of exogenous pyc genes (such as from the exogenous pyc gene of Bacillus firmus). In some embodiments, the increased activity can be achieved by overexpression of an endogenous gene pck gene encoding a PEP carboxykinase or a species homolog thereof (e.g., a direct homolog or a paralog), or by heterologous expression of an exogenous pck gene. In some embodiments where the microbial cell is Escherichia coli, the endogenous pyc and pck genes are overexpressed. In some embodiments where the microbial cell is Escherichia coli, the endogenous pck gene is overexpressed and an exogenous pyc gene (e.g., from Bacillus firmus) is introduced.

[0077] In some embodiments, the engineered microbial cell comprises: (i) overexpression of an endogenous gltA gene; optionally, the engineered microbial cell further comprises (ii) overexpression of an endogenous ppsA, pyc, pck gene or any combination thereof or heterologous expression of an exogenous ppsA, pyc, pck gene or any combination thereof.

[0078] In some embodiments, the engineered microbial cell comprises: (i) overexpression of an endogenous gltA gene; (ii) overexpression of an endogenous ppsA; and (iii) overexpression of an endogenous ppsA, pyc, pck gene, or any combination thereof or heterologous expression of an exogenous ppsA, pyc, pck gene, or any combination thereof.

[0079] In some embodiments, the engineered microbial cell comprises: (i) overexpression of an endogenous gltA gene; (ii) overexpression of an endogenous ppsA; (iii) overexpression of an endogenous pck gene; and (iv) heterologous expression of an exogenous pyc gene (e.g., from Bacillus firmus).

[0080] 3. Introduction or enhancement of invalid loops

[0081] In some embodiments, the engineered microbial cell also expresses an ineffective cycle (e.g., an ineffective cycle for reducing ATP levels due to an enhanced TCA cycle). An ineffective cycle may include at least two metabolic cycles or pathways that, when run simultaneously in opposite directions, do not produce any effect except consuming energy in the form of ATP hydrolysis. Therefore, one or more ineffective cycles are introduced into the microbial cell to reduce ATP levels due to an enhanced TCA cycle.

[0082] In some embodiments, the ATP level of the TCA cycle due to the enhancement is reduced by introducing a coding gene for an enzyme that catalyzes the reaction of consuming ATP. For example, the enzyme that catalyzes the reaction of consuming ATP includes but is not limited to: phosphofructokinase, pyruvate carboxylase.

[0083] In some embodiments, the ineffective cycle includes the simultaneous expression of fructose-1,6-bisphosphatase and phosphofructokinase. Phosphofructokinase catalyzes the conversion of D-fructose-6-phosphate to D-fructose-1,6-bisphosphate. In contrast, fructose 1,6-bisphosphatase catalyzes the hydrolysis of D-fructose-1,6-bisphosphate to D-fructose-6-phosphate in a reaction that consumes one molecule of ATP. Therefore, the simultaneous expression of the two enzymes results in the consumption of ATP.

[0084] In certain embodiments, the ineffective cycle comprises simultaneous overexpression of fructose-1,6-bisphosphatase and phosphofructokinase. In some embodiments, the engineered microbial cell comprises overexpression of endogenous genes encoding fructose-1,6-bisphosphatase and phosphofructokinase, the endogenous genes including fbp and pfk genes or their species homologs (e.g., orthologs or paralogs), or heterologous expression of exogenous fbp (e.g., from Drosophila melanogaster) and exogenous pfk genes. In some embodiments where the microbial cell is Escherichia coli, endogenous fbp and pfk genes are overexpressed.

[0085] In other embodiments, the ineffective cycle at least includes overexpression of fructose-1,6-bisphosphatase, such as overexpression of endogenous fbp gene or heterologous expression of exogenous fbp gene (e.g., from Drosophila melanogaster). In some embodiments, the ineffective cycle also includes overexpression of endogenous phosphofructokinase, such as overexpression of endogenous pfk gene.

[0086] In some embodiments, the futile cycle comprises overexpression of pyruvate carboxylase. Pyruvate carboxylase catalyzes the conversion of pyruvate into oxaloacetate while consuming one molecule of ATP. Therefore, expression of pyruvate carboxylase results in ATP consumption.

[0087] In certain embodiments, the ineffective cycle comprises overexpression while pyruvate carboxylase and PEP carboxykinase. Pyruvate carboxylase catalyzes pyruvate to be converted into oxaloacetate, while consuming a molecule of ATP. PEP carboxykinase catalyzes oxaloacetate to form phosphoenolpyruvate and carbon dioxide. Therefore, the simultaneous expression of two enzymes causes the consumption of ATP, while maintaining the pyruvate generated to enter the PEP generation pathway. In some embodiments, the engineered microbial cell comprises the increased activity of pyruvate carboxylase and PEP carboxykinase. The increased activity can be realized, for example, by the overexpression of endogenous or exogenous pyc gene and endogenous or exogenous pck gene combination, for example, by the overexpression of endogenous genes of encoding enzymes, the endogenous genes include pyc and pck genes or their species homologues (for example, orthologues or paralogues), or by the heterologous expression of exogenous pyc and pck genes (for example, exogenous pyc genes from Bacillus firmus). In some embodiments where the microbial cell is E. coli, an exogenous pyc gene (eg, from Bacillus firmus) is heterologously expressed and an endogenous pck gene is overexpressed.

[0088] In some embodiments, the engineered microbial cell with increased carbon flux into the TCA cycle comprises overexpression of the gltA gene and heterologous expression of an exogenous fbp gene (e.g., from Drosophila melanogaster), or comprises overexpression of the gltA gene and overexpression of an endogenous fbp gene.

[0089] In some embodiments, the engineered microbial cell comprises: (i) overexpression of an endogenous gltA gene; optionally, the engineered microbial cell further comprises (ii) heterologous expression of an exogenous fbp gene (e.g., from Drosophila melanogaster); (iii) overexpression of endogenous ppsA, pyc, pck genes or any combination thereof or heterologous expression of exogenous ppsA, pyc, pck genes or any combination thereof.

[0090] 4. Blocked or reduced acetate and / or lactate production pathways

[0091] The accumulation of acetic acid and / or lactic acid leads to an inhibitory effect on microbial growth and thus limits the production efficiency of aromatic amino acids. Therefore, reducing the accumulation of acetic acid and / or lactic acid will be beneficial to the production of aromatic amino acids.

[0092] In some embodiments, the engineered microbial cell as described above further comprises a blocked or reduced acetate and / or lactate production pathway.

[0093] In some embodiments, the engineered microbial cell comprises a reduced activity of one or more enzymes selected from phosphate acetyltransferase, pyruvate dehydrogenase, lactate dehydrogenase or any combination thereof. In some embodiments, the reduced activity can be achieved by, for example, deleting, knocking out or knocking down one or more endogenous genes encoding one or more enzymes, or transforming or replacing one or more endogenous genes encoding one or more enzymes to include rare codons, the endogenous genes comprising pta, poxB, ldhA genes or their species homologues (e.g., orthologues or paralogues). In some embodiments where the microbial cell is Escherichia coli, one or more genes selected from pta, poxB and / or ldhA are deleted, knocked out or knocked down.

[0094] In some embodiments, the engineered microbial cell comprises: (i) overexpression of an endogenous gltA gene; optionally, the engineered microbial cell further comprises (ii) deletion, knockout or knockdown of endogenous pta, poxB, ldhA or any combination thereof.

[0095] In some embodiments, the engineered microbial cell comprises: (i) overexpression of the endogenous gltA gene; optionally, the engineered microbial cell further comprises (ii) deletion, knockout or knockdown of endogenous pta, poxB, ldhA or any combination thereof; (iii) overexpression of endogenous ppsA, pyc, pck genes or any combination thereof or heterologous expression of exogenous ppsA, pyc, pck genes or any combination thereof.

[0096] 5. Other genetic modifications

[0097] In any of the aforementioned engineered microbial cells, one or more other genetic modifications that promote or optimize aromatic amino acid biosynthesis can also be introduced. For example, strategies that allow for higher PEP availability for aromatic amino acid biosynthesis can be used, including (i) limiting carbon flow from phosphoenolpyruvate (PEP) to oxaloacetate, (ii) replacing the glucose transport and phosphorylation capacity of the phosphotransferase (PTS) transport system by alternative enzymes, and / or (iii) improving the recycling of pyruvate (PYR) to PEP. For example, methods that reduce the accumulation of acetate and / or lactate can also be used to overcome the inhibition of microbial growth.

[0098] I. Oxaloacetate biosynthetic pathway

[0099] In some embodiments, the engineered microbial cell as described above further comprises a blocked or reduced oxaloacetate biosynthetic pathway to limit carbon flow from phosphoenolpyruvate (PEP) to oxaloacetate.

[0100] In some embodiments, the through engineering approaches microbial cell comprises the activity of the phosphoenolpyruvate carboxylase that reduces.In some embodiments, the activity of the phosphoenolpyruvate carboxylase that reduces can for example be realized by deleting, knocking out or striking the endogenous gene of low coding phosphoenolpyruvate carboxylase or transforming or replacing the endogenous gene of coding phosphoenolpyruvate carboxylase to comprise rare codon, and the endogenous gene comprises ppc gene or its species homologue (for example, directly to homologue or paralog).In some embodiments that the microbial cell is escherichia coli, endogenous ppc gene is deleted, knocks out or strikes low.

[0101] In some embodiments, the engineered microbial cell comprises: (i) overexpression of an endogenous gltA gene; optionally, the engineered microbial cell further comprises (ii) deletion, knockout or knockdown of an endogenous ppc gene.

[0102] In some embodiments, the engineered microbial cell comprises: (i) overexpression of the endogenous gltA gene; optionally, the engineered microbial cell further comprises (ii) deletion, knockout or knockdown of the endogenous ppc gene; (iii) overexpression of endogenous ppsA, pyc, pck genes or any combination thereof or heterologous expression of exogenous ppsA, pyc, pck genes or any combination thereof.

[0103] II.PTS Transshipment System

[0104] The phosphotransferase (PTS) transport system is widely present in bacteria, fungi and some archaea, and is the main system for the transport and phosphorylation of glucose from the periplasmic space to the cytoplasmic environment, in which a PEP molecule is consumed and converted to pyruvate (PYR). In order to prevent the loss of PEP to the PTS system and to increase the availability of PEP in the cell, the naturally occurring PTS system can be disabled. Therefore, in order to maintain the ability of engineered microbial cells to use a certain sugar (such as glucose) as a carbon source and energy source, it is necessary to express or overexpress an input protein that is independent of phosphoenolpyruvate:sugar phosphotransferase. In addition, the expression or overexpression of a kinase that can phosphorylate the certain sugar may also be required, or reduced and / or weakened, to respectively achieve the metabolism of the sugar or its accumulation in a non-phosphorylated form in the cell.

[0105] In some embodiments, the engineered microbial cell as described above further comprises an inactivated naturally occurring phosphotransferase (PTS) transport system. In some embodiments, the inactivated naturally occurring PTS transport system comprises a reduced activity of one or more PTS system proteins. In some embodiments, the PTS system proteins comprise soluble non-sugar specific protein component enzyme I (EI, ptsI) and histidine protein (HPr, ptsH), soluble glucose specific enzyme IIA Glc (crr) and membrane-integrated glucose-specific permease IICB Glc (ptsG).

[0106] In some embodiments, the ineffective PTS transport system is achieved by deleting, knocking out or knocking down one or more genes selected from ptsH, ptsI, crr, ptsG or their species homologs (e.g., orthologs or paralogs) or any combination thereof. In some embodiments where the microbial cell is E. coli, one or more genes selected from ptsH, ptsI, crr, ptsG are deleted, knocked out or knocked down.

[0107] In some embodiments, the ineffective PTS transport system is achieved by deleting, knocking out or knocking down the ptsI and / or ptsG genes or their species homologs (e.g., orthologs or paralogs). In some embodiments where the microbial cell is E. coli, the ptsI and / or ptsG genes are deleted, deleted or knocked down.

[0108] In some embodiments, the engineered microbial cell comprises: (i) overexpression of an endogenous gltA gene; optionally, the engineered microbial cell further comprises (ii) deletion, knockout or knockdown of endogenous ptsH, ptsI, crr, ptsG or any combination thereof.

[0109] In some embodiments, the engineered microbial cell comprises: (i) overexpression of the endogenous gltA gene; optionally, the engineered microbial cell further comprises (ii) deletion, knockout or knockdown of endogenous ptsH, ptsI, crr, ptsG or any combination thereof; (iii) overexpression of endogenous ppsA, pyc, pck genes or any combination thereof or heterologous expression of exogenous ppsA, pyc, pck genes or any combination thereof.

[0110] In some embodiments, the engineered microbial cell also comprises an increased activity of at least one non-PTS sugar transporter. Suitable non-PEP-PTS transporters capable of transferring monosaccharides (glucose and / or fructose and / or galactose and / or N-acetylglucosamine and / or N-acetylneuraminic acid and / or fucose) to microbial cells are known to those skilled in the art, such as glf of Zymomonas mobilis.

[0111] In some embodiments, increased activity is achieved by overexpression of an endogenous non-PTS sugar transporter.

[0112] In some embodiments, increased activity is achieved by heterologous expression of an exogenous non-PTS sugar transporter, such as the glucose facilitating protein (glf) of Zymomonas mobilis.

[0113] In some embodiments, the engineered microbial cell also comprises the activity of the increase of glucokinase.In some embodiments, the activity of the increase of glucokinase can be realized by the overexpression of the endogenous gene of for example encoding enzyme, and the endogenous gene comprises glk gene or its species homologue (for example, orthologue or paralogue), or realizes by the heterologous expression of exogenous glk gene (for example from zymomonas mobilis).In some embodiments that microbial cell is Escherichia coli, endogenous glk gene is overexpressed, or introduces exogenous glk gene (for example, from zymomonas mobilis).

[0114] In some embodiments, the engineered microbial cell comprises: (i) overexpression of an endogenous gltA gene; optionally, the engineered microbial cell further comprises (ii) overexpression of an endogenous glf gene or glk gene or heterologous expression of an exogenous glf gene or glk gene.

[0115] In some embodiments, the engineered microbial cell comprises: (i) overexpression of an endogenous gltA gene; optionally, the engineered microbial cell further comprises (ii) overexpression of an endogenous glf gene or glk gene or heterologous expression of an exogenous glf gene or glk gene; (iii) overexpression of an endogenous ppsA, pyc, pck gene or any combination thereof or heterologous expression of an exogenous ppsA, pyc, pck gene or any combination thereof.

[0116] In some embodiments, the engineered microbial cell comprises an ineffective naturally occurring phosphotransferase (PTS) transport system; and increased activity of at least one non-PTS sugar transporter. In some embodiments where the microbial cell is E. coli, one or more genes selected from ptsH, ptsI, crr, ptsG, or any combination thereof are deleted, knocked out, or knocked down, or endogenous ptsH, ptsI, crr, ptsG genes, or any combination thereof are modified or replaced to include rare codons; and overexpression of endogenous or exogenous glf genes or heterologous expression of endogenous or exogenous glk genes (e.g., from Zymomonas mobilis).

[0117] In some embodiments, the engineered microbial cell comprises: (i) overexpression of the endogenous gltA gene; optionally, the engineered microbial cell further comprises (ii) overexpression of the endogenous glf gene or glk gene or heterologous expression of the exogenous glf gene or glk gene, and deletion, knockout or knockdown of the endogenous ptsH, ptsI, crr, ptsG or any combination thereof; (iii) overexpression of the endogenous ppsA, pyc, pck gene or any combination thereof or heterologous expression of the exogenous ppsA, pyc, pck gene or any combination thereof.

[0118] Exemplary Engineered Microorganisms

[0119] Exemplary embodiments of engineered microbial cells provided herein include, but are not limited to, the following.

[0120] In some embodiments, provided herein is an engineered microbial cell, and at least one or more optional modifications can be combined to obtain an engineered microbial cell having desired properties.

[0121] In some embodiments, provided herein is an engineered microbial cell comprising:

[0122] (i) overexpression of endogenous gltA gene or heterologous expression of exogenous gltA gene;

[0123] Optionally, the engineered microbial cell further comprises any of the following:

[0124] (ii) overexpression of endogenous fbp gene or heterologous expression of exogenous fbp gene;

[0125] (iii) overexpression of endogenous ppsA, pyc, pck genes or any combination thereof or heterologous expression of exogenous ppsA, pyc, pck genes or any combination thereof;

[0126] (iv) deletion, knockout or knockdown of endogenous pta, poxB, ldhA or any combination thereof;

[0127] (v) deletion, knockout or knockdown of endogenous ppc gene;

[0128] (vi) deletion, knockout or knockdown of endogenous ptsH, ptsI, crr, ptsG or any combination thereof;

[0129] (vii) overexpression of endogenous glf gene or glk gene or heterologous expression of exogenous glf gene or glk gene;

[0130] (viii) Any combination of (ii) to (vii).

[0131] In some embodiments, provided herein is an engineered microbial cell comprising:

[0132] (i) overexpression of an endogenous gltA gene or heterologous expression of an exogenous gltA gene; and

[0133] (ii) overexpression of endogenous ppsA, pyc, pck genes or any combination thereof or heterologous expression of exogenous ppsA, pyc, pck genes or any combination thereof;

[0134] Optionally, the engineered microbial cell further comprises any of the following:

[0135] (iii) overexpression of endogenous fbp gene or heterologous expression of exogenous fbp gene;

[0136] (iv) deletion, knockout or knockdown of endogenous pta, poxB, ldhA or any combination thereof;

[0137] (v) deletion, knockout or knockdown of endogenous ppc gene;

[0138] (vi) deletion, knockout or knockdown of endogenous ptsH, ptsI, crr, ptsG or any combination thereof;

[0139] (vii) overexpression of endogenous glf gene or glk gene or heterologous expression of exogenous glf gene or glk gene;

[0140] (viii) Any combination of (iii)-(vii).

[0141] In some embodiments, provided herein is an engineered microbial cell comprising:

[0142] (i) overexpression of an endogenous gltA gene or heterologous expression of an exogenous gltA gene; and

[0143] (ii) overexpression of endogenous fbp gene or heterologous expression of exogenous fbp gene;

[0144] Optionally, the engineered microbial cell further comprises any of the following:

[0145] (iii) overexpression of endogenous ppsA, pyc, pck genes or any combination thereof or heterologous expression of exogenous ppsA, pyc, pck genes or any combination thereof;

[0146] (iv) deletion, knockout or knockdown of endogenous pta, poxB, ldhA or any combination thereof;

[0147] (v) deletion, knockout or knockdown of endogenous ppc gene;

[0148] (vi) deletion, knockout or knockdown of endogenous ptsH, ptsI, crr, ptsG or any combination thereof;

[0149] (vii) overexpression of endogenous glf gene or glk gene or heterologous expression of exogenous glf gene or glk gene;

[0150] (viii) Any combination of (iii)-(vii).

[0151] In some embodiments, provided herein is an engineered microbial cell comprising:

[0152] (i) overexpression of an endogenous gltA gene or heterologous expression of an exogenous gltA gene; and

[0153] (ii) overexpression of endogenous fbp gene or heterologous expression of exogenous fbp gene;

[0154] (iii) overexpression of endogenous ppsA, pyc, pck genes or any combination thereof or heterologous expression of exogenous ppsA, pyc, pck genes or any combination thereof;

[0155] Optionally, the engineered microbial cell further comprises any of the following:

[0156] (iv) deletion, knockout or knockdown of endogenous pta, poxB, ldhA or any combination thereof;

[0157] (v) deletion, knockout or knockdown of endogenous ppc gene;

[0158] (vi) deletion, knockout or knockdown of endogenous ptsH, ptsI, crr, ptsG or any combination thereof;

[0159] (vii) overexpression of endogenous glf gene or glk gene or heterologous expression of exogenous glf gene or glk gene;

[0160] (viii) Any combination of (iv)-(vii).

[0161] In some embodiments, provided herein is an engineered microbial cell comprising:

[0162] (1) (i) overexpression of the endogenous gltA gene; and (iii) overexpression of the endogenous ppsA gene;

[0163] (2) (i) Overexpression of the endogenous gltA gene; (ii) Overexpression of the endogenous fbp gene;

[0164] (3) (i) overexpression of the endogenous gltA gene; (ii) overexpression of the endogenous fbp gene; (iii) overexpression of the endogenous ppsA gene; and (iv) overexpression of the endogenous pck gene and heterologous expression of an exogenous pyc gene (e.g., from Cytobacillus firmus); or

[0165] (4) (i) overexpression of the endogenous gltA gene; (ii) overexpression of the endogenous fbp gene; (iii) overexpression of the endogenous ppsA gene; (iv) overexpression of the endogenous pck gene and heterologous expression of an exogenous pyc gene (e.g., from Cytobacillus firmus); and (v) deletion, knockout or knockdown of the endogenous pta and poxB genes;

[0166] Optionally, the engineered microbial cell further comprises any of the following:

[0167] (i) Deletion, knockout or knockdown of endogenous ppc gene;

[0168] (ii) deletion, knockout or knockdown of endogenous ptsH, ptsI, crr, ptsG or any combination thereof;

[0169] (iii) overexpression of endogenous glf gene or glk gene or heterologous expression of exogenous glf gene or glk gene;

[0170] (iv) Any combination of (i) to (iii).

[0171] In addition, exemplary embodiments of engineered microbial cells provided herein include:

[0172] Embodiment 1. An engineered microbial cell comprising overexpression of citrate synthase (eg, gltA) and phosphoenolpyruvate synthase (eg, ppsA).

[0173] Embodiment 2. The engineered microbial cell of embodiment 1, comprising overexpression of endogenous genes encoding citrate synthase and phosphoenolpyruvate synthase, the endogenous genes comprising gltA and ppsA genes or their species homologs (e.g., orthologs or paralogs). In some cases where the microbial cell is Escherichia coli, the endogenous gltA and ppsA genes are overexpressed.

[0174] Embodiment 3. The engineered microbial cell of embodiment 1 or 2, further comprising overexpression of fructose-1,6-bisphosphatase (e.g., fbp), such as heterologous expression of exogenous genes encoding fructose-1,6-bisphosphatase, the exogenous genes comprising fbp genes (e.g., from Drosophila melanogaster). In some cases where the microbial cell is E. coli, endogenous gltA and ppsA genes are overexpressed and exogenous fbp genes (e.g., from Drosophila melanogaster) are introduced. In some cases where the microbial cell is E. coli, endogenous gltA, ppsA, and fbp genes are overexpressed.

[0175] Embodiment 4. An engineered microbial cell comprising overexpression of citrate synthase (e.g., gltA), phosphoenolpyruvate synthase (e.g., ppsA), fructose-1,6-bisphosphatase (e.g., fbp), pyruvate carboxylase (e.g., pyc), and PEP carboxykinase (e.g., pck).

[0176] Embodiment 5. The engineered microbial cell of embodiment 4, comprising overexpression of endogenous genes encoding citrate synthase, phosphoenolpyruvate synthase, and PEP carboxykinase, the endogenous genes including gltA, ppsA, and pck genes or their species homologs (e.g., orthologs, or paralogs), and heterologous expression of exogenous genes encoding fructose-1,6-bisphosphatase and pyruvate carboxylase, the exogenous genes including fbp genes (e.g., from Drosophila melanogaster) and pyc genes (e.g., from Bacillus firmus). In some cases where the microbial cell is Escherichia coli, the endogenous gltA, ppsA, and pck genes are overexpressed, and exogenous fbp genes (e.g., from Drosophila) and pyc genes (e.g., from Bacillus firmus) are introduced. In some cases where the microbial cell is Escherichia coli, the endogenous gltA, ppsA, pck, and fbp genes are overexpressed, and an exogenous pyc gene (e.g., from Bacillus firmus) is introduced.

[0177] Embodiment 6. The engineered microbial cell of embodiment 4 or 5, further comprising a deletion, knockout or knockdown of endogenous genes encoding phosphate acetyltransferase (eg, pta) and pyruvate dehydrogenase (eg, poxB).

[0178] Embodiment 7. The engineered microbial cell of embodiment 6, comprising a deletion, knockout or knockdown of endogenous pta and poxB genes or their species homologs (e.g., orthologs or paralogs). In some cases where the microbial cell is E. coli, the endogenous pta and poxB genes are deleted or knocked out.

[0179] Terminal pathway

[0180] The three AAAs, tryptophan (TRP), phenylalanine (PHE), and tyrosine (TYR), are synthesized via the shikimate pathway and the subsequent branched-chain aromatic amino acid biosynthetic pathway, with chorismate (CHA) as the last common precursor in the terminal branch.

[0181] In some embodiments, any of the foregoing engineered microbial cells further comprise expression (e.g., heterologous expression) of genes required for the TRP branch, PHE branch, or TYR branch to provide an aromatic amino acid biosynthetic pathway.

[0182] The TRP branch requires the following genes to encode the enzymes required for the synthesis of TRP from CHA: trpA, trpB, trpC, trpD and trpE or feedback-resistant variants thereof (e.g., trpE(fbr)) or species homologs thereof (e.g., orthologs or paralogs). In some embodiments where the target product is a TRP, the engineered microbial cell disclosed herein further comprises overexpression of trpA, trpB, trpC, trpD and trpE or feedback-resistant mutants thereof (e.g., trpE(fbr)) or species homologs thereof (e.g., orthologs or paralogs). In some embodiments where the microbial cell is Escherichia coli, the engineered microbial cell comprises overexpression of trpA, trpB, trpC, trpD and trpE or feedback-resistant mutants thereof (e.g., trpE(fbr)). In some embodiments, overexpression of serA and aroG or feedback-resistant mutants thereof (e.g., aroG(fbr)) is also comprised.

[0183] The PHE branch requires the following genes to encode enzymes required for the synthesis of PHE from CHA: pheA, tyrB, or species homologs thereof (e.g., orthologs or paralogs). In some embodiments in which the target product is PHE, the engineered microbial cells disclosed herein also comprise overexpression of pheA, tyrB, or species homologs thereof (e.g., orthologs or paralogs). In some embodiments in which the microbial cell is E. coli, the engineered microbial cell comprises overexpression of pheA, tyrB.

[0184] The TYR branch requires the following genes to encode the enzymes required for the synthesis of TYR from CHA: tyrA, tyrB, or their species homologs (e.g., orthologs or paralogs). In some embodiments where the target product is TYR, the engineered microbial cells disclosed herein also comprise overexpression of tyrA, tyrB, or their species homologs (e.g., orthologs or paralogs). In some embodiments where the microbial cell is E. coli, the engineered microbial cell comprises overexpression of tyrA, tyrB.

[0185] Also provided herein are methods for reducing the production of byproducts and / or increasing the yield or conversion rate of aromatic amino acids in aromatic amino acid biosynthesis, comprising introducing the genetic modifications contained in any of the aforementioned engineered microbial cells into a microbial cell that naturally has an aromatic amino acid biosynthetic pathway.

[0186] In some embodiments, the genetic modification comprises at least: overexpression of citrate synthase. In some embodiments, the genetic modification further comprises: expression of an ineffective cycle. The ineffective cycle comprises at least overexpression of fructose-1,6-bisphosphatase, such as overexpression of an endogenous fbp gene or heterologous expression of an exogenous fbp gene (e.g., from Drosophila melanogaster).

[0187] In some embodiments, the genetic modification comprises at least: overexpression of citrate synthase. In some embodiments, the genetic modification further comprises: an enhanced PEP biosynthetic pathway. In some embodiments, the enhanced PEP biosynthetic pathway comprises increased phosphoenolpyruvate synthase activity, or increased pyruvate carboxylase and PEP carboxykinase activity, for example, overexpression of endogenous ppsA, pyc, pck genes or any combination thereof or heterologous expression of exogenous ppsA, pyc, pck genes or any combination thereof.

[0188] Microbial cells

[0189] The present disclosure provides genetic modifications that promote or optimize AAA biosynthesis. It will be appreciated by those skilled in the art that the genetic modifications exemplified herein are described with reference to suitable host organisms such as Escherichia coli and their corresponding metabolic reactions. However, in view of the complete genome sequencing of a variety of organisms and the high technology level in the field of genomics, those skilled in the art will be able to easily apply the teaching and guidance provided herein to substantially all other organisms. For example, the Escherichia coli metabolic changes exemplified herein can be easily applied to other species by incorporating the same or similar encoding nucleic acids from species other than the reference species through the displacement of species homologues (e.g., straight homologues or paralogs).

[0190] Straight homologues and paralog gene displacements can be determined by methods well known to those skilled in the art. For example, algorithms such as Align, BLAST or ClustalW can be used to determine sequence identity or similarity between two comparison sequences, and to determine the presence or significance of gaps in the sequence, which can be assigned weights or scores. Based on this type of similarity, those skilled in the art can determine whether the similarity is high enough to show that the protein is related through the evolution of a common ancestor.

[0191] In some embodiments, the host microorganism can be selected from, and the engineered microbial cells can be generated in, for example, bacteria, yeast, fungi, or any of a variety of other microorganisms suitable for fermentation processes, particularly aromatic amino acid biosynthesis.

[0192] In some embodiments, the host microorganism naturally has an aromatic amino acid biosynthetic pathway.AAA biosynthesis is highly conserved in microorganisms, including the shikimic acid (SHK) pathway, which links the biosynthesis of central carbon metabolism (CCM) with chorismic acid (CHA).AAA biosynthesis begins with the condensation of phosphoenolpyruvic acid (PEP) and erythrose 4-phosphate (E4P).This achieves the formation of 3-deoxy-D-arabinoheptone acid 7-phosphate (DAHP), which is the first metabolite of the seven-step shikimic acid pathway for the production of chorismic acid.Chorismic acid is a precursor of all three standard AAAs, and a key branching point for secondary aromatic metabolites.

[0193] In some embodiments, the host microorganism is a microorganism suitable for industrial fermentation.

[0194] Exemplary bacteria include species selected from Escherichia coli, Corynebacterium glutamicum, Bacillus subtilis, Bacillus licheniformis.

[0195] E. coli is a particularly useful host organism because it is a well-characterized microbial organism suitable for genetic engineering. It should be understood that any suitable microbial host organism can be used to introduce metabolic and / or genetic modifications to produce a desired product.

[0196] In some embodiments, the engineered microbial cell as described above is a bacterium, a fungus or a yeast. In some embodiments, the engineered microbial cell as described above is an Escherichia coli.

[0197] Methods for making engineered microorganisms

[0198] The engineered microbial cells disclosed herein can be produced by any genetic engineering method known to those skilled in the art without limitation.

[0199] The expression of enzyme in host cell can be realized by introducing nucleic acid into host cell, and described nucleic acid is included in the nucleotide sequence of encoding enzyme under the control of regulatory element, and this regulatory element allows expression in host cell.In some embodiments, nucleic acid is extrachromosomal plasmid.In other embodiments, nucleic acid is chromosomal integration vector, and it can integrate nucleotide sequence into the chromosome of host cell.Exemplary technology of nucleic acid encoding these enzymes is introduced into host cell includes but not limited to spheroplasting, electroporation, PEG 1000 mediation conversion and lithium acetate or lithium chloride mediation conversion.

[0200] Overexpression of enzyme in host cell can be realized, for example, by providing multiple copies of gene or by changing promoter region to provide stronger expression. The copy number of enzyme in host cell can be changed by modifying the transcription of the gene encoding the enzyme. This can be realized, for example, by modifying the copy number of the nucleotide sequence encoding enzyme (for example, by using an expression vector comprising a higher or lower copy number of the nucleotide sequence, or by introducing an extra copy of the nucleotide sequence into the genome of the host cell), or by increasing the strength of a promoter or operon operably connected to the nucleotide sequence.

[0201] In some embodiments, the nucleic acid used to genetically modify the host cell comprises one or more selectable markers, such as antibiotic resistance markers, which can be used to select transformed host cells and to exert selective pressure on the host cell to maintain the exogenous DNA.

[0202] Inhibition of enzyme activity in host cells can be achieved, for example, by deleting or destroying the nucleotide sequence encoding enzymes in the host cell genome. In some embodiments, the activity of reduction can be achieved by introducing gene disruption. The term "gene disruption" encompasses any genetic alteration that inactivates the gene product encoded. The genetic alteration can be, for example, deletion or knockout of the entire gene, deletion of the regulatory sequence required for transcription or translation, deletion of a part of the gene to cause a truncated gene product or by any various mutation strategies that inactivate the gene product encoded.

[0203] In certain embodiments, a particularly useful gene disruption method can be complete gene deletion or knockout, because it reduces or eliminates the occurrence of genetic reversal in the engineered microorganisms of the present disclosure. Deletion or knockout of endogenous genes can be achieved by any gene editing system known in the art, such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), or clustered regularly interspaced short palindromic repeats (CRISPRs).

[0204] In other embodiments, endogenous genes can also be knocked down by gene silencing, for example, by using oligonucleotides that bind to the gene encoding it or its mRNA, resulting in a temporary change in expression. Exemplary gene silencing methods include, but are not limited to, RNA interference (RNAi), small interfering RNA (siRNA) or short hairpin RNA (shRNA), which are used to inactivate the messenger RNA of a specific gene and effectively inhibit the expression of the gene.

[0205] In other embodiments, the inhibition of enzyme activity can also be achieved by transforming or replacing endogenous genes to include rare codons. For example, when expressing exogenous genes in E. coli, rare codons that are rarely used by E. coli will reduce the availability of cognate tRNAs, thereby reducing the expression efficiency and level of proteins. For specific species or cells, those skilled in the art can easily determine rare codons using various analytical tools (e.g., bioinformatics tools).

[0206] Method for producing AAA

[0207] In a further aspect, provided is a method or use of producing AAA using the engineered microbial cells described herein.

[0208] In some embodiments, provided herein is a method for producing an aromatic amino acid, comprising culturing any of the aforementioned engineered microbial cells disclosed herein in a culture medium. In some embodiments, the method further comprises recovering the aromatic amino acid from the culture. In some embodiments, the culture is continued for a time sufficient to produce AAA.

[0209] The method generally relates to culturing host cells in a suitable culture medium comprising a carbon source under suitable conditions. Suitable conditions and suitable culture medium for culturing microorganisms are well known in the art. In some embodiments, the carbon source is a monosaccharide (simple sugar), a disaccharide, a polysaccharide, a non-fermentable carbon source, or one or more combinations thereof. Non-limiting examples of suitable monosaccharides include glucose, galactose, mannose, fructose, ribose, and combinations thereof. Non-limiting examples of suitable disaccharides include sucrose, lactose, maltose, trehalose, cellobiose, and combinations thereof. Non-limiting examples of suitable polysaccharides include starch, glycogen, cellulose, chitin, and combinations thereof. Non-limiting examples of suitable non-fermentable carbon sources include acetate and glycerol. In some embodiments, suitable culture medium is supplemented with one or more additional reagents, such as inducing compounds (for example, when one or more nucleotide sequences of the coding gene product are under the control of an inducible promoter), repressive compounds (for example, when one or more nucleotide sequences of the coding gene product are under the control of a repressible promoter) or selection agents (for example, for selecting antibiotics comprising genetically modified microorganisms).

[0210] In some embodiments, the culture medium is suitable for culturing E. coli.

[0211] In some embodiments, the culture medium may comprise LB medium supplemented with peptone, yeast extract and NaCl. In some embodiments, the culture medium may comprise LB medium supplemented with 10 g / l peptone, 5 g / l yeast extract and 10 g / l NaCl.

[0212] The engineered microbial cells disclosed herein can produce increased amounts of AAA and / or decreased amounts of byproducts compared to a host cell (e.g., a wild-type or parental host cell) that does not comprise the genetic modifications of the engineered microbial cells disclosed herein but is otherwise genetically identical.

[0213] In some embodiments, the increase is by at least about 10% (e.g., at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%) or at least about 2-fold (e.g., about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 15-fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold, about 60-fold, about 70-fold, about 80-fold, about 90-fold, or about 100-fold) as measured, e.g., in grams per liter of cell culture, milligrams per gram of dry cell weight, per unit volume of cell culture, per unit dry cell weight, per unit volume of cell culture per unit time, or per unit dry cell weight per unit time under the same culture conditions.

[0214] In some embodiments, the amount of reduction is at least about 10% (e.g., at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%) or at least about 2-fold (e.g., about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 15-fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold, about 60-fold, about 70-fold, about 80-fold, about 90-fold, or about 100-fold) as measured under the same culture conditions, e.g., in grams per liter of cell culture, milligrams per gram of dry cell weight, on a per unit volume of cell culture basis, on a per unit dry cell weight basis, on a per unit volume of cell culture basis per unit time, or on a per unit dry cell weight basis per unit time.

[0215] In some embodiments, wherein the engineered microbial cell comprises: (i) increased carbon flux into the TCA cycle and (ii) expression of a futile cycle, the engineered microbial cell produces increased amounts of AAA and / or decreased amounts of byproducts compared to a host cell that comprises an unmodified carbon flux into the TCA cycle and does not express a futile cycle but is otherwise genetically identical.

[0216] In some embodiments, wherein the engineered microbial cell comprises: (i) increased carbon flux into the TCA cycle and (ii) an enhanced PEP biosynthetic pathway, the engineered microbial cell produces increased amounts of AAA and / or decreased amounts of byproducts compared to a host cell that comprises an unmodified carbon flux into the TCA cycle and does not comprise an enhanced PEP biosynthetic pathway but is otherwise genetically identical.

[0217] Also provided is the use of any of the foregoing engineered microbial cells disclosed herein in the biosynthesis of aromatic amino acids. Example

[0218] The examples provided below are for illustrative purposes only and are not intended to be limiting unless otherwise specified. Therefore, the present invention should in no way be construed as being limited to the following examples, but rather should be construed to encompass any and all variations that become apparent as a result of the teachings provided herein.

[0219] Example 1. Construction of tryptophan biosynthetic pathway vector

[0220] 1.1 Acquisition of genes encoding tryptophan metabolic pathway

[0221] The main tryptophan biosynthesis pathway genes trpA, trpB, trpC, trpD and trpE were all derived from the Escherichia coli K-12 genome (NCBI reference sequence: NC_000913.3). The genome was used as a template and primers F1 and F2 were used for PCR amplification. The resulting PCR product was named Escherichia coli-trp (6866 bp).

[0222] The tryptophan biosynthesis pathway genes together with the tac promoter and RBS sequence were integrated into the backbone plasmid pUC19 (Addgene, #50005) using the ClonExpress MultiS One-Step Cloning Kit (Vazyme, Jiangsu, China) to obtain the tryptophan pathway exogenous expression vector pUC-TrpEDCBA.

[0223] In order to increase the amount of tryptophan precursor, aroG and serA need to be overexpressed. Using the E. coli K-12 genome as a template, primers F2 and R2 were used for PCR amplification to obtain a PCR product named E. coli-aroG (1061 bp), and primers F3 and R3 were used for PCR amplification to obtain a PCR product named E. coli-serA (1328 bp).

[0224] The aroG and serA sequences, as well as the tac promoter and RBS sequences, were ligated into the backbone plasmid pUC19 using the ClonExpress MultiS one-step cloning kit (Vazyme, Jiangsu, China). The ligation product was transformed into competent cells JM109 (commercial strain) using a chemical transformation method, positive clones were picked, plasmids were extracted and sequenced, and the correct recombinant plasmid was named pTrp-GA vector.

[0225] 1.2 Construction of tryptophan biosynthesis pathway vector pTrp-F

[0226] Gene expression vectors pUC-TrpEDCBA and pTrp-GA were used as templates, and primers F4 and R4, F5 and R5 were used for amplification to obtain gene sequences with tac promoter and RBS, respectively. pRGD-TcR (Addgene, #74110) was used as a template, and primers F6 and R6 were used for amplification to obtain a linearized vector.

[0227] The TrpEDBCA sequence with tac promoter and aroG and serA sequences with tac promoter were ligated into the backbone plasmid pRGD-TcR using ClonExpress MultiS one-step cloning kit (Vazyme, Jiangsu, China). The ligation products were transformed into JM109 competent cells by chemical transformation, positive clones were picked, plasmids were extracted for sequencing, and the correct recombinant plasmid was named pTrp-F vector.

[0228] The obtained vector pTrp-F was transformed into the wild-type strain M000, and the recombinant strain was named M000-Trp.

[0229] Example 2. Overexpression of phosphoenolpyruvate synthase ppsA and / or citrate synthase gltA

[0230] 2.1 Construction of expression vectors pppsA and pgltA-ppsA

[0231] The ppsA gene of Escherichia coli was obtained from the genome of Escherichia coli. The genome of the strain was used as a template and PCR amplification was performed using primers ppsA-F1 and ppsA-R1. The obtained correct PCR product was named Escherichia coli-ppsA (1664 bp).

[0232] The E. coli-ppsA fragment was ligated with the linearized plasmid using the ClonExpress MultiS one-step cloning kit (Vazyme, Jiangsu, China) and transformed into competent cells JM109 by chemical transformation. Positive clones were picked, plasmids were extracted for sequencing, and the correct recombinant plasmid was named pppsA.

[0233] The gltA gene of Escherichia coli was obtained from the genome of strain M000. The genome of strain M000 was used as a template and PCR amplification was performed using primers gltA-F1 and gltA-R1. The obtained correct PCR product was named Escherichia coli-gltA (1238 bp).

[0234] The E. coli -gltA fragment was ligated with the linearized plasmid using the ClonExpress MultiS one-step cloning kit (Vazyme, Jiangsu, China) and transformed into competent cells JM109 by chemical transformation. Positive clones were picked, plasmids were extracted for sequencing, and the correct recombinant plasmid was named pgltA-ppsA.

[0235] 2.2 Construction of recombinant strain overexpressing gltA gene

[0236] The obtained plasmids pppsA and pgltA-ppsA were transformed into competent cells of the wild-type strain by chemical transformation, and the obtained recombinant bacteria were named M008 and M009, respectively.

[0237] 2.3 Construction of M008-Trp and M009-Trp fermentation strains

[0238] The tryptophan biosynthesis pathway vector pTrp-F was transformed into competent cells of strains M008 and M009, respectively, and the obtained recombinant strains were recorded as M008-Trp and M009-Trp.

[0239] 2.4 Tryptophan production by recombinant strains M000-Trp and M008-Trp

[0240] Tryptophan synthesis was carried out according to the following steps: 1% of the bacterial solution with OD600 = 1 was inoculated into 200 ml of seed culture medium containing tetracycline at a final concentration of 20 μl / mL. When OD600 reached 1-2, the seed solution was transferred to 2 mL of culture medium. After fermentation in a microplate for 16 hours, the tryptophan content in the fermentation broth was determined.

[0241] like Figure 1 As shown, overexpression of ppsA in the M008-Trp strain increased tryptophan production from 2.16 g / L to 2.30 g / L, while acetate accumulation decreased from 3.13 g / L to 2.62 g / L. Therefore, overexpression of ppsA can promote the increase of metabolic flux and direct the metabolic flow to the tryptophan production pathway to increase tryptophan production and reduce the accumulation of byproducts.

[0242] 2.5 Tryptophan production by recombinant strains M000-Trp and M009-Trp

[0243] Tryptophan synthesis was carried out according to the following steps: 1% of the bacterial solution with OD600 = 1 was inoculated into 200 ml of seed culture medium containing tetracycline at a final concentration of 20 μl / mL. When OD600 reached 4-5, the seed solution was transferred to a 2 L fermentation tank culture medium. After 40 hours of fermentation, the tryptophan content in the fermentation broth was determined.

[0244] like Figure 2 As shown, overexpression of ppsA and gltA in the M009-Trp strain increased tryptophan production from 34 g / L to 38 g / L, while acetate accumulation decreased from 3.06 g / L to 0.48 g / L. Therefore, overexpression of ppsA and gltA can promote the increase of metabolic flux and direct the metabolic flow to the TCA cycle to increase tryptophan production and reduce the accumulation of byproducts.

[0245] Example 3. Overexpression of pyruvate carboxylase pyc and PEP carboxykinase pck

[0246] 3.1 Construction of the vector pgltA-ppsA-fbp-pck-pyc

[0247] Using the pgltA-ppsA vector as a template, primers gltA-ppsA-F and gltA-ppsA-R were used for PCR amplification to obtain a linearized vector. Using a synthetic gene vector containing pyc (NCBIGeneID: 67523489) and pck (NCBIGeneID: 945667) sequences as a template, primers pck-pyc-VF1 and pck-pyc-VR1 were used to obtain the fragment pck-pyc by PCR amplification. Using the genome of strain M000 as a template, primers fbp-F2 and fbp-R2 were used for PCR amplification to obtain the fragment fbp (1037 bp).

[0248] The pck-pyc fragment and fbp fragment were ligated with the linearized plasmid vector using the ClonExpress MultiS one-step cloning kit (Vazyme, Jiangsu, China) and transformed into competent cells JM109 by chemical transformation. Positive clones were picked, and plasmids were extracted for sequencing. The correct plasmid was named pgltA-ppsA-fbp-pck-pyc.

[0249] 3.2 Construction of recombinant strain overexpressing gltA gene

[0250] The obtained plasmid pgltA-ppsA-fbp-pck-pyc was transformed into competent cells of strain M000 by chemical transformation, and the obtained recombinant bacteria was named M010.

[0251] 3.3 Construction of M010-Trp fermentation strain

[0252] The tryptophan fermentation pathway vector pTrp-F was transformed into competent cells of strain M010, and the obtained recombinant strain was named M010-Trp.

[0253] 3.4 Tryptophan production by recombinant strains M010-Trp and M000-Trp

[0254] Tryptophan synthesis was carried out according to the following steps: 1% of the bacterial solution with OD600 = 1 was inoculated into 200 ml of seed culture medium containing tetracycline at a final concentration of 20 μl / mL. When OD600 = 4-5, the seed solution was transferred to a 2 L fermentation tank culture medium. After 40 hours of fermentation, the amount of byproduct oxaloacetic acid in the fermentation broth was measured.

[0255] like Figure 3 As shown, overexpression of pck and pyc genes resulted in a decrease in the byproduct oxaloacetate from 1.2 g / L to 0.3 g / L. Therefore, overexpression of pck and pyc converted pyruvate into phosphoenolpyruvate.

[0256] Example 4. Reduction of acetic acid production pathways

[0257] 4.1 Construction of knockout vectors pSC101-pta-KO and pSC101-poxB-KO

[0258] Primers pta-HA1-F and pta-HA1-R were used to amplify the upstream homology arm of the pta gene, and primers pta-HA2-F and pta-HA2-R were used to amplify the downstream homology arm. Then, overlapping PCR was performed using primers pta-HA1-F and pta-HA2-R with the upstream and downstream homology arms as templates, and the resulting fragment was named pta-HA fragment.

[0259] Using pSC101-PBAD-sgRNA as a template, primers pta-sgRNA-F and pta-sgRNA-R were used for amplification, and the resulting fragment was named pta-sgRNA. Primers pta-backbone-F and pta-backbone-R were used to amplify and obtain a linearized plasmid vector.

[0260] The pta-HA fragment and pta-sgRNA fragment were connected to the linearized plasmid vector using the ClonExpress MultiS one-step cloning kit (Vazyme, Jiangsu), and transformed into competent cells JM109 by chemical transformation. Positive clones were picked and plasmids were extracted for sequencing. The correct recombinant plasmid was named pSC101-pta-KO.

[0261] Primers poxB-HA1-F and poxB-HA1-R were used to amplify the upstream homology arm of the poxB gene, and primers poxB-HA2-F and poxB-HA2-R were used to amplify the downstream homology arm. Then, overlapping PCR was performed using primers poxB-HA1-F and poxB-HA2-R with the upstream and downstream homology arms as templates, and the resulting fragment was named poxB-HA fragment.

[0262] Using pSC101-PBAD-sgRNA as a template, primers poxB-sgRNA-F and poxB-sgRNA-R were used for amplification, and the resulting fragment was named poxB-sgRNA. Primers poxB-backbone-F and poxB-backbone-R were used to amplify and obtain a linearized plasmid vector.

[0263] The poxB-HA fragment and poxB-sgRNA fragment were connected to the linearized plasmid vector using the ClonExpress MultiS one-step cloning kit (Vazyme, Jiangsu), and transformed into competent cells JM109 using the chemical transformation method. Positive clones were picked, and plasmids were extracted for sequencing. The correct recombinant plasmid was named pSC101-poxB-KO.

[0264] 4.2 Knockout of pta and poxB genes

[0265] Strain M000 was knocked out of pta using the λ-Red-mediated CRISPR-Cas9 method to generate strain M011.

[0266] First, the p15A-PBAD-Cas9-PT5-Redγβα vector expressing λ-Red and CRISPR-Cas9 system was transformed into M000 competent cells. The colonies were grown and inoculated to prepare them into chemical competent cells. The vector pSC101-pta-KO for pta knockout was transformed into M000 competent cells containing the vector p15A-PBAD-Cas9-PT5-Redγβα, and gene editing was performed after a single colony was grown.

[0267] Inoculate a single colony in LB solution and recover for 2 hours, then add 50μg / L kanamycin, 100μg / L ampicillin and IPTG with a final concentration of 1mM, culture for 1 hour, then add L-arabinose with a final concentration of 200mM and culture for 3 hours. 1μl of culture was coated on LB agar plates containing Amp, Kan and L-arabinose and incubated overnight at 30°C. PCR was performed using verification primers pta-verification-F and pta-verification-R to verify whether the pta gene has been successfully knocked out. The pta knockout strain based on the wild-type M000 was recorded as M011.

[0268] The poxB gene of strain M011 was further knocked out using the λ-Red-mediated CRISPR-Cas9 method to obtain strain M012.

[0269] The p15A-PBAD-Cas9-PT5-Redγβα vector expressing λ-Red and CRISPR-Cas9 system was first transformed into M011 competent cells. The colonies were grown and inoculated to prepare them into chemical competent cells. The vector pSC101-poxB-KO for poxB knockout was transformed into M011 competent cells containing the vector p15A-PBAD-Cas9-PT5-Redγβα, and gene editing was performed after a single colony was grown.

[0270] Inoculate a single colony in LB solution to recover for 2 hours, then add 100μg / L kanamycin, 50μg / L ampicillin and IPTG with a final concentration of 1mM, culture for 1 hour, then add L-arabinose with a final concentration of 200mM and culture for 3 hours. 1μl of culture was coated on an LB agar plate containing Amp, Kan and L-arabinose and incubated overnight at 30°C. PCR was performed using verification primers poxB-verification-F and poxB-verification-R to verify whether the poxB gene had been successfully knocked out. The poxB knockout strain based on M011 was named M012. The pgltA-ppsA-fbp-pck-pyc plasmid was transformed into M012 by chemical transformation, and the resulting strain was named M013.

[0271] 4.3 Construction of M013-Trp fermentation strain

[0272] The tryptophan fermentation pathway vector pTrp-F was transformed into competent cells of strain M013 to obtain a recombinant strain labeled M013-Trp.

[0273] 4.4 Tryptophan production by recombinant strains M010-Trp and M013-Trp

[0274] Tryptophan synthesis was carried out according to the following steps: 1% of the bacterial solution with OD600 = 1 was inoculated into 200 ml of seed culture medium containing tetracycline at a final concentration of 20 μl / mL. When OD600 = 4-5, the seed solution was transferred to a 2 L fermentation tank culture medium. After 40 hours of fermentation, the amount of tryptophan in the fermentation broth was measured.

[0275] like Figure 4 As shown, knockout of the pta and poxB genes slightly increased the conversion rate of tryptophan and significantly increased the conversion rate from 15.7% to 18.3%. Therefore, knocking out the acetate production pathway can increase the conversion rate of tryptophan.

[0276] sequence

[0277] SEQ ID NO:1(F1)

[0278] ggcgtatcacgaggccctttgtgtgtcgacactcattaaaattag

[0279] SEQ ID NO:2(R1)

[0280] cgttatcccctgattctgtgatgcaaacacaaaaaccgactctc

[0281] SEQ ID NO:3(F2)

[0282] cagcgatacctttgccatTTATTAAACCttacccgcgacg

[0283] SEQ ID NO:4(R2)

[0284] atgaattatcagaacgacgatttacg

[0285] SEQ ID NO:5(F3)

[0286] AAatggcaaaggtatcgctg

[0287] SEQ ID NO:6(R3)

[0288] ATCCTCTAGAGCAGCAACG

[0289] SEQ ID NO:7(F4)

[0290] TCGACACTCATTAAAATTAGTCGCT

[0291] SEQ ID NO:8(R4)

[0292] catgagaattatcactagtgatcaTTGACAATTAATCATCGGCTCGTATAA

[0293] SEQ ID NO:9(F5)

[0294] acgttaagggattttggtcatgTTGACAATTAATCATCGGCTCGTATAA

[0295] SEQ ID NO:10(R5)

[0296] CTAATTTTAATGAGTGTCGAATCCTCTAGAGCAGCAACG

[0297] SEQ ID NO:11(F6)

[0298] tgatgattcactagtgataattctcatg

[0299] SEQ ID NO:12(R6)

[0300] catgaccaaaatcccttaacgt

[0301] SEQ ID NO:13(ppsA-F1)

[0302] GGATAACAATTTCACACAGGAAACAGCTATGACCATGAgaattcattaaagaggaaggtacaatgtccaacaat

[0303] ggctcg

[0304] SEQ ID NO:14(ppsA-R1)

[0305] gttttatttgatgcctctagcacgttattttcttcagttcagccaggc

[0306] SEQ ID NO:15(gltA-F1)

[0307] ttaagaggaaggtacaatggctgatacaaaagcaaaac

[0308] SEQ ID NO:16(gltA-R1)

[0309] gttttattgatgcctagcacgttaacgcttgatatcgctttaaag

[0310] SEQ ID NO:17(gltA-ppsA-F)

[0311] GGATAACAATTTCACACAGGAAACAGCTATGACCATGAgaattcattaaagaggagaaggtacaatgtccaacaat

[0312] ggctcg

[0313] SEQ ID NO:18(gltA-ppsA-R)

[0314] ggtatatatctccttctttaacgcttgatatcgctttaaag

[0315] SEQ ID NO:19(pck-pyc-VF1)

[0316] cccGAAGAAGAAtataccatgcgcgttaacaatggtt

[0317] SEQ ID NO:20(pck-pyc-VR1)

[0318] tgtaccttctctctctttaatgaattc

[0319] SEQ ID NO:21(fbp-F2)

[0320] ttaaaagaaggagatataccatgaaaacgttaggtgaatttattgtc

[0321] SEQ ID NO:22(fbp-R2)

[0322] ggtataTTCTCTCTTCgggttacgcgtccggggaactc

[0323] SEQ ID NO:23(pta-HA1-F)

[0324] aaacaaataggggttccgcgcaaagcgggcaaacgtatc

[0325] SEQ ID NO:24(pta-HA1-R)

[0326] <h2 style=";text-align:left;direction:ltr">cgatcaacccggatccgac<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0327] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:25(pta-HA2-F)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0328] <h2 style=";text-align:left;direction:ltr"> cgatcaacccggatccgactcttgcttaactgcgctgca<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0329] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:26(pta-HA2-R)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0330] <h2 style=";text-align:left;direction:ltr"> tctccttacgcatctgtgcgccaggataccgttatcaatg<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0331] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:27(pta-sgRNA-F)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0332] <h2 style=";text-align:left;direction:ltr"> gcacagatgcgtaaggaga<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0333] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:28(pta-sgRNA-R)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0334] <h2 style=";text-align:left;direction:ltr"> ctttgtaggtggtgttaccgatggagaaacagtagagagagttgc<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0335] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:29(pta-backbone-F)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0336] <h2 style=";text-align:left;direction:ltr"> cggtaacaccacctacaaagGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0337] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:30(pta-backbone-R)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0338] <h2 style=";text-align:left;direction:ltr"> cgcggaacccctatttgttt<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0339] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:31(poxB-HA1-F)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0340] <h2 style=";text-align:left;direction:ltr"> aaacaaataggggttccgcgtctctgaacggtcttagtgaca<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0341] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:32(poxB-HA1-R)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0342] <h2 style=";text-align:left;direction:ltr"> ctgatgattgcgcgcagccagtttgcgtaactcttcttct<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0343] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO:33(poxB-HA2-F)<h2 style=";text-align:left;direction:ltr">

[0344] gctgcgcgcaatcatcag

[0345] SEQ ID NO:34(poxB-HA2-R)

[0346] ctccttacgcatctgtgcatttggtgcggcgaaat

[0347] SEQ ID NO:35(poxB-sgRNA-F)

[0348] gcacagatgcgtaaggaga

[0349] SEQ ID NO:36(poxB-sgRNA-R)

[0350] gctttcatctccatcgccacatggagaaacagtagagagttgc

[0351] SEQ ID NO:37(poxB-backbone-F)

[0352] gtggcgatggagatgaaagcGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG

[0353] SEQ ID NO:38(poxB-backbone-R)

[0354] cgcggaaccctatttgttt

[0355] SEQ ID NO:39(pta-verification-F)

[0356] ctacatcaacgctgactggat

[0357] SEQ ID NO:40(pta-verification-R)

[0358] aaacagaataaacagcgcagg

[0359] SEQ ID NO:41(poxB-verification-F)

[0360] gcttatatcgccaaaacactc

[0361] SEQ ID NO:42(poxB-verification-R)

[0362] ttcccatgcttctttcaggt 。

Claims

1. An engineered microbial cell for producing aromatic amino acids comprising an increased carbon flux into a TCA cycle, thereby converting byproducts into CO2 to reduce byproducts; Preferably, the engineered microbial cell comprises increased acetyl-CoA flux into the TCA cycle, for example, comprises overexpression of citrate synthase, such as overexpression of an endogenous gltA gene or heterologous expression of an exogenous gltA gene.

2. The engineered microbial cell of claim 1, further comprising an enhanced phosphoenolpyruvate (PEP) biosynthetic pathway; Preferably, the engineered microbial cell comprises increased activity of phosphoenolpyruvate synthase to enhance the conversion of pyruvate to PEP, for example, by overexpression of endogenous ppsA or heterologous expression of an exogenous ppsA gene; Preferably, the engineered microbial cell comprises increased activity of pyruvate carboxylase or PEP carboxykinase to enhance the conversion from pyruvate to PEP, for example, the increased activity of pyruvate carboxylase is achieved by overexpression of an endogenous pyc gene or heterologous expression of an exogenous pyc gene, and the increased activity of PEP carboxykinase is achieved by overexpression of an endogenous pck gene or heterologous expression of an exogenous pck gene; preferably, the engineered microbial cell comprises overexpression of an endogenous pck gene and heterologous expression of an exogenous pyc gene (for example, from Cytobacillus firmus). Preferably, the engineered microbial cell comprises overexpression of an endogenous ppsA or heterologous expression of an exogenous ppsA gene, as well as overexpression of an endogenous pck gene and heterologous expression of an exogenous pyc gene (eg, from Cytobacillus firmus).

3. The engineered microbial cell of claim 1 or 2, which expresses a futile cycle; Preferably, the engineered microbial cell comprises overexpression of fructose-1,6-bisphosphatase, such as overexpression of an endogenous fbp gene or heterologous expression of an exogenous fbp gene (eg, from Drosophila melanogaster).

4. The engineered microbial cell of any one of claims 1 to 3, further comprising a blocked or reduced acetate and / or lactate production pathway; Preferably, the engineered microbial cell comprises reduced activity of one or more enzymes selected from phosphate acetyltransferase, pyruvate dehydrogenase, lactate dehydrogenase, or any combination thereof; for example, by deleting, knocking out or knocking down one or more genes selected from pta, poxB, ldhA, or any combination thereof, or modifying or replacing pta, poxB, ldhA, or any combination thereof to contain rare codons; Preferably, the engineered microbial cell comprises a deletion, knockout or knockdown of endogenous pta and poxB genes.

5. The engineered microbial cell of any one of claims 1 to 4, further comprising a blocked or reduced oxaloacetate biosynthetic pathway; Preferably, the engineered microbial cell comprises reduced phosphoenolpyruvate carboxylase activity, for example by deleting, knocking out or knocking down ppc, or modifying or replacing the endogenous ppc gene to comprise a rare codon.

6. The engineered microbial cell of any one of claims 1 to 5, wherein a naturally occurring phosphotransferase (PTS) transport system is disabled; Preferably, the engineered microbial cell comprises reduced activity of one or more PTS system proteins, for example, by deleting, knocking out or knocking down one or more genes selected from ptsH, ptsI, crr, ptsG or any combination thereof, or modifying or replacing endogenous ptsH, ptsI, crr, ptsG genes or any combination thereof to comprise rare codons; Preferably, the engineered microbial cell further comprises an increased activity of at least one non-PTS sugar transporter, such as overexpression of an endogenous non-PTS sugar transporter or heterologous expression of an exogenous non-PTS sugar transporter (e.g., glucose facilitating protein (Glf) of Zymomonas mobilis); Preferably, the engineered microbial cell further comprises an increased activity of glucose kinase, such as overexpression of an endogenous glk gene or heterologous expression of an exogenous glk gene (e.g., from Zymomonas mobilis); Preferably, the engineered microbial cell comprises one or more gene deletions, knockouts or knockdowns selected from ptsH, ptsI, crr, ptsG or any combination thereof, or modification or replacement of endogenous ptsH, ptsI, crr, ptsG genes or any combination thereof to comprise rare codons, and overexpression of an endogenous or exogenous glf gene or heterologous expression of an endogenous or exogenous glk gene (e.g. from Zymomonas mobilis).

7. The engineered microbial cell of any one of claims 1 to 6, comprising: (i) overexpression of an endogenous gltA gene or heterologous expression of an exogenous gltA gene; and (ii) overexpression of endogenous ppsA, pyc, pck genes or any combination thereof or heterologous expression of exogenous ppsA, pyc, pck genes or any combination thereof; Optionally, the engineered microbial cell further comprises any of the following: (iii) overexpression of endogenous fbp gene or heterologous expression of exogenous fbp gene; (iv) deletion, knockout or knockdown of endogenous pta, poxB, ldhA or any combination thereof; (v) deletion, knockout or knockdown of endogenous ppc gene; (vi) deletion, knockout or knockdown of endogenous ptsH, ptsI, crr, ptsG or any combination thereof; (vii) overexpression of endogenous glf gene or glk gene or heterologous expression of exogenous glf gene or glk gene; (viii) Any combination of (iii)-(vii).

8. The engineered microbial cell of any one of claims 1 to 7, comprising: (i) overexpression of an endogenous gltA gene or heterologous expression of an exogenous gltA gene; and (ii) overexpression of endogenous fbp gene or heterologous expression of exogenous fbp gene; Optionally, the engineered microbial cell further comprises any of the following: (iii) overexpression of endogenous ppsA, pyc, pck genes or any combination thereof or heterologous expression of exogenous ppsA, pyc, pck genes or any combination thereof; (iv) deletion, knockout or knockdown of endogenous pta, poxB, ldhA or any combination thereof; (v) deletion, knockout or knockdown of endogenous ppc gene; (vi) deletion, knockout or knockdown of endogenous ptsH, ptsI, crr, ptsG or any combination thereof; (vii) overexpression of endogenous glf gene or glk gene or heterologous expression of exogenous glf gene or glk gene; (viii) Any combination of (iii)-(vii).

9. The engineered microbial cell of any one of claims 1 to 8, comprising: (i) overexpression of endogenous gltA gene or heterologous expression of exogenous gltA gene; (ii) overexpression of endogenous fbp gene or heterologous expression of exogenous fbp gene; and (iii) overexpression of endogenous ppsA, pyc, pck genes or any combination thereof or heterologous expression of exogenous ppsA, pyc, pck genes or any combination thereof; Optionally, the engineered microbial cell further comprises any of the following: (iv) deletion, knockout or knockdown of endogenous pta, poxB, ldhA or any combination thereof; (v) deletion, knockout or knockdown of endogenous ppc gene; (vi) deletion, knockout or knockdown of endogenous ptsH, ptsI, crr, ptsG or any combination thereof; (vii) overexpression of endogenous glf gene or glk gene or heterologous expression of exogenous glf gene or glk gene; (viii) Any combination of (iv)-(vii).

10. The engineered microbial cell of claim 1, comprising: (1) (i) overexpression of the endogenous gltA gene; and (iii) overexpression of the endogenous ppsA gene; (2) (i) Overexpression of the endogenous gltA gene; (ii) Overexpression of the endogenous fbp gene; (3) (i) overexpression of the endogenous gltA gene; (ii) overexpression of the endogenous fbp gene; (iii) overexpression of the endogenous ppsA gene; and (iv) overexpression of the endogenous pck gene and heterologous expression of an exogenous pyc gene (e.g., from Cytobacillus firmus); or (4) (i) overexpression of the endogenous gltA gene; (ii) overexpression of the endogenous fbp gene; (iii) overexpression of the endogenous ppsA gene; (iv) overexpression of the endogenous pck gene and heterologous expression of the exogenous pyc gene (e.g., from Cytobacillus firmus); and (v) deletion, knockout or knockdown of the endogenous pta and poxB genes.

11. The engineered microbial cell of claim 10, further comprising any of the following: (i) Deletion, knockout or knockdown of endogenous ppc gene; (ii) deletion, knockout or knockdown of endogenous ptsH, ptsI, crr, ptsG or any combination thereof; (iii) overexpression of endogenous glf gene or glk gene or heterologous expression of exogenous glf gene or glk gene; (iv) Any combination of (i) to (iii).

12. The engineered microbial cell of any one of claims 1 to 11, which is a bacterium, a fungus or a yeast.

13. The engineered microbial cell of any one of claims 1 to 11, which is Escherichia coli, Corynebacterium glutamicum, Bacillus subtilis, or Bacillus licheniformis.

14. Use of the engineered microbial cell of any one of claims 1 to 13 in the biosynthesis of aromatic amino acids.

15. A method for producing aromatic amino acids, comprising culturing the engineered microbial cell of any one of claims 1 to 13 in a culture medium.

16. The method of claim 15, further comprising recovering the aromatic amino acid from the culture.

17. A method for reducing the production of by-products in aromatic amino acid biosynthesis and / or increasing the yield or conversion rate of aromatic amino acids, comprising introducing a genetic modification as defined in any one of claims 1 to 11 into a microbial cell having an aromatic amino acid biosynthetic pathway.

Images