A method for constructing a low-copy plasmid production strain and its application

Abstract

The present invention provides a method for constructing a low-copy plasmid production strain and its application, and relates to the field of genetic engineering technology. The present invention, through directed transformation of E. coli JM109 (DE3) strain, uses CRISPR / Cas9 gene editing technology, inserts the antisense nucleic acid anti-rop of the rop gene into the fhuA gene, and uses the artificial promoter J23119 (SpeI) promoter to start transcription, the extraction rate of the PET series plasmid can be increased from 4.4% (plasmid extraction amount / thalline wet weight) to 20.6%, and the plasmid copy number is increased from 1 / 10 of the normal CoIE1 type plasmid to 1 / 2 of the normal CoIE1 type plasmid, which can greatly improve the efficiency of genetic engineering experiments, promote research progress in related fields, and provide new possibilities and technical support for the industrial production of plasmids.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a construction method for a low-copy plasmid production strain and an application thereof. Background Art

[0002] As a commonly used vector, CoIE1 plasmid is widely used in the field of molecular biology. Its replication mechanism is precisely regulated by RNAⅡ, RNAⅠ and Rom protein. Rom protein, encoded by rop gene, is a key regulator of CoIE1 plasmid replication. It inhibits excessive replication of plasmid by stabilizing the binding of RNAⅠ and RNAⅡ. However, this regulatory mechanism leads to a decrease in plasmid copy number, which in turn affects the amount of plasmid extraction, especially when using expression plasmids such as PET series. This problem is particularly prominent. In experiments such as conventional cloning and small-scale expression verification, the insufficient yield of low-copy plasmids increases the consumption of experimental materials and time. At the same time, the step of transforming the expression strain DE3 also affects the experimental efficiency.

[0003] Therefore, how to increase the extraction amount and copy number of CoIE1 low-copy plasmid while retaining the regulatory function of Rom protein has become an urgent problem to be solved. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide a method for constructing a low-copy plasmid production strain and its application, and to further transform the starting strain E. coli JM109 (DE3) using a directed transformation method to increase the extraction amount of CoIE1 type plasmid containing the rop gene per unit volume.

[0005] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0006] In a first aspect, the present invention provides a method for constructing a low copy plasmid production strain, the method comprising the following steps:

[0007] S1. E. coli JM109 (DE3) was selected as the starting strain, and the antisense nucleic acid anti-rop was designed and synthesized according to the sequence of the rop gene;

[0008] S2, select the fhuA gene as the genomic location for modification, design and synthesize sgRNA targeting the selected genomic location;

[0009] S3, fusing the antisense nucleic acid anti-rop synthesized in step S1 with the sgRNA synthesized in step S2 to obtain a donor plasmid by gene synthesis;

[0010] S4. The donor plasmid obtained in step S3 was transferred into the E. coli JM109 (DE3) strain, and gene editing was performed using the CRISPR / Cas9 system. After screening and verification, the modified strain JM109 (DE3)-fhuA was obtained.

[0011] Preferably, the nucleotide sequence of the antisense nucleic acid anti-rop in step S1 is as shown in SEQ ID NO.1.

[0012] SEQ ID NO.1: ggcggttttttcctgtttggtcac

[0013] Preferably, the nucleotide sequence of the sgRNA in step S2 is as shown in SEQ ID NO.2.

[0014] SEQ ID NO.2: agataatggcctttatccgc

[0015] Preferably, the antisense nucleic acid anti-rop uses the artificial promoter J23119 (SpeI) promoter to initiate transcription, and its nucleotide sequence is shown in SEQ ID NO.3.

[0016] SEQ ID NO.3: ttgacagctagctcagtcctaggtataatactagt

[0017] In a second aspect, the present invention provides a low copy plasmid production strain, which is constructed by the construction method described in the first aspect.

[0018] In a third aspect, the present invention provides the use of the construction method described in the first aspect or the strain described in the second aspect in the extraction of CoIE1 type low copy plasmid containing the rop gene.

[0019] Preferably, the low copy plasmid is a PET series plasmid.

[0020] Beneficial effects of the present invention:

[0021] The present invention can significantly improve the extraction amount and copy number of CoIE1 type plasmid by directing the transformation of E.coli JM109 (DE3) strain, using CRISPR / Cas9 gene editing technology, inserting the antisense nucleic acid anti-rop of the rop gene on the fhuA genome, and using the artificial promoter J23119 (SpeI) promoter to start transcription. The plasmid extraction rate can be increased from 4.4% (plasmid extraction amount / microorganism wet weight) to 20.6%, and the plasmid copy number is increased from 1 / 10 of the normal ColE1 type plasmid to 1 / 2 of the normal ColE1 type plasmid. At the same time, the efficiency of genetic engineering experiments is greatly improved, the research progress in related fields is promoted, and new possibilities and technical support are provided for the industrial production of plasmids. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the anti-rop-sgRNA plasmid map after modification in Example 1.

[0023] Figure 2 The agarose gel electrophoresis diagram of the colony PCR product in Example 1.

[0024] Figure 3 This is a comparison chart of the sequencing results in Example 1.

[0025] Figure 4 This is a graph showing the bacterial test results of the transformed strain in Example 2. DETAILED DESCRIPTION

[0026] The technical solution of the present invention is further described below by specific implementation methods. It should be understood by those skilled in the art that the embodiments are only to help understand the present invention and should not be regarded as specific limitations of the present invention.

[0027] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0028] Example 1: Design of antisense RNA anti-rop and synthesis of donor plasmid

[0029] The antisense RNA in the present invention refers to class I translation level regulatory RNA. The antisense RNA binds to the mRNA of the rop gene, causing the mRNA of the rop gene to degrade or form a spatial barrier, thereby preventing the mRNA from being translated into protein.

[0030] The designed antisense RNA sequence (SEQ ID NO.1) is: ggcggttttttcctgtttggtcac, named anti-rop.

[0031] By sequencing the fhuA region of the JM109 (DE3) genome, the sgRNA sequence was agataatggcctttatccgc (SEQ ID NO. 2), and the anti-rop was inserted into the fhuA region.

[0032] The gene sequence of the upstream recombination arm (SEQ ID NO.4) is:

[0033] gaaggttcaaacgattcgctatagctgaagtaaggtgttacaccattatcaaacaggtagttaacaccaccacgccaggtaaactgtttgtcatcacgtttatcggtcgtcccggcaacgcggttaagag attcttgatctgcccagtcataacgaccgcctagggtgaccagcactttatcccactgcgcctgatcctgaacataaacgcccgtttgtttctgtttattcagaatgcggtaagggccggagtttgccgg atctttggcattgaagtcgaaatcggtattcaccggattgtacagattgagcagtggcacaggtcgtcgtaaccaaaccaggcgttgatgtcattacgcatacgcataaagtcgacaccggtcagcagg gtgtggtcgatatcgccagtggcaaacttgctctgcaactgggtatcaacggagaagttttgcagcttctcatcatcaacgacgtatttacgtgccttgacagctagctcagtcctaggtataatactagt

[0034] The gene sequence of the downstream recombination arm (SEQ ID NO.5) is:

[0035] cgctaatgccgcacactgtttgctgtaagcattcgccggatcggagcagacgccgtaaccataaacgctgttttgcgaggttttgttttcagcaaagcgcaggttctgacgcacagtaaaggtgtcgttaaattcgtgatcgaagctgtagccgaccatcttctcattacgagaataggtgttgttcttcgccccttcattaaagtctgtcggcagacgcttaccgttcggcagcggctcaacggttccctctttcggcaaccagccgtaataaccggtttccggctcgttctggaagtaagaaaggaaggtaaaattggttttatcatccggacgccaggtgaacgccggtgcaatagcataacgctgctcttctgaccctttctgctgggcattggcagaacgcgcaagaccggtcaggcgataagagtaaacaccgtcatcatccaacgaatcgctaaagtcaaaaccagtctgga

[0036] The designed donor gene sequence for gene editing insertion (SEQ ID NO.6) is:

[0037]

[0038] The sgRNA sequence was fused with the donor gene sequence and constructed between the SpeI (actagt) and EcoRI (gaattc) sites of the ptargetf plasmid, named anti-rop-sgRNA. The gene sequence is shown in SEQ ID NO.7 and the plasmid map is shown in Figure 1 shown.

[0039] Gene sequence of anti-rop-sgRNA (SEQ ID NO.7):

[0040]

[0041] Anti-rop-sgRNA gene sequence verification:

[0042] The anti-rop-sgRNA gene sequence was decomposed into three gene fragments A / B / C containing overlapping regions (indicated by the underlined part).

[0043] The gene fragment A sequence (SEQ ID NO.8) is as follows:

[0044] atgctggatccttgacagctagctcagtcctaggtataat actagtagataatggcctttatccgcgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttttg gaaggttcaaacgattcgctatag

[0045] The gene fragment B sequence (SEQ ID NO.9) is as follows:

[0046] gaaggttcaaacgattcgctatag ctgaagtaaggtgttacaccattatcaaacaggtagttaacaccaccacgccaggtaaactgtttgtcatcacgtttatcggtcgtcccggcaacgcggttaagagattcttgatctgcc cagtcataacgaccgcctagggtgaccagcactttatcccactgcgcctgatcctgaacataaacgcccgtttgtttctgtttattcagaatgcggtaagggccggagtttgccggatct ttggcattgaagtcgaaatcggtattcaccggattgtacagattgagcagtggcacagagtcgtcgtaaccaaaccaggcgttgatgtcattacgcatacgcataaagtcgacaccggtc agcagggtgtggtcgatatcgccagtggcaaacttgctctgcaactgggtatcaacggagaagttttgcagcttctcatcatcaacgacgtatttacgtgccttgacagctagctcagtcc taggtataatactagtggc ggt

[0047] The gene fragment C sequence (SEQ ID NO.10) is as follows:

[0048] taggtataatactagtggcggt tttttcctgtttggtcactttttttcgctaatgccgcacactgtttgctgtaagcattcgccggatcggagcagacgccgtaaccataaacgctgttttgcgaggttttgttttcagcaaagcgca ggttctgacgcacagtaaaggtgtcgttaaattcgtgatcgaagctgtagccgaccatcttctcattacgagaataggtgttgttcttcgccccttcattaaagtctgtcggcagacgcttaccgt tcggcagcggctcaacggttccctctttcggcaaccagccgtaataaccggtttccggctcgttctggaagtaagaaaggaaggtaaaattggttttatcatccggacgccaggtgaacgccggtg caatagcataacgctgctcttctgaccctttctgctgggcattggcagaacgcgcaagaccggtcaggcgataagagtaaacaccgtcatcatccaacgaatcgctaaagtcaaaaccagtctgga gaattctctagagtcgacctgcagaagcttagatct

[0049] The three gene fragments A / B / C were synthesized separately by overlap extension PCR technology, and the obtained gene fragments A / B / C and ptargetf plasmid were mixed in equal proportions. The 2x Gibson Assembly recombination kit was used to isothermally recombined at 50 degrees in a PCR instrument for 1 hour. The reaction system is shown in Table 1.

[0050] Table 1

[0051] Gene fragment A 3.3ul Gene segment B 3.3ul Gene fragment C 3.3ul 2xGibsonAssembly recombinase (Hongxun Biotechnology) 10ul Total 20ul

[0052] 20ul of the recombinant product was transferred to 100ul of E. coli March1-T1 competent cells. After ice bathing for 30min, heat shock was performed in a 42-degree water bath for 90s. After ice bathing for 3min again, 700ul of LB liquid medium without antibiotics was added. After culturing at 210rpm for 1h in a 37-degree constant temperature shaker, centrifuge at 6000rpm for 4min, the upper LB liquid medium was discarded, and the remaining approximately 200ul of liquid was mixed with the bacterial precipitate and spread on LB solid medium containing ampicillin for overnight culture. Eight suitable single colonies were extracted from the overnight culture dish for colony PCR detection. The colony PCR products were analyzed by 1.5% agarose gel electrophoresis. The analysis results are as follows: Figure 2 As shown in the figure, 8 single colonies randomly selected for PCR testing, 7 of which were positive (the detection size should be 1287 BP). The qualified bacterial liquid was saved, and the plasmid was extracted after culture and amplification for sequencing. The sequencing results are shown in the figure. Figure 3 As shown, after Sanger sequencing, the final anti-rop-sgRNA sequence obtained was completely consistent with the designed sequence.

[0053] Example 2: Using CRISPR / Cas9 gene editing technology to modify the chromosome genome of the target strain

[0054] (1) Prepare the electroporation competent cells of E. coli JM109 (DE3) strain, transform the Cas9 plasmid into E. coli JM109 (DE3) cells, spread the bacterial solution onto kan resistance plates, and culture at 37°C; pick a single clone for PCR verification the next day, prepare electroporation competent cells (induced by arabinose) from the positive clones, and name them JM109 (DE3) -Cas9; transform the anti-rop-sgRNA into JM109 (DE3) -Cas9 cells, spread the bacterial solution onto kan + Spec resistance plates, and culture at 37°C overnight; pick a single clone for PCR verification and expand the culture the next day, use primers to amplify the target gene, recover and purify the PCR product by agarose gel electrophoresis, and recover the DNA for sequencing verification.

[0055] (2) Transfer the correct mutant strain in the above steps to a solid culture medium supplemented with Kan and rhamnose, and culture at 37°C overnight; the next day, pick a single clone to a Kan-resistant liquid culture medium, culture at 37°C for 6 hours, and then transfer it to a Spec-resistant liquid culture medium to screen for clones with Kan resistance but not Spec resistance, dilute the bacterial solution and spread it on an LB solid culture medium without resistance containing sucrose, and culture at 37°C overnight (if necessary, the above two plasmid removal steps can be subcultured multiple times); the next day, pick a single clone to an antibiotic-free liquid culture medium, culture at 37°C for 6 hours, and then transfer it to a kan-resistant liquid culture medium; screen for clones without Kan resistance, spread them on antibiotic-free, Kan-resistant and Spec-resistant plates, and culture at 37°C overnight; if the resistance has been completely removed, use the preset upstream and downstream primers of the target gene, recover and purify the PCR product by agarose gel electrophoresis, recover the DNA for sequencing verification, and the bacterial test results are as follows: Figure 4 shown.

[0056] The target bacteria detection primer sequences are shown in Table 2.

[0057] Table 2

[0058] Primer-F ggcggttttttcctgtttggtcac SEQ ID NO.11 Primer-R gccggtactgacagcctg SEQ ID NO.12

[0059] The bacterial detection reaction system is shown in Table 3.

[0060] Table 3

[0061] Primer-F 1ul Primer-R 1ul Suitable single colony culture solution 5ul 1.25XPCRmix (Hongxun Biotechnology) 28ul <![CDATA[ddH2O]]> - Total 35ul

[0062] Example 3: Calculation of PET plasmid extraction rate

[0063] This example uses PET-28a plasmid as an example to demonstrate the comparison of plasmid extraction rates. PET-28a plasmid was extracted using the strain modified in Example 2, and the PET plasmid extraction rate (plasmid extraction amount / microorganism wet weight) was calculated. The comparison results are shown in Table 4.

[0064] Table 4

[0065]

[0066] After comparison, the modified JM109(DE3):anti-rop strain can extract PET series plasmids and other CoIE1 plasmids containing rop gene, with an extraction rate 4.6 times higher than that of the unmodified JM109(DE3) original strain, which has good practical application prospects in the field of molecular cloning and low-copy plasmid production and preparation.

[0067] The applicant declares that the above is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention shall fall within the protection scope and disclosure scope of the present invention.

Claims

1. A method for constructing a low-copy plasmid production strain, characterized in that: The method comprises the following steps: S1. E. coli JM109 (DE3) was selected as the starting strain, and the antisense nucleic acid anti-rop was designed and synthesized according to the sequence of the rop gene; S2, select the fhuA gene as the genomic location for modification, design and synthesize sgRNA targeting the selected genomic location; S3, fusing the antisense nucleic acid anti-rop synthesized in step S1 with the sgRNA synthesized in step S2 to obtain a donor plasmid by gene synthesis; S4. The donor plasmid obtained in step S3 was transferred into the E. coli JM109 (DE3) strain, and gene editing was performed using the CRISPR / Cas9 system. After screening and verification, the modified strain JM109 (DE3)-fhuA was obtained.

2. The construction method according to claim 1, characterized in that: The nucleotide sequence of the antisense nucleic acid anti-rop is shown in SEQ ID NO.

1.

3. The construction method according to claim 1, characterized in that: The nucleotide sequence of the sgRNA in step S2 is shown in SEQ ID NO.

2.

4. The construction method according to claim 1, characterized in that: The antisense nucleic acid anti-rop uses the artificial promoter J23119 (SpeI) promoter to initiate transcription, and its nucleotide sequence is shown in SEQ ID NO.

3.

5. A low copy plasmid production strain, characterized in that: The strain is constructed by the construction method described in any one of claims 1 to 4.

6. Use of the construction method according to any one of claims 1 to 4 or the strain according to claim 5 in the extraction of CoIE1 type low-copy plasmid containing the rop gene.

7. The use according to claim 6, characterized in that: The low copy plasmid is a PET series plasmid.

Images