Method for expressing mussel fusion protein by taking bacillus subtilis as chassis strain

Abstract

The invention relates to the field of microbial engineering in biochemical engineering technology, in particular to a method for expressing mussel fusion protein by taking bacillus subtilis as a chassis strain. According to the invention, bacillus subtilis 168 or bacillus subtilis KP8 with extracellular protease knocked out is used as a chassis strain, an expression plasmid containing a promoter (containing ribosome binding sites), a signal peptide, a solubilization tag, mussel fusion protein, a purification tag and a terminator is transformed into the bacillus subtilis by using a chemical transformation method or an electric shock transformation method, and the bacillus subtilis is obtained. The expression quantity of fermentation culture of the mussel fusion protein is improved. The amino acid sequence of the recombinant mussel fusion protein comprises one or more mussel characteristic proteins, and an optimized gene sequence designed by combining the characteristics can effectively improve the yield and the functional performance of the recombinant mussel fusion protein. The mussel fusion protein has good operability and relatively strong application potential, and an innovative solution is provided for industrial production of the mussel fusion protein.

Description

Technical Field

[0001] The invention relates to the field of microbial engineering in biochemical technology, and in particular to a method for expressing mussel fusion protein by using a Bacillus subtilis strain as a chassis. Background Art

[0002] In recent years, with the rapid development of biotechnology, the construction and application of cell factories have gradually become an important research direction in the field of bioengineering. In particular, microorganisms, as the chassis strains for the production of biological products, are increasingly attracting attention in the application of drugs, enzymes, vaccines and food additives. Among them, Bacillus subtilis has become a widely used protein expression system in industrial production and scientific research due to its non-pathogenicity, easy cultivation and ability to secrete a large amount of protein.

[0003] The production of recombinant proteins is one of the core technologies of modern biotechnology, which involves transferring specific genes into host cells and expressing and folding them correctly in the cells. Mussel fusion protein has become one of the research hotspots due to its unique biological activity and potential industrial application value. Although a variety of expression systems have been applied to the production of recombinant mussel fusion proteins, how to improve their expression level, folding efficiency and subsequent purification effect is still a challenge for current scientific research.

[0004] In many studies, the strategy of using Bacillus subtilis as a chassis strain to express recombinant proteins has achieved good results. However, there is still a lack of systematic research and effective methods to effectively insert and efficiently express mussel fusion proteins in Bacillus subtilis.

[0005] Based on this, this patent proposes a method for expressing recombinant mussel fusion protein using Bacillus subtilis as a chassis strain to achieve more efficient protein production. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide a recombinant Bacillus subtilis expressing mussel fusion protein in view of the deficiencies of the prior art, so as to achieve more efficient production of mussel adhesion protein.

[0007] The technical problem that the present invention needs to solve is to provide a method for constructing the above-mentioned recombinant Bacillus subtilis.

[0008] The technical problem that the present invention needs to solve is to provide the use of the above-mentioned recombinant Bacillus subtilis in secretory expression of mussel adhesion protein.

[0009] The final technical problem to be solved by the present invention is to provide a method for expressing mussel fusion protein using the recombinant Bacillus subtilis.

[0010] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:

[0011] A recombinant Bacillus subtilis expressing mussel fusion protein is obtained by taking Bacillus subtilis as a chassis strain and transforming an expression plasmid containing a promoter, a signal peptide, a lytic tag, mussel fusion protein, a purification tag and a terminator into Bacillus subtilis to obtain the recombinant Bacillus subtilis.

[0012] Wherein, the promoter contains a ribosome binding site, and the ribosome binding site is downstream of the promoter.

[0013] Among them, in the expression plasmid, the connection mode between the various elements is: promoter-signal peptide-solubilizing tag-mussel fusion protein-purification tag-terminator. Specifically, the connection mode is direct connection or connection through a connecting peptide.

[0014] Specifically, any one of the connecting peptides (GGGGS)n, (G)n, (EAAAK)n, and (XP)n, wherein n represents the number of repetitions of the connecting peptide, and n=1-3.

[0015] Wherein, the promoter is an inducible promoter or a constitutive promoter.

[0016] Specifically, the inducible promoter includes but is not limited to any one of P43, PHpaII, PlapS, and PamyQ, and the constitutive promoter includes but is not limited to any one of Pgrac, Pspac, and Pxyl.

[0017] Specifically, the nucleotide sequences of the promoters P43, PHpaII, PlapS, PamyQ, Pgrac, Pspac, and Pxyl are shown in SEQ ID NOs. 21 to 27, respectively.

[0018] Wherein, the terminator is a Rho-dependent terminator or a Rho-independent terminator.

[0019] Specifically, the Rho-dependent terminator includes but is not limited to any one of T1, T2, T3, and T4; the Rho-independent terminator includes but is not limited to any one of TR1, TR2, and TR3.

[0020] Specifically, the nucleotide sequences of the terminators T1, T2, T3, T4, TR1, TR2, and TR3 are shown in SEQ ID NOs. 50 to 56, respectively.

[0021] Wherein, the signal peptide includes but is not limited to SP amyQ , SP AmyE , SP NprE , SP PgsA , SPLipA , SP PhaA , SP BslA , SP LecA In the prior art, short peptide sequences that can be used as signal peptides of Bacillus subtilis are within the scope of protection of the present invention, and they can be exogenous, artificially designed, or fused with multiple signal peptides.

[0022] Specifically, the signal peptide SP amyQ , SP AmyE , SP NprE , SP PgsA , SP LipA , SP PhaA , SP BslA , SP LecA , and their nucleotide sequences are shown in SEQ ID NOs.28 to 35 respectively.

[0023] The lytic tag includes but is not limited to any one of GFP, SPY, SUMO, Trx, NusA, DsbA, and Poly-Arg.

[0024] Specifically, the nucleotide sequences of the lytic tags GFP, SPY, SUMO, Trx, NusA, DsbA, and Poly-Arg are shown in SEQ ID NOs. 36 to 42, respectively.

[0025] The purification tag includes but is not limited to any one of His-Tag, GST, MBP, Strep-tag II, FLAG, T7, and Protein A.

[0026] Specifically, the purification tags His-Tag, GST, MBP, Strep-tag II, FLAG, T7, and Protein A, their nucleotide sequences are shown in SEQ ID NOs. 43 to 49 respectively.

[0027] Among them, the mussel fusion protein includes any one or a combination of Mfp-1, Mfp-2, Mfp-3, Mfp-4, Mfp-5, and Mfp-6 to meet the needs of protein activity in different scenarios.

[0028] Specifically, the nucleotide sequences of Mfp-1, Mfp-2, Mfp-3, Mfp-4, Mfp-5 and Mfp-6 are shown in SEQ ID NOs. 1 to 6 respectively.

[0029] Furthermore, when any combination of the mussel fusion proteins Mfp-1, Mfp-2, Mfp-3, Mfp-4, Mfp-5, and Mfp-6 is used, the mussel fusion proteins are directly connected to the mussel fusion proteins, or connected by a connecting peptide;

[0030] Furthermore, the connecting peptide includes any one of (GGGGS)n, (G)n, (EAAAK)n, and (XP)n, where n represents the number of repetitions of the connecting peptide, and n=1-3.

[0031] For example, the mussel fusion protein Mfp-151 is a direct connection of Mfp-1, Mfp-5, and Mfp-1 in sequence; the mussel fusion protein Mfp-1561 is a direct connection of Mfp-1, Mfp-5, Mfp-6, and Mfp-1 in sequence.

[0032] For example, mussel fusion protein Mfp-1 (GGGGS) n 5(GGGGS) n 1 sequence, which is a linker peptide (GGGGS) between Mfp-1, Mfp-5, and Mfp-1. n connect.

[0033] Wherein, the transformation is a chemical transformation method or an electroporation transformation method.

[0034] Among them, before using the chemical transformation method or the electroporation transformation method, Bacillus subtilis needs to enter the competent state in advance.

[0035] Specifically, the preparation method of competent state of Bacillus subtilis by the chemical transformation method is as follows: (1) Use a sterile inoculation loop to streak the bacterial solution from the glycerol tube onto an LB solid plate and culture at 37°C overnight; (2) Pick a single colony and inoculate it into 5 mL GMI solution. Culture at 37°C, 200 rpm overnight; (3) Transfer 2 mL of the culture solution to 18 mL of GMI solution. Culture at 37°C, 200 rpm with shaking for 3.5 h; (4) Transfer 10 mL of the culture solution to 90 mL of GMII solution. Culture at 37°C, 200 rpm for 1.5 h; (5) Collect the bacteria by centrifugation at 8,000 rpm, resuspend the bacteria with 10 mL of supernatant, add 5 mL of sterile 50% glycerol, mix well, aliquot and freeze at -80°C.

[0036] Specifically, the preparation method of the competent state of Bacillus subtilis by the electroporation transformation method is as follows: pick a single colony from a plate and inoculate it in 5ml LB medium and culture it overnight. Then transfer it to GM with 50ml of culture medium. Cultivate at 37°C and 200rpm. Take all the bacterial solution and put it in an ice water bath for 10min, then centrifuge at 5000rpm, 10min, and 4°C to collect the bacteria. Then wash the bacteria with 40mL of pre-cooled electroporation buffer ETM, centrifuge at 5000rpm, 10min, and 4°C to remove the supernatant, and rinse 3 times. Resuspend the washed bacteria in 500μL of ETM, and dispense 1mL into each tube. Take an appropriate amount of competent cells and add plasmids. After incubation in an ice bath for 5min, add them to a pre-cooled electroporation cup (1mm), electroporate once at 1.0~3.0kv for 1~5ms, and immediately add 1mL of recovery medium RM after the electroporation, 37°C, 200rpm, and after recovery for 3h, apply the plate. Incubate at 37°C overnight.

[0037] Wherein, the Bacillus subtilis is Bacillus subtilis.168, or Bacillus subtilis.KP8 with extracellular protease knocked out.

[0038] Specifically, gene editing technology can be used to knock out the extracellular protease to avoid the degradation of mussel fusion protein.

[0039] Specifically, the extracellular protease includes any one or a combination of several of aprE, nprE, nprB, epr, mpr, vpr, wprA, and bpr.

[0040] In some embodiments of the present invention, the Bacillus subtilis.KP8 with the extracellular protease knocked out is Bacillus subtilis.KP8 with aprE, nprE, nprB, epr, mpr, vpr, wprA and bpr knocked out from Bacillus subtilis.168.

[0041] The method for constructing the recombinant Bacillus subtilis expressing the mussel fusion protein comprises the following steps:

[0042] (1) purifying the PCR product containing a promoter, a signal peptide, a lytic tag, a mussel fusion protein, a purification tag and a terminator obtained by overlapping PCR, and then connecting it with a linearized plasmid to obtain a mussel fusion protein expression plasmid;

[0043] (2) Transforming the mussel fusion protein expression plasmid into Bacillus subtilis competent cells to obtain the recombinant Bacillus subtilis.

[0044] Among them, the plasmid includes but is not limited to the plasmid pHT43 mentioned in the embodiment of the present invention. In the prior art, the plasmid vector that can be used as the plasmid skeleton of the mussel fusion protein expression plasmid is within the scope of protection of the present invention.

[0045] The use of the recombinant Bacillus subtilis expressing mussel fusion protein in secretory expression of mussel adhesion protein is also within the scope of protection of the present invention.

[0046] A method for expressing mussel fusion protein by using the recombinant Bacillus subtilis comprises inoculating the seed liquid of the recombinant Bacillus subtilis into a culture medium for fermentation culture, centrifuging to obtain the supernatant, separating and purifying to obtain the secretory expressed mussel adhesion protein.

[0047] The culture medium is 2*SR liquid culture medium, and its formula is: peptone 20-50g / L, yeast powder 40-60g / L, K 2 HPO 4 5~8g / L, the preferred formula is: peptone 30g / L, yeast powder 50g / L, K 2 HPO 4 6g / L; the fermentation culture, the fermentation conditions are: 30-37°C, 100-300rpm culture for 36-72h, the preferred fermentation conditions are: 37°C, 200rpm culture for 48h.

[0048] When the promoter is an inducible promoter, the fermentation culture is cultured to OD 600 When the value is 0.6 to 1.0, an inducer is added, wherein the inducer includes but is not limited to maltose, xylose, lactose or IPTG, preferably IPTG.

[0049] Beneficial effects:

[0050] 1. Efficient expression and increased yield: The present invention optimizes the expression system of Bacillus subtilis and enhances the transcription and translation efficiency of mussel fusion protein by in-depth study of the genomic characteristics of Bacillus subtilis and its binding mechanism with mussel fusion protein, significantly improves the expression level and yield of mussel fusion protein, and provides feasibility for large-scale industrial production.

[0051] 2. Good protein folding and activity stability: The present invention develops suitable culture conditions and processes to ensure that the expressed Bacillus subtilis can correctly fold the mussel fusion protein during the expression process and maintain its biological activity and functionality, thereby ensuring the effectiveness of the final product in application.

[0052] 3. Simplified separation and purification process: The present invention simplifies the extraction and purification process of mussel fusion protein by utilizing the secretion characteristics of Bacillus subtilis, reduces the time and cost in the production process, improves economic benefits and improves the operability and efficiency of the process.

[0053] 4. Provides a safe and reliable production system: Bacillus subtilis is a non-pathogenic microorganism with extremely high safety. It is suitable for use in sensitive fields such as food and medicine, reducing potential biosafety risks.

[0054] 5. Expanded the application potential of mussel fusion protein: mussel fusion protein can be widely used in multiple industries such as medicine (such as biological drugs, vaccines), food additives, agricultural biological preparations, etc. The present invention uses an efficient production method to enable mussel fusion protein to be widely used in the fields of medicine, food, materials science, etc., meet the market demand for specific biological preparations, increase the market value of mussel fusion protein, and have good commercial prospects.

[0055] 6. Promote the progress of microbial engineering technology: The present invention provides new ideas and methods for the research on the synthesis of complex proteins using microorganisms, which will help promote the development of microbial engineering and protein engineering and promote the research and development of new technologies and new products.

[0056] 7. Sustainability and economic advantages: The present invention achieves efficient use of resources and reduces production costs by optimizing culture conditions and production processes, which meets the requirements of modern biotechnology for sustainable development.

[0057] In summary, the method of expressing mussel fusion protein using Bacillus subtilis as a chassis strain in the present invention not only improves the production efficiency and activity of the protein, but also ensures safety and economy, has significant application value, and provides strong support for research and industrial development in related fields. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] The present invention will be further described in detail below with reference to the accompanying drawings, and the above and / or other advantages of the present invention will become more clear.

[0059] Figure 1 This is a DNA nucleic acid gel image of different mussel fusion proteins.

[0060] Figure 2 The present invention is a schematic diagram of the construction of a mussel fusion protein expression plasmid in a preparation method for expressing mussel fusion protein using Bacillus subtilis as a chassis strain.

[0061] Figure 3 This is the protein electrophoresis diagram after the Bacillus subtilis chassis transformation.

[0062] Figure 4This is a plate diagram of screening positive expression strains using chemical transformation and electroporation transformation. The first row of plates is a plate transformed using the chemical transformation method, and from left to right, they contain positive expression strains of Mfp-1, Mfp-1561, Mfp-35, and Mfp-3⊕5; the second row of plates is a plate transformed using the electroporation transformation method, and from left to right, they contain positive expression strains of Mfp-1, Mfp-1561, Mfp-35, and Mfp-3⊕5.

[0063] Figure 5 This is the protein gel electrophoresis diagram after separation and purification, taking the recombinant mussel fusion protein Mfp-151 as an example.

[0064] Figure 6 It is a bar chart of the yield of different mussel fusion proteins under fermentation regulation. DETAILED DESCRIPTION

[0065] The present invention will be further described in detail below in conjunction with specific implementations, and the above and / or other advantages of the present invention will become more clear.

[0066] The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and materials described are commercially available unless otherwise specified.

[0067] Example 1: Obtaining mussel fusion protein

[0068] The gene sequences of mussel fusion proteins (Mfp-1, Mfp-2, Mfp-3, Mfp-4, Mfp-5, and Mfp-6) after codon optimization were submitted to General Biotech for synthesis, and then overlapping PCR was performed on the synthesized single-fragment mussel fusion protein genes to obtain the DNA sequence of the recombinant mussel fusion protein.

[0069] Among them, the nucleotide sequences of the codon-optimized mussel fusion proteins Mfp-1 to 6 are shown in SEQ ID NO.1 to 6 respectively.

[0070] Wherein, the single-fragment mussel fusion protein genes are subjected to overlapping PCR, and any one or several of the above-mentioned 6 types of mussel fusion proteins can be selected for permutation and combination, and the single-fragment mussel fusion proteins can be connected by connecting peptides, such as: (GGGGS)n, (G)n, (EAAAK)n, (XP)n, etc., and the connecting peptides are represented by "⊕". For example, in this embodiment, recombinant mussel fusion proteins Mfp-151, Mfp-1561, Mfp-35, Mfp-36, Mfp-53, Mfp-56, Mfp-63, Mfp-65, Mfp-3⊕5, Mfp-3⊕6, Mfp-5⊕3, Mfp-5⊕6, Mfp-6⊕3, Mfp-6⊕5 are obtained through overlapping PCR, and their nucleotide sequences are shown in SEQ ID NO.7 to 20.

[0071] (1) Taking the recombinant mussel fusion protein Mfp-151 as an example, based on the synthesized Mfp-1 fragment, primers F-Mfp1 and R-15 were used to amplify the Mfp-151-head 1 fragment of Mfp-151; based on the synthesized Mfp-5 fragment, primers F-15 and R-51 were used to amplify the Mfp-151-middle 5 fragment of Mfp-151; based on the synthesized Mfp-1 fragment, primers F-51 and R-His were used to amplify the Mfp-151-tail 1 fragment of Mfp-151; then, the three fragments were amplified by overlapping PCR using primers F-Mfp1 and R-His to obtain Mfp-151.

[0072] (2) Taking the recombinant mussel fusion protein Mfp-1561 as an example. Based on the synthesized Mfp-1 fragment, primers F-Mfp1 and R-15 were used to amplify the Mfp-1561-head 1 fragment of Mfp-1561; based on the synthesized Mfp-5 fragment, primers F-15 and R-56 were used to amplify the Mfp-1561-middle 5 fragment of Mfp-1561; based on the synthesized Mfp-6 fragment, primers F-56 and R-61 were used to amplify the Mfp-1561-middle 6 fragment of Mfp-1561; based on the synthesized Mfp-1 fragment, primers F-61 and R-His were used to amplify the Mfp-1561-tail 1 fragment of Mfp-1561; then, primers F-Mfp1 and R-His were used to amplify the above four fragments by overlapping PCR to obtain Mfp-1561.

[0073] (3) Taking the recombinant mussel fusion protein Mfp-35 as an example, based on the synthesized Mfp-3 fragment, primers F-Mfp3 and R-35 were used to amplify the Mfp-35-3 fragment of Mfp-35; based on the synthesized Mfp-5 fragment, primers F-35 and R-His were used to amplify the Mfp-35-5 fragment of Mfp-35; then, primers F-Mfp3 and R-His were used to amplify the above two fragments by overlapping PCR to obtain Mfp-35.

[0074] The acquisition process of other recombinant mussel fusion proteins Mfp-36, Mfp-53, Mfp-56, Mfp-63, and Mfp-65 refers to Mfp-35.

[0075] (4) Take the recombinant mussel fusion protein Mfp-3⊕5 as an example. Based on the synthesized Mfp-3 fragment, primers F-Mfp3 and R-3⊕5 were used to amplify the Mfp-35-3 fragment of Mfp-35; based on the synthesized Mfp-5 fragment, primers F-3⊕5 and R-His were used to amplify the Mfp-35-5 fragment of Mfp-35; then, primers F-Mfp3 and R-His were used to amplify the above two fragments by overlapping PCR to obtain Mfp-3⊕5.

[0076] The acquisition process of the other recombinant mussel fusion proteins Mfp-3⊕6, Mfp-5⊕3, Mfp-5⊕6, Mfp-6⊕3, and Mfp-6⊕5 refers to Mfp-3⊕5.

[0077] Specifically, the amplification system of the PCR amplification is: 25 μL of DNA polymerase mixture, 2 μL of upstream primer F, 2 μL of downstream primer R, X μL of template DNA, ddH 2 O up to 50μL; the reaction conditions of the PCR amplification are: 95℃3min; 95℃15sec, 56~72℃15sec, 72℃30~60sec, 25~35 cycles; 72℃5min.

[0078] The primers used in the above PCR process are shown in Table 1 below. Figure 1 Shown are DNA nucleic acid gel images of different mussel fusion proteins.

[0079] Table 1 Primers used in the PCR process in Example 1

[0080]

[0081]

[0082]

[0083] Example 2: Construction of mussel fusion protein expression plasmid

[0084] The corresponding mussel fusion protein expression plasmid was constructed by overlapping PCR and homologous recombination. Primers were designed to amplify the promoter (containing the ribosome binding site RBS) sequence, signal peptide sequence, lytic tag sequence, purification tag sequence and terminator sequence. Then, overlapping PCR was performed with the mussel fusion protein fragment, and finally, the overlapping PCR fragment was connected to the plasmid backbone linearized with restriction endonucleases by homologous recombination. The specific expression plasmid construction process is as follows, Figure 2 A schematic diagram of the construction of the mussel fusion protein expression plasmid is shown.

[0085] 1. PCR amplification / synthesis of promoter (ribosome binding site is already included in the promoter sequence)

[0086] Plasmid pHT43 was used as a template and primers Pgrac-F and Pgrac-R were used to amplify the Pgrac promoter (the ribosome binding site was already included in the promoter sequence). Other promoters (P43, PHpaII, PlapS, PamyQ, Pspac, Pxyl) and the attached ribosome binding sites were synthesized by General Biotech. The nucleotide sequences of the promoters P43, PHpaII, PlapS, PamyQ, Pgrac, Pspac, and Pxyl are shown in SEQ ID NOs. 21 to 27, respectively.

[0087] 2. PCR amplification / synthesis of signal peptide

[0088] Using plasmid pHT43 as template and primers SP amyQ -F and SP amyQ -R amplifies SP amyQ Signal peptide. Other signal peptides (SP AmyE , SP NprE , SP PgsA , SP LipA , SP PhaA , SP BslA , SP LecA ) was synthesized by General Biotechnology. The signal peptide SP amyQ , SP AmyE , SP NprE , SP PgsA , SP LipA , SP PhaA , SP BslA , SP LecA , and their nucleotide sequences are shown in SEQ ID NOs.28 to 35 respectively.

[0089] 3. PCR amplification / synthesis of lytic tags

[0090] Using the E. coli genome as a template, the ATP-independent periplasmic chaperone SPY lytic tag was amplified using primers SPY-F and SPY-R. Other lytic tags (GFP, SUMO, Trx, NusA, DsbA, Poly-Arg) were synthesized by General Bio. The nucleotide sequences of the lytic tags GFP, SPY, SUMO, Trx, NusA, DsbA, Poly-Arg are shown in SEQ ID NOs. 36 to 42, respectively.

[0091] 4. PCR amplification of mussel fusion protein

[0092] Primers Mfp-1-F and Mfp-1-R; primers Mfp-2-F and Mfp-2-R; primers Mfp-3-F and Mfp-3-R; primers Mfp-4-F and Mfp-4-R; primers Mfp-5-F and Mfp-5-R; primers Mfp-6-F and Mfp-6-R; primers Mfp-35-F and Mfp-35-R; primers Mfp p-36-F and Mfp-36-R; primers Mfp-53-F and Mfp-53-R; primers Mfp-56-F and Mfp-56-R; primers Mfp-63-F and Mfp-63-R; primers Mfp-65-F and Mfp-65-R; primers Mfp-3⊕5-F and Mfp-3⊕5-R; primers Mfp-3⊕6-F and Mfp- 3⊕6-R; primers Mfp-5⊕3-F and Mfp-5⊕3-R; primers Mfp-5⊕6-F and Mfp-5⊕6-R; primers Mfp-6⊕3-F and Mfp-6⊕3-R; primers Mfp-6⊕5-F and Mfp-6⊕5-R respectively amplify Mfp-1 and Mfp-2 synthesized by General Biotech or obtained by overlapping PCR in Example 1 ,Mfp-3,Mfp-4,Mfp-5,Mfp-6,Mfp-151,Mfp-1561,Mfp-35,Mfp-36,Mfp-53,Mfp- 56. Mfp-63, Mfp-65, Mfp-3⊕5, Mfp-3⊕6, Mfp-5⊕3, Mfp-5⊕6, Mfp-6⊕3, Mfp-6⊕5 fragments.

[0093] 5. Synthetic purification tags

[0094] Purification tags such as His-Tag, GST, MBP, Strep-tag II, FLAG, T7, and Protein A are synthesized by general biotechnology, and their nucleotide sequences are shown in SEQ ID NOs. 43 to 49. When the plasmid backbone contains one or more of the above purification tags, it does not need to be additionally synthesized or overlapped with the target fragment by PCR, and can be directly used during enzyme digestion and reconnection.

[0095] 6. Synthetic terminator

[0096] Rho-dependent terminators (T1, T2, T3, T4) and Rho-independent terminators (TR1, TR2, TR3) were synthesized by General Biotech. The nucleotide sequences of the terminators T1, T2, T3, T4, TR1, TR2, TR3 are shown in SEQ ID NOs. 50 to 56. When one or more of the terminators are present in the plasmid backbone, no additional synthesis or PCR overlap with the target fragment is required, and the terminators can be directly used during enzyme cutting and reconnection.

[0097] The amplification system of the PCR amplification is as follows: 25 μL of DNA polymerase mixture, 2 μL of upstream primer F, 2 μL of downstream primer R, X μL of template DNA, ddH 2 O up to 50μL; the reaction conditions of the PCR amplification are: 95℃3min; 95℃15sec, 56~72℃15sec, 72℃30~60sec, 25~35 cycles; 72℃5min.

[0098] Select any one of the above-amplified / synthesized promoters containing ribosome binding sites, signal peptides, lytic tags, mussel fusion proteins, purification tags, and terminators (not required when purification tags and terminators exist in the plasmid backbone), and use the upstream primer of the selected promoter and the downstream primer of the mussel fusion protein (or the downstream primer of the purification tag, or the downstream primer of the terminator) to perform overlapping PCR to obtain overlapping PCR fragments, i.e., PCR products.

[0099] The obtained PCR products were used The product was purified using Gel DNA Extraction Mini Kit to obtain the purified fragment.

[0100] Construction of plasmid: Plasmid pHT43 was selected as the plasmid backbone, and the amplified plasmid pHT43 was double-digested with BamH I and XbaI, and purified as described above. After purification, the concentrations of the target gene (purified fragment) and the expression vector were determined at the same time. The molar ratio of the target gene to the expression vector was 3 to 5:1 and gently mixed. The total reaction system was 20 μL and connected at 37°C for 0.5 h. The reaction product after connection was transformed into E. coli DH5α competent cells. A single colony was picked in an LB test tube containing 50 μg / mL kanamycin, shaken and cultured at 200 rpm for 10 h, and the mussel fusion protein expression plasmid was extracted using a plasmid extraction kit. After double enzyme digestion verification, it was sent to Universal Biotech for successful sequencing.

[0101] For example, after the above steps, Pgrac-SP is constructed amyQ -SPY-RBS-Mfp-1 (or Mfp-2, Mfp-3, Mfp-4, Mfp-5, Mfp-6, Mfp-151, Mfp-1561, Mfp-35, Mfp-36, Mfp-53, M fp-56, Mfp-63, Mfp-65, Mfp-3⊕5, Mfp-3⊕6, Mfp-5⊕3, Mfp-5⊕6, Mfp-6⊕3, Mfp-6⊕5)-His-Tag-TR1 expression plasmid.

[0102] Table 2 Primer sequences used in Example 2

[0103]

[0104]

[0105]

[0106] Example 3: Construction of modified strains of Bacillus subtilis

[0107] 1. Extraction of genomic DNA from Bacillus subtilis 168

[0108] Take 1-3mL of overnight grown Bacillus subtilis.168 bacterial solution into a centrifuge tube, centrifuge at 10000rpm for 1min, discard the supernatant, add 120μL TE buffer to resuspend the bacteria, then add 80μL 20mg / mL lysozyme to mix, and incubate in a 37℃ water bath for 2h; centrifuge at 10000rpm for 1min, discard the supernatant, add 200μL TE buffer to resuspend the bacteria, and then add 100μL DNA extraction phenol reagent and vortex for 2 minutes; add 100 μL chloroform-isoamyl alcohol solution, mix and centrifuge at 13000rpm for 10 minutes, aspirate 160 μL supernatant, add 80 μL DNA extraction phenol reagent and 80 μL chloroform-isoamyl alcohol solution, mix and centrifuge at 13000rpm for 5 minutes; aspirate 100 μL supernatant, add 100 μL chloroform-isoamyl alcohol solution, mix and centrifuge at 10000rpm for 3 minutes; aspirate 40 μL supernatant into a new EP tube to obtain Bacillus subtilis.168 genomic DNA, and store at -20℃. It needs to be thawed on ice before use.

[0109] The TE buffer solution is prepared as follows: 20 mL of 0.5 M EDTA solution and 100 mL of 1 M Tris-HCl solution are measured and mixed evenly, and then the volume is adjusted to 1 L. 0.5 M EDTA solution: 18.61 g of disodium ethylenediaminetetraacetate dihydrate is weighed and 70 mL of pure water is added, 1 M NaOH solution is used to adjust the pH to 8.0 to completely dissolve it, and then the volume is adjusted to 100 mL; 1 M Tris-HCl solution: 121.14 Tris is weighed and 800 mL of pure water is added, concentrated hydrochloric acid is used to adjust the pH to 7.6 to completely dissolve it, and then the volume is adjusted to 1 L.

[0110] The preparation process of 20 mg / mL lysozyme is as follows: weigh 1 g of lysozyme and dissolve it in an appropriate volume of TE buffer, and make the volume to 50 mL.

[0111] The chloroform-isoamyl alcohol solution was prepared as follows: 96 mL of chloroform and 4 mL of isoamyl alcohol were measured and mixed evenly.

[0112] 2. Construction of knockout plasmids for Bacillus subtilis extracellular proteases (aprE, nprE, nprB, epr, mpr, vpr, wprA, bpr)

[0113] Using the genome of Bacillus subtilis.168 as a template, primers up-FX and up-RX were used to PCR amplify the upstream homology arm fragments of proteases (aprE, nprE, nprB, epr, mpr, vpr, wprA, bpr), and primers down-FX and down-RX were used to PCR amplify the downstream homology arm fragments of proteases (aprE, nprE, nprB, epr, mpr, vpr, wprA, bpr), and then overlapping PCR was performed to connect the upstream and downstream homology arms, and finally the knockout plasmid was successfully constructed. Among them, X represents any one of the extracellular proteases.

[0114] Specifically,

[0115] (1) PCR amplified the upstream and downstream homology arms of aprE using the following primers:

[0116] up-F-aprE:ttattgtgcagctgcttgtacgttgattaacccttttc

[0117] up-R-aprE: tggctcctggcgtgtccatccaaagcacacttcctgg

[0118] down-F-aprE:tcttttacagctttttcatccaatgttgctgcggccgc

[0119] down-R-aprE: atggcgttcagcaacatgtctgcgcaggctgccggaaaaag

[0120] Corresponding knockout sgRNA: TATCCTTCTACTATTGCAGTAGG

[0121] (2) PCR amplified the upstream and downstream homology arms of nprE using the following primers:

[0122] up-F-nprE:ttacaatccaacagcattccaggctgctt

[0123] up-R-nprE:atggcggtgtacacacaaacagcggaattcca

[0124] down-F-nprE:tcagtcgtgctttcaacaagcttcagccttttggaagggtca

[0125] down-R-nprE:gtgggtttaggtaagaaattgtctgttgctgtcgctgctt

[0126] Corresponding knockout sgRNA: GTGCTTGAGACAAGCGTGCCCGG (3) The upstream and downstream homology arms of nprB were amplified by PCR using the following primers: up-F-nprB: ttgcgcaacttgaccaagacatctctattactggccggct up-R-nprB: aatttaaaaaacgtttgttttgtctttggatcctttat

[0127] down-F-nprB:ctatactcctggtattgcaggagattcattgcggtca

[0128] down-R-nprB:tcatagaatgccgacagcctcatacgccttttcgactgaag

[0129] The corresponding knockout sgRNA: TATTTCATCGATGCCAAAAACGG (4) The upstream and downstream homology arms of epr were amplified by PCR using the following primers: up-F-epr: atgaaaaacatgtcttgcaaacttgttgtatcagtcactctgttttcagttttctcac up-R-epr: ctgctgcggtaaatgatacgttgttttctacatacaaaatatcagg

[0130] down-F-epr: caagttcagaaaaaacgtccctgcagaaac

[0131] down-R-epr: ttactttttcggtttgacggcgttcagccgtttttgcagctttgttttt

[0132] The corresponding knockout sgRNA: CACGATGACCTGTCGATTGCCGG (5) The upstream and downstream homology arms of mpr were amplified by PCR using the following primers: up-F-mpr: atgaaattagttccaagattcagaaaacaatggttcg up-R-mpr: gttccgataatgctcgaaggctgtaaggtttg

[0133] down-F-mpr:tgtgacaaaacctttggcacgatgtgg

[0134] down-R-mpr: ttattgatttgcccaatattgaatattgttgaatac

[0135] The corresponding knockout sgRNA: AGTTGAACGGTTGCTCTATATGG (6) The upstream and downstream homology arms of vpr were amplified by PCR using the following primers: up-F-vpr: ttgaaaaaggggatcattcgctttctgcttgtaagtttcg up-R-vpr: ccgctagaagttttggaatctcattagctg

[0136] down-F-vpr:ggtacctacattgctgattgtgaaagagcccg

[0137] down-R-vpr: ttattcaacagtgaaaggttcttcggtcaaaacctggcttgacttgcctt corresponding knockout sgRNA: TGAGATTCCAAAACTTCTAGCGG (7) The upstream and downstream homology arms of wprA were amplified by PCR using the following primers: up-F-wprA: atgaaacgcagaaaattcagctcggttgtggcggcagtgcttatttttgcactg up-R-wprA: acgcgtatggaaaaatgacttcgctttttccatcctccgc

[0138] down-F-wprA:gaaaagacaatgcgttcaaggtgaatatcgcgactcaaaaacag

[0139] down-R-wprA: ttacttttcaacaacaacttttgcttccttgc

[0140] The corresponding knockout sgRNA: GATGTACCGTTCTTTCACAGCGG (8) The upstream and downstream homology arms of bpr were amplified by PCR using the following primers: up-F-bpr: atgaggaaaaaaacgaaaaacagactcatcagctctgttttaag up-R-bpr: cttttaaagatgacacaacagcagaacgcttttgatattccg

[0141] down-F-bpr:gccggtgaatctgtgaaaatcgctttctcaagcgctgaggatttag

[0142] down-R-bpr:ttaattttctgtgttcatattaagttttccattc

[0143] Corresponding knockout sgRNA: TCTGATTAATTTAAAAGATCTGG

[0144] Among them, the system of PCR amplification of upper and lower homology arms is as follows:

[0145] 1) PCR amplification reaction system: Buffer 25μl, dNTPs 10μl, Primer F 1.5μl, Primer R 1.5μl, Template 1μl, ddH 2 0 19μl, the total system is 50μl.

[0146] 2) The PCR amplification program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 sec, annealing at 54°C for 30 sec, extension at 60°C for 1.5 min, 30 cycles; extension at 72°C for 10 min, and storage at 4°C.

[0147] The upstream and downstream homologous arms and sgRNA of each amplified extracellular protease gene were subjected to overlapping PCR to obtain PCR products, which were then connected with the PHT01cas9-p43 plasmid purchased from Addgen to construct knockout plasmids: PHT01cas9-p43-aprE; PHT01cas9-p43-nprE; PHT01cas9-p43-nprB; PHT01cas9-p43-epr; PHT01cas9-p43-mpr; PHT01cas9-p43-vpr; PHT01cas9-p43-wprA; PHT01cas9-p43-bp.

[0148] 3. Construction of modified strains of Bacillus subtilis

[0149] The knockout plasmid PHT01cas9-p43-aprE is introduced into the competent cells of Bacillus subtilis.168, and after electro-transformation or chemical transformation, it is verified to obtain the modified bacteria with aprE knockout. The modified bacteria with aprE knockout are prepared into competent cells, and then the knockout plasmid PHT01cas9-p43-nprE is introduced, and after electro-transformation or chemical transformation, it is verified to obtain the modified bacteria with aprE and nprE knockout. By analogy, a modified strain of Bacillus subtilis with aprE, nprE, nprB, epr, mpr, vpr, wprA, and bpr protease knocked out is obtained, namely Bacillus subtilis.KP8.

[0150] The above-mentioned Bacillus subtilis transformed strain was fermented, that is, the positive expression strain of the Bacillus subtilis transformant was streaked on a solid LB medium containing Kan resistance, cultured at 37°C for 12 hours, and a single colony was picked and inoculated into 4 mL of LB liquid medium, and cultured at 37°C with shaking at 200 rpm for 12 hours to obtain a seed solution. The seed solution was transferred to 100 mL of 2*SR liquid medium containing Kan resistance (the formula of 2*SR liquid medium is: 30 g / L peptone, 50 g / L yeast powder, K 2 HPO 4 6g / L), 37℃, 200rpm, and cultured for 3.5h (OD 600 The value was 0.6-1.0), and the inducer IPTG was added to the bacterial solution, and the culture was carried out at 200 rpm for 36 h to obtain the fermentation broth. Then the supernatant of the fermentation broth was taken and protein gel was run for verification. Figure 3 As shown, the extracellular secretion bands of the modified Bacillus subtilis were significantly less than those of the unmodified strain.

[0151] Example 4: Construction of mussel fusion protein expression strain

[0152] 1. Preparation of expression strains expressing mussel fusion protein by chemical transformation

[0153] First, use a sterile inoculation loop to streak Bacillus subtilis.KP8 bacterial liquid from the glycerol tube on an LB solid plate and culture it overnight at 37°C. Pick a single colony and inoculate it in 5mL GMI solution, and culture it overnight at 37°C, 200rpm to obtain a culture solution. Take 2mL of culture solution and transfer it to 18mL GMI solution. After shaking culture at 37°C, 200rpm for 3.5h, transfer 10mL of culture solution to 90mL GMII solution and culture it at 37°C, 200rpm for 1.5h. After the culture is completed, centrifuge at 8,000rpm to collect the bacteria, resuspend the bacteria with 10mL supernatant, add 5mL of sterile 50% glycerol, prepare the competent bacterial liquid of Bacillus subtilis, mix well, divide and freeze at -80°C. Then add 10 to 50μL of the mussel fusion protein expression plasmid obtained in Example 2 to the competent bacterial liquid of Bacillus subtilis prepared above. After shaking culture at 37°C and 200 rpm for 1 hour, the culture was spread on a sodium carbenicillin-resistant LB plate, and monoclonal strains were screened on the resistant plate and colony PCR and sequencing were performed to identify the positive expression strain of the corresponding mussel fusion protein.

[0154] The GMI solution formula is: 9 mL of 10× minimum salt solution, 1 mL of 50% glucose, 0.4 mL of 5% hydrolyzed casein, 1 mL of 10% yeast extract, 2.5 mL of 2 mg / mL L-tryptophan solution, and 90 mL of sterile water.

[0155] The GMII solution formula is as follows: 9.75 mL of 10× minimum salt solution, 1 mL of 50% glucose, 0.08 mL of 5% hydrolyzed casein, 0.04 mL of 10% yeast extract, and 0.5 mol / L MgCl 2 0.5mL, 0.1mol / L CaCl 2 0.5mL, 2mg / mL L-tryptophan solution 0.5mL, sterile water 90mL.

[0156] Wherein, the formula of the 10× minimum salt solution is: K 2 HPO 4 14g, KH 2 PO 4 6g, (NH4) 2 SO 42g, sodium citrate 1g, MgSO 4 7H 2 O 0.2g, added into water successively and stirred to dissolve, and finally added water to make up to 100mL.

[0157] 2. Preparation of expression strains expressing mussel fusion protein by electroporation

[0158] Pick a single colony of Bacillus subtilis.KP8 from a plate and inoculate it in 5mL LB medium for overnight culture. Then transfer it to 50mL GM medium and culture it at 37℃, 200rpm for 48h. Take all the bacterial liquid and put it in an ice water bath for 10min, then centrifuge at 5000rpm, 10min, 4℃ to collect the bacteria. Then wash the bacteria with 40mL pre-cooled electrotransfer buffer ETM, centrifuge at 5000rpm, 10min, 4℃ to remove the supernatant, and rinse 3 times. Resuspend the washed bacteria in 500μL ETM, and dispense 1mL into each tube to prepare Bacillus subtilis.KP8 competent cells. Take 100-500 μL of Bacillus subtilis.KP8 competent cells, add 10-50 μL of mussel fusion protein expression plasmid, incubate in an ice bath for 5 minutes, add to a pre-cooled electroporation cup (1 mm), electroshock once at 1.0-3.0 kV for 1-5 ms, add 1 mL of recovery medium RM immediately after the electroshock, 37° C., 200 rpm, after recovery for 3 hours, apply to LB plate resistant to carbenicillin sodium, 37° C., culture overnight, screen monoclonal strains through the resistance plate, perform colony PCR and sequencing, and identify the positive expression strain of the corresponding mussel fusion protein.

[0159] The GM medium formula is: LB + 0.5M sorbitol; the ETM formula is: 0.5M sorbitol, 0.5M mannitol, 10% glycerol; the recovery medium RM formula is: LB + 0.5M sorbitol + 0.38M mannitol. The LB formula is: tryptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L.

[0160] Pgrac-SP amyQ -SPY-RBS-Mfp-1 (or Mfp-1561, Mfp-35, Mfp-3⊕5)-His-Tag-TR1 expression plasmid was further purified by three-zone lines of positive expression strains transformed by the above two transformation methods, such as Figure 4 As shown, the first row of plates were transformed by chemical transformation, and the second row of plates were transformed by electroporation. The results showed that both chemical transformation and electroporation showed good transformation efficiency.

[0161] Example 5: Fermentation, separation and purification of Bacillus subtilis positive expression strains

[0162] The positive expression strain of Bacillus subtilis containing Mfp-151 mussel fusion protein was streaked on solid LB medium containing Kan resistance, cultured at 37°C for 12 hours, and a single colony was picked and inoculated into 4 mL LB liquid medium, and cultured at 37°C with shaking at 200 rpm for 12 hours to obtain seed liquid. The seed liquid was transferred to 100 mL 2*SR liquid medium containing Kan resistance (the formula of 2*SR liquid medium is: peptone 30 g / L, yeast powder 50 g / L, K 2 HPO 4 6g / L) and cultured at 37°C, 200rpm for 3.5h (at which time OD 600 The value is 0.6~1.0), and the inducer IPTG is added to the bacterial solution, and the fermentation liquid is obtained by culturing at 200rpm for 36h. The supernatant of the fermentation liquid after induction is taken and purified by AKTA system. The loading liquid, washing liquid and elution liquid are collected, mixed with an appropriate amount of SDS-PAGE protein loading buffer and boiled in water bath for 10min. After centrifugation, 20μL of the supernatant is taken and SDS-PAGE detection is performed using 15% protein gel. Figure 5 As shown, the Mfp-151 mussel fusion protein has an obvious thick bright band in the eluate after separation and purification. Example 6: Construction of Bacillus subtilis expression strain using Bacillus subtilis modified strain as chassis strain to produce mussel fusion protein by fermentation

[0163] The Pgrac-SP constructed in Example 2 amyQ -SPY-RBS-Mfp-1 (or Mfp-2, Mfp-3, Mfp-4, Mfp-5, Mfp-6, Mfp-151, Mfp-1561, Mfp-35, Mfp-63) -His-Tag-TR1 expression plasmids refer to the construction method of Example 4, and use electroporation or chemical transformation to the competent cells of the modified strain of Bacillus subtilis to obtain expression strains expressing different mussel fusion proteins, and then ferment, separate and purify according to the fermentation, separation and purification process of the positive expression strain of Bacillus subtilis in Example 5, and perform SDS-PAGE gel running. Subsequently, the image measurement tool Image J was used to quantitatively count the yield of the samples run on the protein gel after purification. The results are as follows Figure 6 As shown, it can be seen that the process method and chassis strain developed by the present invention can allow the mussel fusion protein to be well expressed in the fermentation system, wherein the expression level of the mussel fusion protein Mfp-5 reaches more than 600 mg / L.

[0164] The present invention provides a method and method for expressing mussel fusion protein using Bacillus subtilis as a chassis strain. There are many methods and approaches to implement the technical solution. The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the protection scope of the present invention. All components not specified in this embodiment can be implemented by existing technologies.

Claims

1. A recombinant Bacillus subtilis expressing mussel fusion protein, characterized in that: Using Bacillus subtilis as a base strain, transforming an expression plasmid containing a promoter, a signal peptide, a solubility-promoting tag, a mussel fusion protein, a purification tag and a terminator into Bacillus subtilis to obtain the recombinant Bacillus subtilis; Wherein, the promoter contains a ribosome binding site, and the ribosome binding site is downstream of the promoter.

2. The recombinant Bacillus subtilis according to claim 1, characterized in that In the expression plasmid, the connection mode between the various elements is: promoter-signal peptide-solubilizing tag-mussel fusion protein-purification tag-terminator.

3. The recombinant Bacillus subtilis according to claim 1 or 2, characterized in that The promoter is an inducible promoter or a constitutive promoter; wherein the inducible promoter includes any one of P43, PHpaII, PlapS, and PamyQ, and the constitutive promoter includes any one of Pgrac, Pspac, and Pxyl; The terminator is a Rho-dependent terminator or a Rho-independent terminator; wherein the Rho-dependent terminator includes any one of T1, T2, T3, and T4, and the Rho-independent terminator includes any one of TR1, TR2, and TR3.

4. The recombinant Bacillus subtilis according to claim 1 or 2, characterized in that The signal peptide includes SP AmyQ , SP AmyE , SP NprE , SP PgsA , SP LipA , SP PhaA , SP BslA , SP LecA any one of; the lytic tag includes any one of GFP, SPY, SUMO, Trx, NusA, DsbA, and Poly-Arg; the purification tag includes any one of His-Tag, GST, MBP, Strep-tag II, FLAG, T7, and Protein A.

5. The recombinant Bacillus subtilis according to claim 1 or 2, characterized in that The mussel fusion protein includes any one or a combination of Mfp-1, Mfp-2, Mfp-3, Mfp-4, Mfp-5, and Mfp-6; wherein the nucleotide sequences of Mfp-1, Mfp-2, Mfp-3, Mfp-4, Mfp-5, and Mfp-6 are shown in SEQ ID NOs. 1 to 6, respectively.

6. The recombinant Bacillus subtilis according to claim 5, characterized in that When any combination of the mussel fusion proteins Mfp-1, Mfp-2, Mfp-3, Mfp-4, Mfp-5, and Mfp-6 is used, the mussel fusion proteins are directly connected to each other, or connected by a connecting peptide; The connecting peptide includes any one of (GGGGS)n, (G)n, (EAAAK)n, and (XP)n, where n represents the number of repetitions of the connecting peptide, and n=1-3.

7. The recombinant Bacillus subtilis according to claim 1, characterized in that The transformation is carried out by chemical transformation or electroporation; the Bacillus subtilis is Bacillus subtilis.168, or Bacillus subtilis.KP8 with extracellular protease knocked out, wherein the extracellular protease includes any one or a combination of aprE, nprE, nprB, epr, mpr, vpr, wprA, and bpr.

8. The method for constructing a recombinant Bacillus subtilis according to any one of claims 1 to 7, characterized in that: The steps include: (1) purifying the PCR product containing a promoter, a signal peptide, a lytic tag, a mussel fusion protein, a purification tag and a terminator obtained by overlapping PCR, and then connecting it with a linearized plasmid to obtain a mussel fusion protein expression plasmid; (2) Transforming the mussel fusion protein expression plasmid into Bacillus subtilis competent cells to obtain the recombinant Bacillus subtilis.

9. Use of the recombinant Bacillus subtilis according to any one of claims 1 to 7 in secretory expression of mussel adhesion protein.

10. A method for expressing mussel fusion protein using the recombinant Bacillus subtilis according to any one of claims 1 to 7, characterized in that: Inoculating the seed liquid of the recombinant Bacillus subtilis into a culture medium for fermentation culture, taking the supernatant by centrifugation, and obtaining the secretory expressed mussel adhesion protein by separation and purification; The culture medium has a formula of 20-50 g / L peptone, 40-60 g / L yeast powder, and 5-8 g / L K2HPO4; the fermentation conditions are 30-37° C., 100-300 rpm, and 36-72 h.

Images