Bioreactive compositions and methods of use thereof

Abstract

Provided herein are non-toxic, bioreactive, non-natural amino acids and methods of use thereof, among other things.

Description

This application is a divisional application of Chinese patent application No. 201980030860.0, with the application date of March 8, 2019 and the invention name of “Bioreactive Compositions and Methods of Use Thereof”. CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Application No. 62 / 640,450, filed on March 8, 2018, the disclosure of which is incorporated herein by reference. About federally funded research and Declaration of rights to inventions made under development

[0002] This invention was made with government support under Grant Nos. R01 GM118384 and MH114079 awarded by the National Institutes of Health. The government has certain rights in this invention. Background Art

[0003] The amino acid side chains of proteins are generally incapable of forming covalent bonds with each other, except for cysteine, which produces weak but reversible disulfide bonds. Therefore, proteins primarily use non-covalent interactions within or between proteins. A potentially bioreactive non-natural amino acid that is non-toxic to cells and capable of reacting with multiple natural amino acid residues would greatly expand the diversity of proteins suitable for covalent bonding in vivo. By expanding the diversity of proteins suitable for covalent bonding in vivo, it is possible to enhance existing protein properties or develop new functions by utilizing novel covalent bonds. In addition, the ability to form covalent bonds between proteins would allow irreversible capture of protein-protein interactions in vivo, which could be used for protein identification, drug target discovery, or biotherapeutics.

[0004] Solutions to these and other needs in the art are provided herein, among other things. Summary of the invention

[0005] In one aspect, a biomolecule conjugate is provided that includes a first biomolecule moiety conjugated to a second biomolecule moiety via a bioconjugate linker, wherein the bioconjugate linker has the formula:

[0006] In one aspect, proteins are provided having the following unnatural amino acid side chains: In some aspects, the protein further comprises a lysine, a histidine, a tyrosine, or a combination of two or more thereof near the non-natural amino acid side chain.

[0007] In one aspect, a protein of formula (I) is provided: Where R 1 and R 2 Each is independently a peptidyl moiety.

[0008] In one aspect, a protein of formula (II) is provided: Where R 1 and R 2 Each is independently a peptidyl moiety.

[0009] In one aspect, a protein of formula (III) is provided: Where R 1 and R 2 Each is independently a peptidyl moiety.

[0010] In one aspect, a protein is provided, comprising a moiety of formula (A), a moiety of formula (B), a moiety of formula (C), or a combination of two or more thereof:

[0011] In one aspect, a pyrrolysyl-tRNA synthetase is provided, which includes at least 5 amino acid residue substitutions within the substrate binding site of the mutant pyrrolysyl-tRNA synthetase of SEQ ID NO: 3.

[0012] In one aspect, a vector is provided, comprising a nucleic acid sequence encoding a mutant pyrrolysyl-tRNA synthetase as described herein.

[0013] In one aspect, a complex is provided comprising a pyrrolysyl-tRNA synthetase described herein and fluorosulfate-L-tyrosine (FSY).

[0014] In one aspect, a cell is provided, comprising fluorosulfate-L-tyrosine (FSY); a biomolecule conjugate as described herein; an FSY biomolecule as described herein; a pyrrolysyl-tRNA synthetase as described herein; a vector as described herein; or a complex as described herein. In some aspects, the cell is a bacterial cell or a mammalian cell.

[0015] These and other embodiments and aspects of the disclosure are described in further detail herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figures 1A-1E . Encoding of the FSY gene into a protein in E. coli. Figure 1A : The structure of FSY. Figure 1B: Scheme shows the nearby realized SuFEx reaction between FSY and a natural nucleophilic residue (abbreviated as Nu). Figure 1C : SDS-PAGE showing FSY incorporation into Afb(36TAG) in E. coli. Figure 1D : ESI-TOF MS spectrum of intact Afb-36FSY. Figure 1E : Tandem MS spectrum of Z-24FSY.

[0017] Figure 2A-2C . Genetic encoding of FSY into a protein in mammalian cells. Figure 2A : FACS analysis of FSY incorporation into EGFP-182TAG in HeLa cells. Figure 2B : Total EGFP fluorescence intensity measured from the same number of HeLa-EGFP-182TAG reporter cells. Error bars: sem, n=6. Figure 2C : Fluorescence images of HeLa-EGFP-182TAG reporter gene cells.

[0018] Figures 3A-3D .FSY directly cross-links proximal Lys, His, and Tyr in E. coli cells via SuFEx. Figure 3A : Structure of the Afb-Z complex showing the two proximal sites for incorporation of FSY and target residue X. Figure 3B : Upper panel: Western blot of E. coli cell lysate; Lower panel: SDS-PAGE of His-tag protein purified from E. coli. Figure 3C-3D :Tandem MS spectrum of MBP-Z-24FSY / Afb-7Lys ( Figure 3C ) and MBP-Z-24FSY / Afb-7His( Figure 3D ).

[0019] Figure 4 .Tandem MS spectrum of purified CaM-76FSY-80Tyr.

[0020] Figures 5A-5C .FSY cross-links Tyr through SuFEx molecules. ( Figure 5A ) Structure of Trx1 in complex with PAPS reductase, showing the FSY site and native Tyr191. Figure 5B )SDS-PAGE and ( Figure 5C )Tandem MS spectra.

[0022] Figure 6 Shown is FACS analysis of AzF incorporation into EGFP-182TAG HeLa reporter cells.

[0023] Figure 7 Shown are cell viability assays of HeLa-EGFP-182TAG reporter cells and 293T cells incubated with various concentrations of FSY. Error bars represent sem; n=3.

[0024] Figure 8 Shown is SDS-PAGE analysis of Trx62FSY cross-linked with PAPS reductase at pH 7.4 and 8.0.

[0025] Fig. 9 Provided is a graphic representation of FSY behavior in living cells.

[0026] Fig.10 The ligand-receptor interface is provided, showing the FSY incorporation site (Q68) on hGH and the target residue Lys166 on the hGH receptor

[0027] Fig.11 Western blot analysis of hGH(FSY) binding to the extracellular domain of the hGH receptor.

[0028] Fig.12 Western blot analysis of pSTAT5 production in BAF3 cells following stimulation with hGH(FSY) or hGH(WT) as described in Example 2. DETAILED DESCRIPTION

[0029] A potential bioreactive non-natural amino acid that is non-toxic to cells and can react with multiple natural amino acid residues will greatly expand the diversity of proteins suitable for covalent bonding in vivo. This article describes a new tRNA / aminoacyl-tRNA synthetase pair that encodes the fluorosulfate-L-tyrosine (FSY) gene into biomolecules (e.g., proteins) in living cells. It has been found that FSY, which is non-toxic to cells, can react with proximal lysine, histidine, and tyrosine in proteins both in vitro and in living cells.

[0030] The amino acid side chains of proteins are generally unable to form covalent bonds with each other, except for cysteine, which produces weak and reversible disulfide bonds. Therefore, proteins mainly use non-covalent interactions within or between proteins. In order to give proteins the ability to form covalent bonds, the inventors genetically incorporated a potential bioreactive unnatural amino acid fluorosulfate-L-tyrosine, which can selectively react with lysine, histidine or tyrosine to form covalent bonds directly within and between proteins in vivo.

[0031] Genetically encoded fluorosulfate-L-tyrosine enables proteins to have covalent bonding capabilities by targeting multiple residues. When used in proteins, this is a novel protein engineering approach that enhances the performance of existing proteins or develops new functions by utilizing novel covalent bonds. When used between proteins, it can irreversibly capture interacting proteins, which is useful for protein identification, drug target discovery, or biotherapeutics.

[0032] Existing technologies, such as protein modification or bioorthogonal chemistry, can make proteins covalently bondable in vitro. However, the technology described herein can make proteins covalently bondable in vivo. The final product can be developed in vivo (in living cells), which is beneficial for target identification with physiological relevance and large-scale production by recombinant methods.

[0033] definition

[0034] Abbreviations used herein have conventional meanings within the chemical and biological arts.Chemical structures and formulae described herein are constructed according to standard rules of chemical valency known in the chemical arts.

[0035] When substituents are described using a conventional chemical formula written from left to right, the substituents equally encompass chemically identical substituents that would result from writing the structure from right to left, for example, -CH2O- is equivalent to -OCH2-.

[0036] Unless otherwise indicated, the term "alkyl" by itself or as part of another substituent means a straight (i.e., unbranched) or branched carbon chain (or carbons), or combinations thereof, which may be fully saturated, monounsaturated, and or polyunsaturated, and may include monovalent, divalent, and polyvalent groups. An alkyl group may contain a specified number of carbons (e.g., C1-C 10Meaning one carbon to ten carbons). Alkyl is an uncyclized chain. Examples of saturated hydrocarbon groups include, but are not limited to, groups such as methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, isobutyl, sec-butyl, methyl, homologues and isomers such as n-pentyl, n-hexyl, n-heptyl, n-octyl, etc. Unsaturated alkyl groups are alkyl groups having one or more double or triple bonds. Examples of unsaturated alkyl groups include, but are not limited to, vinyl, 2-propenyl, crotyl, 2-isopentenyl, 2-(butadienyl), 2,4-pentadienyl, 3-(1,4-pentadienyl), ethynyl, 1- and 3-propynyl, 3-butynyl, and higher homologues and isomers. Alkoxy is an alkyl group connected to the rest of the molecule via an oxygen linker (-O-). The alkyl portion may be an alkenyl portion. The alkyl portion may be an alkynyl portion. The alkyl portion may be fully saturated. In addition to one or more double bonds, an alkenyl group may contain more than one double bond and / or one or more triple bonds. In addition to one or more triple bonds, an alkynyl group may contain more than one triple bond and / or one or more double bonds.

[0037] Unless otherwise stated, the term "alkylene" by itself or as part of another substituent means a divalent radical derived from an alkyl group, such as (but not limited to) -CH2CH2CH2CH2-. Typically, an alkyl (or alkylene) group will have from 1 to 24 carbon atoms, with those groups having 10 or fewer carbon atoms being preferred herein. "Lower alkyl" or "lower alkylene" is a short chain alkyl or alkylene group generally having eight or fewer carbon atoms. Unless otherwise stated, the term "alkenylene" by itself or as part of another substituent means a divalent radical derived from an alkene group.

[0038] Unless otherwise indicated, the term "heteroalkyl" alone or in combination with another term means a stable straight or branched chain comprising at least one carbon atom and at least one heteroatom (e.g., O, N, P, Si, and S, wherein the nitrogen and sulfur atoms may be optionally oxidized, and the nitrogen heteroatom may be optionally quaternized), or a combination thereof. One or more heteroatoms (e.g., N, S, Si, or P) may be placed at any interior position of the heteroalkyl group or at the position where the alkyl group is attached to the rest of the molecule. A heteroalkyl group is an uncyclized chain. Examples include, but are not limited to, -CH2-CH2-O-CH3, -CH2-CH2-NH-CH3, -CH2-CH2-N(CH3)-CH3, -CH2-S-CH2-CH3, -CH2-CH2, -S(O)-CH3, -CH2-CH2-S(O)2-CH3, -CH=CH-O-CH3, -Si(CH3)3, -CH2-CH=N-OCH3, -CH=CH-N(CH3)-CH3, -O-CH3, -O-CH2-CH3, and -CN. Up to two or three heteroatoms may be consecutive, for example, -CH2-NH-OCH3 and -CH2-O-Si(CH3)3. The heteroalkyl moiety may contain one heteroatom (e.g., O, N, S, Si, or P). The heteroalkyl moiety may contain two optionally different heteroatoms (e.g., O, N, S, Si, or P). The heteroalkyl moiety may include three optionally different heteroatoms (e.g., O, N, S, Si, or P). The heteroalkyl moiety may include four optionally different heteroatoms (e.g., O, N, S, Si, or P). The heteroalkyl moiety may include five optionally different heteroatoms (e.g., O, N, S, Si, or P). The heteroalkyl moiety may include up to 8 optionally different heteroatoms (e.g., O, N, S, Si, or P). Unless otherwise stated, alone or in combination with another term, the term "heteroalkenyl" means a heteroalkyl group comprising at least one double bond. In addition to one or more double bonds, the heteroalkenyl group may include more than one double bond and / or one or more triple bonds. Unless otherwise stated, alone or in combination with another term, the term "heteroalkynyl" means a heteroalkyl group comprising at least one triple bond. In addition to one or more double bonds, the heteroalkynyl group may optionally include more than one triple bond and / or one or more double bonds in addition to one or more triple bonds.

[0039] Similarly, unless otherwise indicated, the term "heteroalkylene" alone or as part of another substituent means a divalent group derived from a heteroalkyl group, such as, but not limited to, -CH2-CH2-S-CH2-CH2- and -CH2-S-CH2-CH2-NH-CH2-. For heteroalkylene, heteroatoms may also occupy either or both of the chain termini (e.g., alkyleneoxy, alkylenedioxy, alkyleneamino, alkylenediamino, etc.). In addition, for alkylene and heteroalkylene linking groups, the direction in which the chemical formula of the linking group is written does not imply the orientation of the linking group. For example, the formula -C(O)2R'- represents both -C(O)2R'- and -R'C(O)2-. As described above, as used herein, heteroalkyl groups include those groups that are attached to the rest of the molecule through a heteroatom, such as -C(O)R', -C(O)NR', ​​-NR'R", -OR', -SR' and / or -S02R'. When "heteroalkyl" is recited followed by a specific heteroalkyl group, such as -NR'R" or a similar group, it is understood that the terms heteroalkyl and -NR'R" are not redundant or mutually exclusive. Rather, reciting the specific heteroalkyl group is for added clarity. Therefore, the term "heteroalkyl" should not be interpreted herein to exclude specific heteroalkyl groups, such as -NR'R" or a similar group.

[0040] Unless otherwise indicated, the terms "cycloalkyl" and "heterocycloalkyl" mean, alone or in combination with other terms, cyclic forms of "alkyl" and "heteroalkyl", respectively. Cycloalkyl and heterocycloalkyl are not aromatic. In addition, for heterocycloalkyl, a heteroatom may occupy the position where the heterocycle is attached to the rest of the molecule. Examples of cycloalkyl include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, 1-cyclohexenyl, 3-cyclohexenyl, cycloheptyl, and the like. Examples of heterocycloalkyl include, but are not limited to, 1-(1,2,5,6-tetrahydropyridinyl), 1-piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-morpholinyl, 3-morpholinyl, tetrahydrofuran-2-yl, tetrahydrofuran-3-yl, tetrahydrothiophene-2-yl, tetrahydrothiophene-3-yl, 1-piperazinyl, 2-piperazinyl, and the like. By themselves or as part of another substituent, "cycloalkylene" and "heterocycloalkylene" mean a divalent radical derived from cycloalkyl and heterocycloalkyl, respectively.

[0041] In embodiments, the term "cycloalkyl" means a monocyclic, bicyclic or polycyclic cycloalkyl ring system. In one aspect, a monocyclic system is a cycloalkyl containing 3 to 8 carbon atoms, wherein such groups may be saturated or unsaturated, but not aromatic. In one aspect, a cycloalkyl is fully saturated. Examples of monocyclic cycloalkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl and cyclooctyl. A bicyclic cycloalkyl ring system is a bridged monocyclic or fused bicyclic. In one aspect, a bridged monocyclic ring contains a monocyclic cycloalkyl ring in which two non-adjacent carbon atoms of the monocyclic ring are connected by an alkylene bridge of between one and three additional carbon atoms (i.e., in the form of (CH2) w , wherein w is 1, 2 or 3). Representative examples of bicyclic systems include, but are not limited to, bicyclo[3.1.1]heptane, bicyclo[2.2.1]heptane, bicyclo[2.2.2]octane, bicyclo[3.2.2]nonane, bicyclo[3.3.1]nonane and bicyclo[4.2.1]nonane. In one aspect, the fused bicyclic cycloalkyl ring system contains a monocyclic cycloalkyl ring fused to any of a phenyl, a monocyclic cycloalkyl, a monocyclic cycloalkenyl, a monocyclic heterocyclyl or a monocyclic heteroaryl. In one aspect, the bridged or fused bicyclic cycloalkyl is connected to the parent molecular moiety via any carbon atom contained within the monocyclic cycloalkyl ring. In one aspect, the cycloalkyl is optionally substituted with one or two groups that are independently oxo or thio. In one aspect, the fused bicyclic cycloalkyl is a 5- or 6-membered monocyclic cycloalkyl ring, a 5- or 6-membered monocyclic cycloalkyl, a 5- or 6-membered monocyclic heteroalkenyl, a 5- or 6-membered monocyclic heterocyclyl, or a 5- or 6-membered monocyclic heteroaryl fused to a benzene ring, wherein the fused bicyclic cycloalkyl is optionally substituted with one or two groups that are independently oxo or thio. In one aspect, the polycyclic cycloalkyl ring system is a monocyclic cycloalkyl ring (base ring) fused to any of the following: (i) one ring system selected from the group consisting of: bicyclic aromatic, bicyclic heteroaryl, bicyclic cycloalkyl, bicyclic cycloalkenyl, and bicyclic heterocyclyl; or (ii) two other ring systems independently selected from the group consisting of: phenyl, bicyclic aromatic, monocyclic or bicyclic heteroaryl, monocyclic or bicyclic cycloalkyl, monocyclic or bicyclic cycloalkenyl, and monocyclic or bicyclic heterocyclyl. In one aspect, the polycyclic cycloalkyl is attached to the parent molecular moiety via any carbon atom contained within the base ring. In one aspect, the polycyclic cycloalkyl ring system is a monocyclic cycloalkyl ring (base ring) fused to any of the following: (i) one ring system selected from the group consisting of: bicyclic aromatic, bicyclic heteroaryl, bicyclic cycloalkyl, bicyclic cycloalkenyl, and bicyclic heterocyclyl; or (ii) two other ring systems independently selected from the group consisting of: phenyl, monocyclic heteroaryl, monocyclic cycloalkyl, monocyclic cycloalkenyl, and monocyclic heterocyclyl. Examples of polycyclic cycloalkyls include, but are not limited to, tetradecahydrophenanthrenyl, perhydrophenothiazin-1-yl, and perhydrophenoxazin-1-yl.

[0042] In an embodiment, cycloalkyl is cycloalkenyl. The term "cycloalkenyl" is used according to its common general meaning. In one aspect, cycloalkenyl is a monocyclic, bicyclic or polycyclic cycloalkenyl ring system. In one aspect, a monocyclic cycloalkenyl ring system is a cycloalkyl containing 3 to 8 carbon atoms, wherein such a group is unsaturated (i.e., contains at least one annular carbon-carbon double bond), but is not aromatic. Examples of monocyclic cycloalkenyl ring systems include cyclopentenyl and cyclohexenyl. In one aspect, a bicyclic cycloalkenyl ring is a bridged monocyclic or fused bicyclic. In one aspect, a bridged monocyclic ring contains a monocyclic cycloalkenyl ring, wherein two non-adjacent carbon atoms of the monocyclic ring are connected by an alkylene bridge of between one and three additional carbon atoms (i.e., in the form of (CH2) w , wherein w is 1, 2 or 3). Representative examples of bicyclic cycloalkenyl groups include, but are not limited to, norbornenyl and bicyclo[2.2.2]oct2enyl. In one aspect, the fused bicyclic cycloalkenyl ring system contains a monocyclic cycloalkenyl ring fused to any of a phenyl, a monocyclic cycloalkyl, a monocyclic cycloalkenyl, a monocyclic heterocyclyl or a monocyclic heteroaryl. In one aspect, the bridged or fused bicyclic cycloalkenyl is connected to the parent molecular moiety via any carbon atom contained within the monocyclic cycloalkenyl ring. In one aspect, the cycloalkenyl is optionally substituted with one or two groups that are independently oxo or thio. In one aspect, the polycyclic cycloalkenyl ring system contains a monocyclic cycloalkenyl ring (base ring) fused to any of: (i) one ring system selected from the group consisting of: bicyclic aromatic, bicyclic heteroaryl, bicyclic cycloalkyl, bicyclic cycloalkenyl, and bicyclic heterocyclyl; or (ii) two ring systems independently selected from the group consisting of: phenyl, bicyclic aromatic, monocyclic or bicyclic heteroaryl, monocyclic or bicyclic cycloalkyl, monocyclic or bicyclic cycloalkenyl, and monocyclic or bicyclic heterocyclyl. In one aspect, the polycyclic cycloalkenyl is attached to the parent molecular moiety through any carbon atom contained within the base ring. In one aspect, the polycyclic cycloalkenyl ring system contains a monocyclic cycloalkenyl ring (base ring) fused to either: (i) one ring system selected from the group consisting of bicyclic aromatic, bicyclic heteroaryl, bicyclic cycloalkyl, bicyclic cycloalkenyl, and bicyclic heterocyclyl; or (ii) two ring systems independently selected from the group consisting of phenyl, monocyclic heteroaryl, monocyclic cycloalkyl, monocyclic cycloalkenyl, and monocyclic heterocyclyl.

[0043] In an embodiment, heterocycloalkyl is a heterocyclic radical. As used herein, the term "heterocyclic radical" means monocyclic, bicyclic or polycyclic heterocycles. Heterocyclic radical monocyclic heterocycle is a 3-, 4-, 5-, 6- or 7-ring containing at least one heteroatom independently selected from the group consisting of O, N and S, wherein the ring is saturated and or unsaturated, but not aromatic. 3- or 4-rings contain 1 heteroatom selected from the group consisting of O, N and S. 5-rings can contain zero or one double bond and one, two or three heteroatoms selected from the group consisting of O, N and S. 6- or 7-rings contain zero, one or two double bonds and one, two or three heteroatoms selected from the group consisting of O, N and S. Heterocyclic radical monocyclic heterocycles are derived from any carbon atom or any nitrogen contained in the heterocyclic radical monocyclic heterocycle to be connected to the parent molecular moiety. Representative examples of heterocyclyl monocyclic heterocycles include, but are not limited to, azetidinyl, azepanyl, aziridinyl, diazepanyl, 1,3-dioxanyl, 1,3-dioxolanyl, 1,3-dithiopentyl, 1,3-dithianyl, imidazolinyl, imidazolidinyl, isothiazolinyl, isothiazolidinyl, isoxazolyl, isoxazolidinyl, morpholinyl, oxadiazolinyl, oxadiazolidinyl, oxazolinyl, oxazolidinyl, piperazinyl, piperidinyl, pyranyl, pyrazolinyl, thiazolidinyl, pyrrolinyl, pyrrolidinyl, tetrahydrofuranylmethyl, tetrahydrothiophenyl, thiadiazolinyl, thiadiazolinyl, thiazolinyl, tetrahydrothiazolyl, thiomorpholinyl, 1,1-oxothiomorpholinyl (thiomorpholine sulfone), thiopyranyl, and trithianyl. Heterocyclyl bicyclic heterocycle is a monocyclic heterocycle fused to any one of phenyl, monocyclic cycloalkyl, monocyclic cycloalkenyl, monocyclic heterocycle or monocyclic heteroaryl. Heterocyclyl bicyclic heterocycle is connected to the parent molecular moiety by any carbon atom or any nitrogen atom contained in the monocyclic heterocyclic ring part of the bicyclic ring system. Representative examples of bicyclic heterocyclyl include but are not limited to 2,3-dihydrobenzofuran-2-yl, 2,3-dihydrobenzofuran-3-yl, indol-1-yl, indol-2-yl, indol-3-yl, 2,3-dihydrobenzothiophene-2-yl, decahydroquinolyl, decahydroisoquinolyl, octahydro-1H-indolyl and octahydrobenzofuranyl. In aspect, heterocyclyl is optionally substituted with one or two groups independently being oxo or thio. In certain aspects, the bicyclic heterocyclyl is a 5- or 6-membered monocyclic heterocycle, a 5- or 6-membered monocyclic alkyl, a 5- or 6-membered monocyclic heteroalkenyl, a 5- or 6-membered monocyclic heterocyclyl, or a 5- or 6-membered monocyclic heteroaryl fused to a benzene ring, wherein the bicyclic heterocyclyl is optionally substituted with one or two groups that are independently oxo or thio.A polycyclic heterocyclyl ring system is a monocyclic heterocyclyl ring (base ring) fused to any of: (i) one ring system selected from the group consisting of: bicyclic aromatic, bicyclic heteroaryl, bicyclic cycloalkyl, bicyclic cycloalkenyl, and bicyclic heterocyclyl; or (ii) two other ring systems independently selected from the group consisting of: phenyl, bicyclic aromatic, monocyclic or bicyclic heteroaryl, monocyclic or bicyclic cycloalkyl, monocyclic or bicyclic cycloalkenyl, and monocyclic or bicyclic heterocyclyl. The polycyclic heterocyclyl is attached to the parent molecular moiety through any carbon atom or nitrogen atom contained within the base ring. In aspects, the polycyclic heterocyclyl ring system is a monocyclic heterocyclyl ring (base ring) fused to either: (i) one ring system selected from the group consisting of bicyclic aromatic, bicyclic heteroaryl, bicyclic cycloalkyl, bicyclic cycloalkenyl, and bicyclic heterocyclyl; or (ii) two other ring systems independently selected from the group consisting of phenyl, monocyclic heteroaryl, monocyclic cycloalkyl, monocyclic cycloalkenyl, and monocyclic heterocyclyl. Examples of polycyclic heterocyclyl include, but are not limited to, 10H-phenothiazin-10-yl, 9,10-dihydroacridin-9-yl, 9,10-dihydroacridin-10-yl, 10H-phenoxazin-10-yl, 10,11-dihydro-5H-dibenzo[b,f]azepin-5-yl, 1,2,3,4-tetrahydropyrido[4,3-g]isoquinolin-2-yl, 12H-benzo[b]phenoxazin-12-yl, and dodecahydro-1H-carbazol-9-yl.

[0044] Unless otherwise indicated, the term "halo" or "halogen" by itself or as part of another substituent means a fluorine, chlorine, bromine or iodine atom. In addition, terms such as "haloalkyl" are meant to include monohaloalkyl and polyhaloalkyl. For example, the term "halo (C1-C4) alkyl" includes but is not limited to fluoromethyl, difluoromethyl, trifluoromethyl, 2,2,2-trifluoroethyl, 4-chlorobutyl, 3-bromopropyl, etc.

[0045] Unless otherwise indicated, the term "acyl" means -C(O)R, wherein R is substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl.

[0046] Unless otherwise indicated, the term "aryl" means a polyunsaturated aromatic hydrocarbon substituent, which can be a single ring or multiple rings (preferably 1 to 3 rings) fused together (i.e., fused ring aryl) or covalently linked. A fused ring aryl refers to multiple rings fused together, wherein at least one of the fused rings is an aryl ring. The term "heteroaryl" refers to an aryl (or ring) containing at least one heteroatom (such as N, O or S), wherein the nitrogen atom and the sulfur atom are optionally oxidized, and one or more nitrogen atoms are optionally quaternized. Therefore, the term "heteroaryl" includes fused ring heteroaryls (i.e., multiple rings fused together, wherein at least one of the fused rings is a heteroaromatic ring). 5,6-fused ring heteroaryl refers to two rings fused together, wherein one ring has 5 members and the other ring has 6 members, and wherein at least one ring is a heteroaryl ring. Likewise, a 6,6-fused ring heteroarylene refers to two rings fused together, one ring having 6 members and the other ring having 6 members, and wherein at least one ring is a heteroaryl ring. And a 6,5-fused ring heteroarylene refers to two rings fused together, one ring having 6 members and the other ring having 5 members, and wherein at least one ring is a heteroaryl ring. A heteroaryl group can be attached to the rest of the molecule through a carbon or heteroatom. Non-limiting examples of aryl and heteroaryl groups include phenyl, naphthyl, pyrrolyl, pyrazolyl, pyridazinyl, triazinyl, pyrimidinyl, imidazolyl, pyrazinyl, purinyl, oxazolyl, isoxazolyl, thiazolyl, furanyl, thienyl, pyridyl, pyrimidinyl, benzothiazolyl, benzoxazolyl, benzimidazolyl, benzofuran, isobenzofuranyl, indolyl, isoindolyl, benzothienyl, isoquinolyl, quinoxalinyl, quinolyl, 1-naphthyl, 2-naphthyl, 4-biphenyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 3-pyrazolyl, 2-imidazolyl, 4-imidazolyl Substituents for each of the above noted aryl and heteroaryl ring systems are selected from the group of acceptable substituents described below. "Arylene" and "heteroarylene" by themselves or as part of another substituent mean a divalent radical derived from aryl and heteroaryl, respectively. A heteroaryl substituent can be -O- bonded to a nitrogen ring heteroatom.

[0047] A fused ring heterocycloalkyl-aryl is an aryl fused to a heterocycloalkyl. A fused ring heterocycloalkyl-heteroaryl is a heteroaryl fused to a heterocycloalkyl. A fused ring heterocycloalkyl-cycloalkyl is a heterocycloalkyl fused to a cycloalkyl. A fused ring heterocycloalkyl-heterocycloalkyl is a heterocycloalkyl fused to another heterocycloalkyl. A fused ring heterocycloalkyl-aryl, a fused ring heterocycloalkyl-heteroaryl, a fused ring heterocycloalkyl-cycloalkyl or a fused ring heterocycloalkyl-heterocycloalkyl can each independently be unsubstituted or substituted with one or more substituents as described herein.

[0048] Spirocycle is two or more rings, wherein adjacent rings are connected by a single atom.Single ring in spirocycle can be the same or different.Individual ring in spirocycle can be substituted or unsubstituted, and can have substituents different from other individual rings in spirocycle group.The possible substituents of individual rings in spirocycle are possible substituents of the same ring when not being a part of spirocycle (for example, substituents of cycloalkyl ring or heterocycloalkyl ring).Spirocycle can be substituted or unsubstituted cycloalkyl, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene or substituted or unsubstituted heterocycloalkylene, and individual ring in spirocycle group can be any one of the immediately preceding list, including all rings with one type (for example, all rings of substituted heterocycloalkylene, wherein each ring can be the same or different substituted heterocycloalkylene).When referring to spirocycle system, heterocyclic spirocycle means that at least one ring is a heterocycle and each ring can be a spirocycle of different rings. When referring to a spiro ring system, substituted spiro means that at least one ring is substituted and each substituent may be optionally different.

[0049] symbol or "-" indicates the point of attachment of a chemical moiety to the rest of a molecule or chemical formula.

[0050] As used herein, the term "oxo" means an oxygen double-bonded to a carbon atom.

[0051] As used herein, the term "alkylsulfonyl" refers to a moiety having the formula -S(O2)-R', wherein R' is a substituted or unsubstituted alkyl as defined above. R' may have a specified number of carbons (e.g., "C1-C4 alkylsulfonyl").

[0052] The term "alkylarylene" is an arylene moiety covalently bonded to an alkylene moiety (also referred to herein as an alkylene linker). In one aspect, the alkylarylene group has the formula:

[0053] The alkylarylene moiety can be substituted (e.g., with a substituent) on the alkylene moiety or the arylene linker (e.g., at carbon 2, 3, 4, or 6) with halogen, oxo, -N, -CF, -CCl, -CBr, -CI, -CN, -CHO, -OH, -NH, -COOH, -CONH, -NO, -SH, -SOCH, -SOH, -OSOH, -SONH, -NHNH, -ONH, -NHC(O)NHNH, substituted or unsubstituted C1-C5 alkyl or substituted or unsubstituted 2- to 5-membered heteroalkyl). In aspects, the alkylarylene is unsubstituted.

[0054] Each of the above terms (eg, "alkyl," "heteroalkyl," "cycloalkyl," "heterocycloalkyl," "aryl," and "heteroaryl") includes both substituted and unsubstituted forms of the indicated radical. Preferred substituents for each type of radical are provided below.

[0055] Substituents for alkyl and heteroalkyl (including those commonly referred to as alkylene, alkenyl, heteroalkylene, heteroalkenyl, alkynyl, cycloalkyl, heterocycloalkyl, cycloalkenyl, and heterocycloalkenyl) may be one or more of a variety of groups selected from, but not limited to, -OR', =O, =NR', =N-OR', -NR'R", -SR', halogen, -SiR'R"R"', -OC(O)R', -C(O)R', -C02R', -CONR'R", -OC(O)N R'R", -NR"C(O)R', -NR'-C(O)NR"R"', -NR"C(O)2R', -NR-C(NR'R"R"')=NR"", -NR-C(NR'R")=NR"' , -S(O)R', -S(O)2R', -S(O)2NR'R", -NRSO2R', -NR'NR"R"', -ONR'R", -NR'C(O)NR"NR"'R"", -CN, -N O2, -NR'SO2R", -NR'C(O)R", -NR'C(O)-OR", -NR'OR", the number ranges from zero to (2m'+1), where m' is the total number of carbon atoms in such a group. R, R', R", R'' and R"" each preferably independently refers to hydrogen, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl (e.g., substituted by 1-3 halogens); substituted aryl), substituted or unsubstituted heteroaryl, substituted or unsubstituted alkyl, alkoxy, or thioalkoxy or aralkyl. When the compounds described herein contain more than one R group, for example, each of the R groups is independently selected as each R', R", R"' and R"" group is independently selected when more than one of these groups is present. When R' and R" are attached to the same nitrogen atom, they can be combined with the nitrogen atom to form a 4-, 5-, 6- or 7-membered ring. For example, -NR'R" includes (but is not limited to) 1-pyrrolidinyl and 4-morpholinyl. From the discussion of the above substituents, it is known that those skilled in the art will understand that the term "alkyl" means a group containing a carbon atom bound to a group other than a hydrogen group, such as a haloalkyl (e.g., -CF3 and -CH2CF3) and an acyl (e.g., -C(O)CH3, -C(O)CF3, -C(O)CH2OCH3 and the like).

[0056] Substituents for aryl and heteroaryl groups are similar to those described for alkyl groups and are different and are selected from, for example, the following: -OR', -NR'R", -SR', -halo, -SiR'R"R"', -OC(O)R', -C(O)R', -C02R', -CONR'R", -OC(O)NR'R", -NR"C(O)R', -NR'-C(O)NR"R"', -NR"C(O)2R', -NR-C(NR'R"R"')=NR"", -NR-C(NR'R")=NR"', -S(O)R', -S(O)2R', -S(O)2NR'R", -NRSO2R', -NR'NR"R"', -ONR'R", -NR'C(O)NR"NR"'R"', -CN, -NO2, -R' , -N3, -CH(Ph)2, fluoro(C1-C4)alkoxy, and fluoro(C1-C4)alkyl, -NR'SO2R", -NR'C(O)R", -NR'C(O)-OR", -NR'OR", in a number ranging from zero to the total number of open valences on the aromatic ring system; and wherein R', R", R"' and R"" are preferably independently selected from hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl. When the compounds described herein contain more than one R group, each of the R groups is independently selected, for example, as each R', R", R"' and R"" group is independently selected when more than one of these groups is present.

[0057] Substituents of a ring (e.g., cycloalkyl, heterocycloalkyl, aryl, heteroaryl, cycloalkylene, heterocycloalkylene, arylene, or heteroarylene) may be described as substituents on the ring rather than on a specific atom of the ring (commonly referred to as floating substituents). In this case, the substituent may be attached to any of the ring atoms (following the rules of chemical valence), and in the case of a fused or spiro ring, a substituent described as being bound to one member of the fused or spiro ring (floating substituent on a single ring) may be a substituent on any of the fused or spiro rings (floating substituents on multiple rings). When a substituent is attached to a ring rather than a specific atom (floating substituent) and the subscript of the substituent is an integer greater than one, multiple substituents may be on the same atom, the same ring, different atoms, different fused rings, different spiro rings, and each substituent may be optionally different. When the point of attachment of the ring to the rest of the molecule is not limited to a single atom (floating substituent), the point of attachment may be any atom of the ring, and in the case of a fused or spiro ring, may be any atom of any of the fused or spiro rings, while following the rules of chemical valence. When a ring, fused ring, or spiro ring contains one or more ring heteroatoms, and the ring, fused ring, or spiro ring is shown to have one more floating substituent (including but not limited to, a point of attachment to the rest of the molecule), the floating substituent may be bonded to the heteroatom. When a ring heteroatom is shown bonded to one or more hydrogens in a structure or formula with a floating substituent (e.g., two bonds to a ring atom and a third bond to a ring nitrogen that is bonded to a hydrogen), when the heteroatom is bonded to the floating substituent, the substituent will be understood to replace the hydrogen while respecting chemical valence rules.

[0058] Two or more substituents may optionally be joined to form aryl, heteroaryl, cycloalkyl or heterocycloalkyl. It is common but not necessarily found that this type of so-called ring-forming substituent is connected to the cyclic base structure. In one embodiment, the ring-forming substituent is connected to the adjacent members of the base structure. For example, two ring-forming substituents connected to the adjacent members of the cyclic base structure produce a condensed ring structure. In another embodiment, the ring-forming substituent is connected to a single member of the base structure. For example, two ring-forming substituents connected to a single member of the cyclic base structure produce a spirocyclic structure. In another embodiment, the ring-forming substituent is connected to a non-adjacent member of the base structure.

[0059] Two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally form a group of the formula -TC(O)-(CRR') q -U-, wherein T and U are independently -NR-, -O-, -CRR'- or a single bond, and q is an integer from 0 to 3. Alternatively, two of the substituents on adjacent atoms of the aryl or heteroaryl ring may be optionally replaced by the formula -A-(CH2) r-B-, wherein A and B are independently -CRR'-, -O-, -NR-, -S-, -S(O)-, -S(O)2-, -S(O)2NR'-, or a single bond, and r is an integer from 1 to 4. One of the single bonds of the new ring thus formed may optionally be replaced with a double bond. Alternatively, two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally be replaced with a double bond of the formula -(CRR')s-X'-(C"R"R"') d -substituted with a substituent, wherein s and d are independently integers from 0 to 3, and X' is -O-, -NR'-, -S-, -S(O)-, -S(O)2- or -S(O)2NR'-. The substituents R, R', R" and R"' are preferably independently selected from hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl and substituted or unsubstituted heteroaryl.

[0060] As used herein, the term "heteroatom" or "ring heteroatom" is meant to include oxygen (O), nitrogen (N), sulfur (S), phosphorus (P) and silicon (Si).

[0061] As used herein, a "substituent" refers to a group selected from the following moieties: (A) oxo, halogen, -CCl3, -CBr3, -CF3, -CI3, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr 3, -OCI3, -OCHCl2, -OCHBr2, -OCHI2, -OCHF2, unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl), unsubstituted heteroalkyl (e.g., 2-8 membered heteroalkyl, 2-6 membered heteroalkyl, or 2-4 membered heteroalkyl), unsubstituted cycloalkyl (e.g., C3-C8 cycloalkyl, C3-C6 cycloalkyl, or C5-C6 cycloalkyl), unsubstituted heterocycloalkyl (e.g., 3-8 membered heterocycloalkyl, 3-6 membered heterocycloalkyl, or 5-6 membered heterocycloalkyl), unsubstituted aryl (e.g., C6-C 10 Aryl, C 10(i) oxo, halogen, -CCl3, -CBr3, -CF3, -CI3, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3, -OCHCl2, -OCHBr2, -OCHI2, -OCHF2, unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl), unsubstituted heteroalkyl (e.g., 2- to 8-membered heteroalkyl, 2- to 6-membered heteroalkyl, or 2- to 4-membered heteroalkyl), unsubstituted cycloalkyl (e.g., C3-C8 cycloalkyl, C3-C6 cycloalkyl, or C5-C6 cycloalkyl), unsubstituted heterocycloalkyl (e.g., 3- to 8-membered heterocycloalkyl, 3- to 6-membered heterocycloalkyl, or 5- to 6-membered heterocycloalkyl), unsubstituted aryl (e.g., C6-C 10 Aryl, C 10 The invention further comprises the following: (i) alkyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, which are substituted with at least one substituent selected from the group consisting of: (a) oxo, halogen, -CCl3, -CBr3, -CF3, -CI3, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, - NHC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3, -OCHCl2, -OCHBr2, -OCHI2, -OCHF2, unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl), unsubstituted heteroalkyl (e.g., 2- to 8-membered heteroalkyl, 2- to 6-membered heteroalkyl, or 2- to 4-membered heteroalkyl), unsubstituted cycloalkyl (e.g., C3-C8 cycloalkyl, C3-C6 cycloalkyl, or C5-C6 cycloalkyl), unsubstituted heterocycloalkyl (e.g., 3- to 8-membered heterocycloalkyl, 3- to 6-membered heterocycloalkyl, or 5- to 6-membered heterocycloalkyl), unsubstituted aryl (e.g., C6-C 10 Aryl, C 10(a) alkyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, which is substituted with at least one substituent selected from the group consisting of oxo, halogen, -CCl3, -CBr3, -CF3, -CI3, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, -NHNH2, -ONH2, -NHC(O)NHNH2, -NHC(O)NH2, -NHSO2H, -NHC(O)H, -NH HC(O)OH, -NHOH, -OCCl3, -OCF3, -OCBr3, -OCI3, -OCHCl2, -OCHBr2, -OCHI2, -OCHF2, unsubstituted alkyl (e.g., C1-C8 alkyl, C1-C6 alkyl, or C1-C4 alkyl), unsubstituted heteroalkyl (e.g., 2- to 8-membered heteroalkyl, 2- to 6-membered heteroalkyl, or 2- to 4-membered heteroalkyl), unsubstituted cycloalkyl (e.g., C3-C8 cycloalkyl, C3-C6 cycloalkyl, or C5-C6 cycloalkyl), unsubstituted heterocycloalkyl (e.g., 3- to 8-membered heterocycloalkyl, 3- to 6-membered heterocycloalkyl, or 5- to 6-membered heterocycloalkyl), unsubstituted aryl (e.g., C6-C 10 Aryl, C 10 aryl or phenyl) or unsubstituted heteroaryl (e.g., 5- to 10-membered heteroaryl, 5- to 9-membered heteroaryl, or 5- to 6-membered heteroaryl).

[0062] As used herein, "size-limited substituent" or "size-limited substituent group" means a group selected from all substituents described above for "substituent", wherein each substituted or unsubstituted alkyl is a substituted or unsubstituted C1-C 20 alkyl, each substituted or unsubstituted heteroalkyl is a substituted or unsubstituted 2 to 20-membered heteroalkyl, each substituted or unsubstituted cycloalkyl is a substituted or unsubstituted C3-C8 cycloalkyl, each substituted or unsubstituted heterocycloalkyl is a substituted or unsubstituted 3 to 8-membered heterocycloalkyl, each substituted or unsubstituted aryl is a substituted or unsubstituted C6-C 10 The invention also relates to aryl groups, and each substituted or unsubstituted heteroaryl group is a substituted or unsubstituted 5- to 10-membered heteroaryl group.

[0063] As used herein, "lower substituent" or "lower substituent group" means a group selected from all substituents described above for "substituent", wherein each substituted or unsubstituted alkyl is a substituted or unsubstituted C1-C8 alkyl, each substituted or unsubstituted heteroalkyl is a substituted or unsubstituted 2 to 8 membered heteroalkyl, each substituted or unsubstituted cycloalkyl is a substituted or unsubstituted C3-C7 cycloalkyl, each substituted or unsubstituted heterocycloalkyl is a substituted or unsubstituted 3 to 7 membered heterocycloalkyl, each substituted or unsubstituted aryl is a substituted or unsubstituted C6-C8 alkyl, 10 The invention also relates to aryl groups, and each substituted or unsubstituted heteroaryl group is a substituted or unsubstituted 5- to 9-membered heteroaryl group.

[0064] In embodiments, each substituted group described in the compounds herein is substituted with at least one substituent. More specifically, in aspects, each substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, substituted heteroaryl, substituted alkylene, substituted heteroalkylene, substituted cycloalkylene, substituted heterocycloalkylene, substituted arylene and / or substituted heteroarylene described in the compounds herein is substituted with at least one substituent. In aspects, at least one or all of these groups are substituted with at least one size-restricted substituent. In aspects, at least one or all of these groups are substituted with at least one low substituent.

[0065] In embodiments of the compounds herein, each substituted or unsubstituted alkyl is a substituted or unsubstituted C1-C 20 alkyl, each substituted or unsubstituted heteroalkyl is a substituted or unsubstituted 2- to 20-membered heteroalkyl, each substituted or unsubstituted cycloalkyl is a substituted or unsubstituted C3-C8 cycloalkyl, each substituted or unsubstituted heteroalkyl is a substituted or unsubstituted 3- to 8-membered heteroalkyl, each substituted or unsubstituted aryl is a substituted or unsubstituted C6-C 10 In the aspect of the compound herein, each substituted or unsubstituted alkylene is a substituted or unsubstituted C1-C 20 alkylene, each substituted or unsubstituted heteroalkylene is a substituted or unsubstituted 2 to 20-membered heteroalkylene, each substituted or unsubstituted cycloalkylene is a substituted or unsubstituted C3-C8 cycloalkylene, each substituted or unsubstituted heterocycloalkylene is a substituted or unsubstituted 3 to 8-membered heterocycloalkylene, each substituted or unsubstituted arylene is a substituted or unsubstituted C6-C8 10The arylene group, and / or each substituted or unsubstituted heteroarylene group is a substituted or unsubstituted 5- to 10-membered heteroarylene group.

[0066] In an embodiment, each substituted or unsubstituted alkyl is a substituted or unsubstituted C1-C8 alkyl, each substituted or unsubstituted heteroalkyl is a substituted or unsubstituted 2- to 8-membered heteroalkyl, each substituted or unsubstituted cycloalkyl is a substituted or unsubstituted C3-C7 cycloalkyl, each substituted or unsubstituted heterocycloalkyl is a substituted or unsubstituted 3- to 7-membered heterocycloalkyl, each substituted or unsubstituted aryl is a substituted or unsubstituted C6-C 10 In some aspects, each substituted or unsubstituted alkylene group is a substituted or unsubstituted C1-C8 alkylene group, each substituted or unsubstituted heteroalkylene group is a substituted or unsubstituted 2- to 8-membered heteroalkylene group, each substituted or unsubstituted cycloalkylene group is a substituted or unsubstituted C3-C7 cycloalkylene group, each substituted or unsubstituted heteroalkylene group is a substituted or unsubstituted 3- to 7-membered heteroalkylene group, and each substituted or unsubstituted arylene group is a substituted or unsubstituted C6-C8 alkylene group. 10 Arylene, and / or each substituted or unsubstituted heteroarylene is a substituted or unsubstituted 5- to 9-membered heteroarylene. In one aspect, the compound is a chemical species described in the Examples section, Figures, or Tables below.

[0067] In embodiments, a substituted or unsubstituted moiety (e.g., substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene and / or substituted or unsubstituted heteroarylene) is unsubstituted (e.g., unsubstituted alkyl, unsubstituted heteroalkyl, unsubstituted cycloalkyl, unsubstituted heterocycloalkyl, unsubstituted aryl, unsubstituted heteroaryl, unsubstituted alkylene, unsubstituted heteroalkylene, unsubstituted cycloalkylene, unsubstituted heterocycloalkylene, unsubstituted arylene and / or unsubstituted heteroarylene, respectively). In aspects, the substituted or unsubstituted moiety (e.g., substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene and / or substituted or unsubstituted heteroarylene) is substituted (e.g., substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, substituted heteroaryl, substituted alkylene, substituted heteroalkylene, substituted cycloalkylene, substituted heterocycloalkylene, substituted arylene and / or substituted heteroarylene, respectively).

[0068] In an embodiment, a substituted moiety (e.g., substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, substituted heteroaryl, substituted alkylene, substituted heteroalkylene, substituted cycloalkylene, substituted heterocycloalkylene, substituted arylene, and / or substituted heteroarylene) is substituted with at least one substituent, wherein if the substituted moiety is substituted with multiple substituents, each substituent may optionally be different. In an aspect, if the substituted moiety is substituted with multiple substituents, each substituent is different.

[0069] In embodiments, a substituted moiety (e.g., substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, substituted heteroaryl, substituted alkylene, substituted heteroalkylene, substituted cycloalkylene, substituted heterocycloalkylene, substituted arylene, and / or substituted heteroarylene) is substituted with at least one substituent of limited size, wherein if the substituted moiety is substituted with multiple substituents of limited size, each substituent of limited size can optionally be different. In aspects, if the substituted moiety is substituted with multiple substituents of limited size, each substituent of limited size is different.

[0070] In an embodiment, a substituted moiety (e.g., substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, substituted heteroaryl, substituted alkylene, substituted heteroalkylene, substituted cycloalkylene, substituted heterocycloalkylene, substituted arylene, and / or substituted heteroarylene) is substituted with at least one lower substituent, wherein if the substituted moiety is substituted with multiple lower substituents, each lower substituent may optionally be different. In an aspect, if the substituted moiety is substituted with multiple lower substituents, each lower substituent is different.

[0071] In an embodiment, a substituted moiety (e.g., substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, substituted heteroaryl, substituted alkylene, substituted heteroalkylene, substituted cycloalkylene, substituted heterocycloalkylene, substituted arylene, and / or substituted heteroarylene) is substituted with at least one substituent, size-limited substituent, or lower substituent; wherein if the substituted moiety is substituted with a plurality of groups selected from substituents, size-limited substituents, and lower substituents, each substituent, size-limited substituent, and lower substituent may optionally be different. In an aspect, if the substituted moiety is substituted with a plurality of groups selected from substituents, size-limited substituents, and lower substituents, each substituent, size-limited substituent, and lower substituent is different.

[0072] Certain compounds of the present disclosure possess asymmetric carbon atoms (optical or chiral centers) or double bonds; enantiomers, racemates, diastereomers, tautomers, geometric isomers, stereoisomeric forms, and individual isomers defined in terms of absolute stereochemistry as (R)- or (S)- or (D)- or (L) for amino acids are encompassed within the scope of the present disclosure. Compounds of the present disclosure do not include those compounds known in the art to be too unstable to synthesize and / or separate. The present disclosure is intended to include compounds in racemic and optically pure form. Optically active (R)- and (S)- or (D)- and (L)-isomers can be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques. When the compounds described herein contain olefinic bonds or other centers of geometric asymmetry, and unless otherwise specified, it is intended that the compounds include both E and Z geometric isomers.

[0073] As used herein, the term "isomer" refers to compounds that have the same number and kind of atoms, and therefore the same molecular weight, but have different structural arrangements or configurations of the atoms.

[0074] As used herein, the term "tautomer" refers to one of two or more structural isomers that exist in equilibrium and are readily converted from one isomeric form to another.

[0075] It will be apparent to those skilled in the art that certain compounds of the present disclosure may exist in tautomeric forms and all such tautomeric forms of the compounds are within the scope of the present disclosure.

[0076] Unless otherwise specified, structures depicted herein are also intended to include all stereochemical forms of the structure; that is, the R and S configurations for each asymmetric center. Therefore, single stereochemical isomers as well as enantiomeric mixtures and diastereomeric mixtures of the present compounds are within the scope of the present disclosure.

[0077] Unless otherwise stated, structures depicted herein are also meant to include compounds that differ only in the presence of one or more isotopically enriched atoms. 13 C- or 14 Compounds of the present structures having C-enriched carbon substituted for carbon other than carbon are within the scope of the present disclosure.

[0078] The compounds of the present disclosure may also contain unnatural proportions of atomic isotopes at one or more of the atoms that make up such compounds. For example, the compounds may be treated with tritium ( 3 H), iodine-125 ( 125 I) or carbon-14 ( 14 C) radioactive isotope radiolabeling. All isotopic variations of the compounds of the present disclosure, whether radioactive or not, are encompassed within the scope of the present disclosure.

[0079] It should be noted that throughout the application, alternatives are written in Markush groups, such as in each amino acid position containing more than one possible amino acid. It is specifically contemplated that each member of a Markush group should be considered individually, thereby comprising another embodiment, and that a Markush group should not be construed as a single unit.

[0080] "Analog" or "analogue" is used according to its ordinary general meaning within chemistry and biology, and refers to a compound that is structurally similar but compositionally different from another compound (i.e., the so-called "reference" compound), for example in the replacement of one atom by an atom of a different element, or in the presence of a particular functional group, or in the replacement of one functional group by another functional group, or in the absolute stereochemistry of one or more chiral centers of the reference compound. Thus, an analog is a compound that is similar or equivalent to the reference compound in function and appearance, but not similar or equivalent in structure or origin.

[0081] As used herein, the term "a" or "an" means one or more. In addition, as used herein, the phrase "substituted with [n]..." means that the specified group may be substituted with one or more of any or all of the named substituents. For example, when a group such as an alkyl or heteroaryl group is "substituted with an unsubstituted C1-C 20 alkyl or unsubstituted 2- to 20-membered heteroalkyl”, the group may contain one or more unsubstituted C1-C 20 alkyl, and / or one or more unsubstituted 2- to 20-membered heteroalkyl groups.

[0082] In addition, when a moiety is substituted with an R substituent, the group may be referred to as "R-substituted". When a moiety is R-substituted, the moiety is substituted with at least one R substituent, and each R substituent is optionally different. When a particular R group is present in the description of a chemical species (such as Formula (I)), a Roman letter symbol may be used to distinguish each occurrence of the particular R group. For example, when multiple R 13 When a substituent is present, each R 13 The substituent may be R 13A , R 13B , R 13C , R 13D Equal distinction, among which R 13A , R 13B , R 13C , R 13D Each of the definitions in R 13 defined range, and optionally different.

[0083] A "detectable agent" or "detectable moiety" is a composition detectable by appropriate means, such as spectroscopic, photochemical, biochemical, immunochemical, chemical, magnetic resonance imaging, or other physical means. For example, useful detectable agents include 18 F. 32 P. 33 P. 45 Ti, 47 Sc, 52 Fe, 59 Fe, 62 Cu, 64 Cu, 67 Cu, 67 Ga, 68 Ga, 77 As, 86 Y. 90 Y. 89 Sr. 89 Zr, 94 Tc, 94 Tc, 99m Tc, 99For 105 pd 105 Rh、 111 Ag 111 in 123 I 124 I 125 I 131 I 142 Mr. 143 Mr. 149 PM 153 Sm、 154-1581 God 161 Tb 166 Dy 166 Ho 169 Err 175 sun 177 sun 186 Re 188 Re 189 Re 194 Ir 198 I 199 I 211 And 211 Pb、 212 Hello 212 Pb、 213 Hello 223 Ra 225 Ac、Cr、V、Mn、Fe、Co、Ni、Cu、La、Ce、Pr、Nd、Pm、Sm、Eu、Gd、Tb、Dy、Ho、Er、Tm、Yb、Lu、 32P, fluorophores (e.g., fluorescent dyes), electron-dense reagents, enzymes (e.g., commonly used in ELISA), biotin, digoxigenin, paramagnetic molecules, paramagnetic nanoparticles, ultrasmall superparamagnetic iron oxide ("USPIO") nanoparticles, USPIO nanoparticle aggregates, superparamagnetic iron oxide ("SPIO") nanoparticles, SPIO nanoparticle aggregates, single crystalline iron oxide nanoparticles, single crystalline iron oxide, nanoparticle contrast agents, liposomes or other delivery vehicles containing gadolinium chelate ("Gd-chelate") molecules, gadolinium, radioisotopes, radionuclides (e.g., carbon 11, nitrogen 13, oxygen 15, fluorine 18, rubidium 82), fluorodeoxyglucose (e.g., fluorine 18 labeled), any gamma-emitting radionuclide, an emitting Positron-emitting radionuclides, radiolabeled glucose, radiolabeled water, radiolabeled ammonia, biocolloids, microbubbles (e.g., including microbubble shells comprising albumin, galactose, lipids and / or polymers; microbubble gas cores comprising air, heavy gases, perfluorocarbons, nitrogen, octafluoropropane, perflexane lipid microspheres, perflutren, etc.), iodinated contrast agents (e.g., iohexol, iodixanol, ioversol, iopamidol, ioxilan, iopromide, diatrizoate, metrizoate, iodixanol), barium sulfate, thorium dioxide, gold, gold nanoparticles, gold nanoparticle aggregates, fluorophores, two-photon fluorophores or haptens and proteins or other entities that can be detected by, for example, incorporating radiolabels into peptides or antibodies that react with target peptides. The detectable moiety is a monovalent detectable agent or a detectable agent that is capable of forming a bond with another component.

[0084] Radioactive materials (e.g., radioisotopes) that can be used as imaging agents and / or labeling agents according to embodiments of the present disclosure include, but are not limited to 18 F. 32 P. 33 P. 45 Ti, 47 Sc, 52 Fe, 59 Fe, 62 Cu, 64 Cu, 67 Cu, 67 Ga, 68 Ga, 77 As, 86 Y. 90 Y. 89 Sr. 89 Zr, 94 Tc, 94 Tc, 99m Tc, 99 Mo, 105 Pd, 105 Rh, 111 Ag,111 In, 123 I. 124 I. 125 I. 131 I. 142 Pr, 143 Pr, 149 Pm, 153 Sm, 154-1581 Gd, 161 Tb, 166 Dy, 166 Ho, 169 2. 175 Lu, 177 Lu, 186 Re, 188 Re, 189 Re, 194 Ir, 198 Au, 199 Au, 211 At 211 Pb, 212 Bi, 212 Pb, 213 Bi, 223 Ra and 225 Ac. Paramagnetic ions that can be used as additional imaging agents according to embodiments of the present disclosure include, but are not limited to, ions of transition metals and lanthanide metals (e.g., metals with atomic numbers 21-29, 42, 43, 44, or 57-71). These metals include ions of Cr, V, Mn, Fe, Co, Ni, Cu, La, Ce, Pr, Nd, Pm, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb, and Lu.

[0085] The description of the compounds of the present disclosure is limited by the principles of chemical bonding known to those skilled in the art. Thus, when a group may be substituted by one or more of a plurality of substituents, such substitutions are selected so as to conform to the principles of chemical bonding and give compounds that are not inherently unstable and / or would be known to those of ordinary skill in the art as being unstable under ambient conditions such as aqueous, neutral and several known physiological conditions. For example, heterocycloalkyl or heteroaryl groups, in accordance with the principles of chemical bonding known to those skilled in the art, are connected to the rest of the molecule via a ring heteroatom, thereby avoiding inherently unstable compounds.

[0086] One of ordinary skill in the art will understand that when a variable (e.g., a moiety or linker) of a compound or class of compounds (e.g., a class described herein) is described by the name or formula of an independent compound with all valences filled, the unfilled valences of the variable will be determined by the context in which the variable is used. For example, when a variable of a compound described herein is connected (e.g., bonded) to the rest of the compound by a single bond, the variable should be understood to represent the monovalent form of the independent compound (i.e., capable of forming a single bond due to the unfilled valences) (e.g., if in one embodiment the variable is named "methane", but it is known that the variable is connected to the rest of the compound by a single bond), one of ordinary skill in the art will understand that the variable is actually the monovalent form of methane, i.e., methyl or -CH3). Similarly, for linker variables (e.g., L as described herein), 1 , L 2 or L 3 ), one of ordinary skill in the art would understand that the variable is the divalent form of the independent compound (e.g., if the variable is designated as "PEG" or "polyethylene glycol" in one embodiment, but the variable is attached to the rest of the compound by two separate bonds, one of ordinary skill in the art would understand that the variable is the divalent (i.e., capable of forming two bonds through two unfilled valencies) form of PEG, rather than the independent compound PEG).

[0087] "Nucleic acid" refers to nucleotides (e.g., deoxyribonucleotides or ribonucleotides) and polymers thereof in single-stranded, double-stranded or multi-stranded form or their complements. The terms "polynucleotide", "oligonucleotide", "oligonucleoside" and the like refer to linear sequences of nucleotides in the usual and customary sense. The term "nucleotide" refers to a single unit of a polynucleotide, i.e., a monomer, in the usual and customary sense. A nucleotide can be a ribonucleotide, a deoxyribonucleotide or a modified form thereof. Examples of polynucleotides encompassed herein include single-stranded and double-stranded DNA, single-stranded and double-stranded RNA, and hybrid molecules having a mixture of single-stranded and double-stranded DNA and RNA. Examples of nucleic acids, such as polynucleotides encompassed herein include any type of RNA (e.g., mRNA, siRNA, miRNA, and guide RNA) and any type of DNA, genomic DNA, plastid DNA, and small ring DNA and any fragments thereof. In the case of polynucleotides, the term "duplex" refers to a double-stranded type in the usual and customary sense. Nucleic acids can be linear or branched. For example, the nucleic acid can be a linear chain of nucleotides or the nucleic acid can be branched, for example, such that the nucleic acid comprises one or more arms or branches of nucleotides. Optionally, the branched nucleic acid branches repeatedly to form higher order structures, such as dendrimers and their analogs.

[0088] Nucleic acids, including, for example, nucleic acids with a thiophosphate backbone, may include one or more reactive moieties. As used herein, the term reactive moiety includes any group that is capable of reacting with another molecule (e.g., a nucleic acid or a polypeptide) by covalent, non-covalent, or other interactions. By way of example, a nucleic acid may include an amino acid reactive moiety that reacts with an amino acid on a protein or polypeptide by covalent, non-covalent, or other interactions.

[0089] The term also includes the nucleic acid containing the backbone residue or bond of known nucleotide analogs or modifications, which is synthetic, naturally occurring and non-naturally occurring, and has a binding property similar to a reference nucleic acid, and is metabolized in a manner similar to a reference nucleotide. The example of such analogs includes, but is not limited to, phosphodiester derivatives, including, for example, phosphoramidate, diaminophosphorate, thiophosphate (also referred to as thiophosphoric acid, which has the oxygen in double bond sulfur replacement phosphoric acid), dithiophosphate, phosphonocarboxylic acid, phosphonocarboxylate, phosphonoacetic acid, phosphonoformic acid, methylphosphonate, borophosphonate, or O-methylphosphoramidite bond (see Eckstein, Oligonucleotides and Analogues: A Practical Approach, Oxford University Press), and modification of nucleotide bases, such as in 5-methylcytidine or pseudouridine; With peptide nucleic acid backbone and bond. Other similar nucleic acids include nucleic acids with cationic backbones; nonionic backbones, modified sugars and non-ribose backbones (e.g., phosphorodiamidate morpholino oligonucleotides or locked nucleic acids (LNA) known in the art), including those described in U.S. Pat. Nos. 5,235,033 and 5,034,506 and Chapters 6 and 7, ASC Symposium Series 580, Carbohydrate Modifications in Antisense Research, edited by Sanghui & Cook. Nucleic acids containing one or more carbocyclic sugars are also included in a definition of nucleic acids. Modification of the ribose-phosphate backbone can be performed for a variety of reasons, for example, to increase the stability and half-life of these molecules in a physiological environment or as probes on a biochip. A mixture of naturally occurring nucleic acids and analogs can be prepared; alternatively, a mixture of different nucleic acid analogs can be prepared, as well as a mixture of naturally occurring nucleic acids and analogs. In aspects, the internucleotide bond in DNA is a phosphodiester, a phosphodiester derivative, or a combination of the two.

[0090] Nucleic acid can comprise non-specific sequence.As used herein, term " non-specific sequence " refers to the nucleic acid sequence containing a series of residues that are not designed to be complementary to any other nucleic acid sequence or are only partially complementary to any other nucleic acid sequence, for example non-specific nucleic acid sequence is the sequence of nucleic acid residues that do not play the inhibitory nucleic acid effect when contacting with cell or organism.

[0091] As may be used herein, the terms "nucleic acid", "nucleic acid molecule", "nucleic acid oligomer", "oligonucleotide", "nucleic acid sequence", "nucleic acid fragment" and "polynucleotide" are used interchangeably and are intended to include, but are not limited to, polymeric forms of nucleotides of various lengths covalently linked together, the nucleotides being deoxyribonucleotides or ribonucleotides or analogs, derivatives or modifications thereof. Different polynucleotides may have different three-dimensional structures and may perform various known or unknown functions. Non-limiting examples of polynucleotides include genes, gene fragments, exons, introns, intergenic DNA (including but not limited to heterochromatic DNA), messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of a sequence, isolated RNA of a sequence, nucleic acid probes and primers. The polynucleotides that can be used in the methods of the present disclosure may include natural nucleic acid sequences and variants thereof, artificial nucleic acid sequences, or combinations of such sequences.

[0092] A polynucleotide is generally composed of a specific sequence of four nucleotide bases: adenine (A); cytosine (C); guanine (G); and thymine (T) (uracil (U) for thymine (T) when the polynucleotide is RNA). Thus, the term "polynucleotide sequence" is an alphabetic representation of a polynucleotide molecule; alternatively, the term can be applied to the polynucleotide molecule itself. This alphabetic representation can be entered into a database in a computer having a central processing unit and used for bioinformatics applications such as functional genomics and homology searches. A polynucleotide may optionally contain one or more non-standard nucleotides, one or more nucleotide analogs, and / or modified nucleotides.

[0093] As used herein, the term "complement" refers to a nucleotide (e.g., RNA or DNA) or a nucleotide sequence that can base pair with a complementary nucleotide or nucleotide sequence. As described herein and as known in the art, the complementary (matching) nucleotide of adenosine is thymidine, and the complementary (matching) nucleotide of guanine is cytosine. Therefore, the complement can include a nucleotide sequence that base pairs with the corresponding complementary nucleotide of the second nucleic acid sequence. The nucleotides of the complement can partially or completely match the nucleotides of the second nucleic acid sequence. When the nucleotides of the complement fully match each nucleotide of the second nucleic acid sequence, the complement forms a base pair with each nucleotide of the second nucleic acid sequence. When the nucleotides of the complement partially match the nucleotides of the second nucleic acid sequence, only some nucleotides of the complement form a base pair with the nucleotides of the second nucleic acid sequence. The example of a complementary sequence includes coding and non-coding sequences, wherein the non-coding sequence contains the complementary nucleotides of the coding sequence, thereby forming the complement of the coding sequence. Another example of a complementary sequence is a sense and antisense sequence, wherein the sense sequence contains the complementary nucleotides of the antisense sequence, thereby forming the complement of the antisense sequence.

[0094] As described herein, sequence complementarity can be partial, in which only some of the nucleic acids match based on base pairing, or complete, in which all nucleic acids match based on base pairing. Thus, two sequences that are complementary to each other can have a specified percentage of identical nucleotides (i.e., about 60% identity over a specified region, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity).

[0095] The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to naturally occurring amino acids. Naturally occurring amino acids are amino acids encoded by the genetic code, as well as those that are subsequently modified, e.g., hydroxyproline, γ-carboxyglutamate, and O-phosphoserine. Amino acid analogs refer to compounds that have the same basic chemical structure as naturally occurring amino acids, i.e., an alpha carbon bound to a hydrogen, carboxyl group, amino group, and R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methylsulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as naturally occurring amino acids. Amino acid mimetics refer to compounds that have a structure that is different from the general chemical structure of an amino acid but function in a manner similar to naturally occurring amino acids. The terms "non-naturally occurring amino acids" and "non-natural amino acids" refer to amino acid analogs, synthetic amino acids, and amino acid mimetics that are not found in nature.

[0096] Amino acids are referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.

[0097] The term "amino acid side chain" refers to a functional substituent contained on an amino acid. For example, the amino acid side chain can be a side chain of a naturally occurring amino acid. Naturally occurring amino acids are amino acids encoded by the genetic code (e.g., alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, or valine), as well as amino acids that are subsequently modified, for example, hydroxyproline, γ-carboxyglutamate, and O-phosphoserine. In aspects, the amino acid side chain can be a non-natural amino acid side chain. In aspects, the amino acid side chain is H, In an embodiment, the non-natural amino acid side chain is

[0098] The term "non-natural amino acid side chain" or "unnatural amino acid side chain" or "Uaa" refers to functional substituents of a compound having the same basic chemical structure as a naturally occurring amino acid, i.e., an alpha carbon bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methylsulfonium, allylalanine, 2-aminobutyric acid. Non-natural amino acids are naturally occurring or chemically synthesized non-proteinogenic amino acids. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid.Non-limiting examples include exo-cis-3-aminobicyclo[2.2.1]hept-5-ene-2-carboxylic acid hydrochloride, cis-2-aminocycloheptanecarboxylic acid hydrochloride, cis-6-amino-3-cyclohexene-1-carboxylic acid hydrochloride, cis-2-amino-2-methylcyclohexanecarboxylic acid hydrochloride, cis-2-amino-2-methylcyclopentanecarboxylic acid hydrochloride, 2-(Boc-aminomethyl)benzoic acid, 2-(Boc-amino)suberic acid, Boc-4,5-dehydro-Leu-OH (dicyclohexyl ammonium salt), Boc-4-(Fmoc-amino)-L-phenylalanine, Boc-β-Homopyr-OH, Boc-(2-indanyl)-Gly-OH, 4-Boc-3-morpholineacetic acid, 4- Boc-3-morpholineacetic acid, Boc-pentafluoro-D-phenylalanine, Boc-pentafluoro-L-phenylalanine, Boc-Phe(2-Br)-OH, Boc-Phe(4-Br)-OH, Boc-D-Phe(4-Br)-OH, Boc-D-Phe(3-Cl)-OH, Boc-Phe(4-NH2)-OH, Boc-Phe(3-NO2)-OH, Boc-Phe(3,5-F2)-OH, 2-(4-Boc-piperazine)-2-(3,4-dimethoxyphenyl)acetic acid purum, 2-(4-Boc-piperazine)-2-(2-fluorophenyl)acetic acid purum, 2-(4-Boc-piperazine)-2-(3-fluorophenyl)acetic acid purum, 2-(4-Boc-piperazine)-2-(4-fluorophenyl)acetic acid purum, 2-(4-Boc-piperazine)-2-(4-methoxyphenyl)acetic acid purum, 2-(4-Boc-piperazine)-2-phenylacetic acid purum, 2-(4-Boc-piperazine)-2-(3-pyridyl)acetic acid purum, 2-(4-Boc-piperazine)-2-[4-(trifluoromethyl)phenyl]acetic acid purum, Boc-β-(2-quinolyl)-Ala-OH, N-Boc-1,2,3,6-tetrahydro-2-pyridinecarboxylic acid, Boc-β-(4-thiazolyl)-Ala-OH, Boc-β-(2-thienyl)-D-Ala-O H, Fmoc-N-(4-Boc-aminobutyl)-Gly-OH, Fmoc-N-(2-Boc-aminoethyl)-Gly-OH, Fmoc-N-(2,4-dimethoxybenzyl)-Gly-OH, Fmoc-(2-indanyl)-Gly-OH, Fmoc-pentafluoro-L-phenylalanine, Fmoc-Pen(Trt)-OH, Fmoc-Phe(2-Br)-OH, Fmoc-Phe(4-Br)-OH, Fmoc-Phe(3,5-F2)-OH, Fmoc-β-(4-thiazolyl)-Ala-OH, Fmoc-β-(2-thienyl)-Ala-OH, 4-(hydroxymethyl)-D-phenylalanine.In an embodiment, the unnatural amino acid is fluorosulfate-L-tyrosine (FSY) having the formula: .

[0099] "Variants through conservative modification" are applicable to both amino acid sequences and nucleic acid sequences. With respect to specific nucleic acid sequences, "variants through conservative modification" refers to those nucleic acids encoding the same or substantially the same amino acid sequences. Because of the degeneracy of the genetic code, multiple nucleic acid sequences will encode any given protein. For example, codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Therefore, at each position where alanine is specified by a codon, the codon can be changed to any corresponding codon described without changing the encoded polypeptide. Such nucleic acid changes are "silent changes", which are a species of conservatively modified changes. Each nucleic acid sequence encoding a polypeptide herein also describes each possible silent change of the nucleic acid. The technician will recognize that each codon in the nucleic acid (except AUG, which is usually the only codon for methionine, and TGG, which is usually the only codon for tryptophan) can be modified to obtain functionally identical molecules. Therefore, each silent change of the nucleic acid encoding a polypeptide is implicit in each described sequence.

[0100] With respect to amino acid sequences, the skilled artisan will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide or protein sequence that alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence are "conservatively modified variants" where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs and alleles of the present disclosure.

[0101] The following eight groups each contain amino acids that are conservative substitutions for one another: (1) alanine (A), glycine (G); (2) aspartic acid (D), glutamic acid (E); (3) asparagine (N), glutamine (Q); (4) arginine (R), lysine (K); (5) isoleucine (I), leucine (L), methionine (M), valine (V); (6) phenylalanine (F), tyrosine (Y), tryptophan (W); (7) serine (S), threonine (T); and (8) cysteine ​​(C), methionine (M). (See, e.g., Creighton, Proteins (1984)).

[0102] The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues, wherein the polymer may, in embodiments, be conjugated to a moiety that does not consist of amino acids. The terms apply to amino acid polymers in which one or more amino acid residues is an artificial chemical mimetic of the corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymers. A "fusion protein" refers to a chimeric protein encoding two or more separate protein sequences that are recombinantly expressed as a single part.

[0103] The "position" of an amino acid or nucleotide base is represented by a number that sequentially identifies each amino acid (or nucleotide base) in the reference sequence based on its position relative to the N-terminus (or 5' end). Due to deletions, insertions, truncations, fusions, etc. that must be considered when determining the optimal alignment, the numbering of amino acid residues in the test sequence determined by counting only from the N-terminus is not necessarily the same as the numbering of their corresponding positions in the reference sequence. For example, in the case where a variant has a deletion relative to the aligned reference sequence, there will be no amino acid in the variant corresponding to the position at the deletion site in the reference sequence. In the case of an insertion in the aligned reference sequence, the insertion will not correspond to the numbered amino acid position in the reference sequence. In the case of truncations or fusions, there may be amino acid segments in the reference sequence or aligned sequence that do not correspond to any amino acid in the corresponding sequence.

[0104] The terms "numbered relative to" or "numbered corresponding to" when used in the context of numbering a given amino acid or polynucleotide sequence means that when comparing the given amino acid or polynucleotide sequence to a reference sequence, the residues of the reference sequence are numbered as specified.

[0105] The amino acid residue in the protein "corresponds" to the given residue when it occupies the same basic structural position as the given residue in the protein. For example, when the selected residue occupies the same necessary space or other structural relationship as the Ala302 in the PylRS protein, the selected residue in the selected protein corresponds to the Ala302 of the PylRS protein. In some embodiments where the selected protein and the PylRS protein are compared for maximum homology, the position compared with Ala302 in the compared selected protein is referred to as corresponding to Ala302. Instead of the primary sequence comparison, the three-dimensional structure comparison can also be used, for example, wherein the structure of the selected protein and the PylRS protein are compared for maximum correspondence, and the overall structure is relatively compared. In this case, the amino acid that occupies the same basic position as Ala302 in the structural model is considered to correspond to the Ala302 residue.

[0106] "Percentage of sequence identity" is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence or polypeptide sequence in the comparison window may include additions or deletions (i.e., gaps) as compared to a reference sequence (which does not include additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions where the same nucleic acid base or amino acid residue occurs in the two sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window and multiplying the result by 100 to obtain the percentage of sequence identity.

[0107] In the context of two or more nucleic acid or polypeptide sequences, the term "identical" or "identity" percentage refers to two or more sequences of identical or specified percentages of amino acid residues or identical nucleotides (i.e., about 60% identity over a specified region, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity when compared and aligned for maximum correspondence over a comparison window or specified region) (see, e.g., NCBI website ncbi.nlm.nih.gov / BLAST / or similar websites). Such sequences are then referred to as "substantially identical". This definition also relates to or can be applied to the complement of a test sequence. The definition also includes sequences with deletions and / or additions, and sequences with substitutions. As described below, preferred algorithms can account for gaps, etc. Preferably, identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is 50-100 amino acids or nucleotides in length.

[0108] As used herein, the term "biomolecule" refers to macromolecules, such as proteins, carbohydrates, lipids, and nucleic acids, as well as small molecules, such as primary and secondary metabolites. In one aspect, the term biomolecule refers to proteins. In one aspect, the term biomolecule refers to nucleic acids. In one aspect, the term biomolecule refers to carbohydrates.

[0109] The term "biomolecule moiety" refers to a peptidyl moiety, a carbohydrate moiety, a lipid moiety, or a nucleic acid moiety that forms a biomolecule.

[0110] As used herein, the term "peptidyl moiety" refers to a protein, protein fragment, or peptide that can form part of a biomolecule or biomolecule conjugate. In one aspect, the peptidyl moiety forms part of a biomolecule (e.g., a protein). In one aspect, the peptidyl moiety forms part of a biomolecule (e.g., a protein) conjugate. The peptidyl moiety can also be substituted with another chemical moiety (e.g., another R substituent).

[0111] As used herein, the term "carbohydrate moiety" refers to a carbohydrate, e.g., a polyhydroxy aldehyde, a ketone, an alcohol, an acid, a simple derivative thereof, and a polymer thereof having an acetal type of bond, which can form part of a biomolecule or a biomolecule conjugate. In one aspect, the carbohydrate moiety forms part of a biomolecule. In one aspect, the carbohydrate moiety forms part of a biomolecule conjugate. The carbohydrate moiety can also be substituted with another chemical moiety (e.g., another R substituent).

[0112] As used herein, the term "nucleic acid moiety" refers to a nucleic acid, such as DNA and RNA, which can form part of a biomolecule or biomolecule conjugate. In aspects, the nucleic acid moiety forms part of a biomolecule. In aspects, the nucleic acid moiety forms part of a biomolecule conjugate. The nucleic acid moiety can also be substituted with additional chemical moieties (e.g., additional R substituents).

[0113] The term "pyrrolysyl-tRNA synthetase" refers to an enzyme (including homologs, isoforms and functional fragments thereof) having pyrrolysyl-tRNA synthetase activity. Pyrrolysyl-tRNA synthetase is an aminoacyl-tRNA synthetase that catalyzes the ligation of the α-amino acid pyrrolysine to a cognate tRNA (tRNA pyl ) necessary reaction, thereby allowing the introduction of pyrrolysine during the protein production process of the amber stop codon (i.e., UAG). The term includes any recombinant or naturally occurring form of pyrrolysyl-tRNA synthetase or its variant, homolog, or isoform, which maintains pyrrolysyl-tRNA synthetase activity (e.g., at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% activity compared to wild-type pyrrolysyl-tRNA synthetase). In one aspect, the variant, homolog or isoform has at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity over the entire sequence or a portion of the sequence (e.g., 50, 100, 150 or 200 continuous amino acid portions) compared to the naturally occurring pyrrolysyl-tRNA synthetase. In one aspect, the pyrrolysyl-tRNA synthetase comprises the sequence shown in SEQ ID NO: 3. In one aspect, the pyrrolysyl-tRNA synthetase is the sequence shown in SEQ ID NO:3.

[0114] The term "mutant pyrrolysyl-tRNA synthetase" or "mutant PylRS" refers to any pyrrolysyl-tRNA synthetase having an amino acid sequence different from the wild-type amino acid sequence of Methanosarcina mazei pyrrolysyl-tRNA synthetase as shown in SEQ ID NO: 3. In one aspect, "mutant pyrrolysyl-tRNA synthetase" refers to a catalytic catalytic reaction between fluorosulfate-L-tyrosine (FSY) and tRNA pyl In one aspect, the mutant pyrrolysyl-tRNA synthetase comprises the sequence shown in SEQ ID NO: 1. In one aspect, the mutant pyrrolysyl-tRNA synthetase is the sequence shown in SEQ ID NO: 1. In one aspect, the mutant pyrrolysyl-tRNA synthetase is encoded by the sequence shown in SEQ ID NO: 2. In one aspect, the "mutant pyrrolysyl-tRNA synthetase" is referred to as "pyrrolysyl-tRNA synthetase", and based on a comparison with the wild-type SEQ ID NO: 3, a skilled person will readily recognize whether the pyrrolysyl-tRNA synthetase is mutant.

[0115] The term "tRNA Pyl "and (i.e., tRNA(superscript Pyl)(subscript CUA)) refers to a single-stranded RNA molecule containing about 50 to about 100 nucleotides, which folds through intrachain base pairing to form a unique four-leaf cloverleaf structure with a specific amino acid (e.g., pyrrolysine, FSY) and enables it to match its corresponding codon on mRNA (i.e., complementary to the anticodon of tRNA) during protein synthesis. Pyl In , the anticodon is CUA. The anticodon CUA is complementary to the amber stop codon UAG. Pyl The abbreviation "Pyl" stands for pyrrole, tRNA Pyl The "CUA" of tRNA refers to its anticodon CUA. Pyl Attached to FSY. In one aspect, tRNA Pyl Refers to a single-stranded RNA molecule comprising about 70 to about 90 nucleotides.

[0116] As used herein, the term "substrate binding site" refers to a residue located in the active site of an enzyme that forms a temporary bond or interaction with a substrate. In one aspect, the substrate binding site of a pyrrolysyl-tRNA synthetase refers to a residue located in the active site of a pyrrolysyl-tRNA synthetase that forms a temporary bond or interaction with an amino acid substrate. In one aspect, the substrate binding site of a pyrrolysyl-tRNA synthetase includes one or more of the following residues: alanine at position 302, leucine at position 305, tyrosine at position 306, leucine at position 309, isoleucine at position 322, asparagine at position 346, cysteine ​​at position 348, tyrosine at position 384, valine at position 401, and tryptophan at position 417, as shown in the amino acid sequence of SEQ ID NO: 3.

[0117] The term "plasmid", "vector" or "expression vector" refers to a nucleic acid molecule encoding a gene and / or regulatory elements necessary for gene expression. Gene expression from a plasmid can occur in cis or in trans. If a gene is expressed in cis, the gene and regulatory elements are encoded by the same plasmid. Trans expression refers to the situation where the gene and regulatory elements are encoded by separate plasmids.

[0118] The term "complex" refers to a composition comprising two or more components, wherein the components are bound together to form a functional unit. In one aspect, the complex described herein comprises a mutant pyrrolysyl-tRNA synthetase described herein and an amino acid substrate (e.g., FSY). In one aspect, the complex described herein comprises a mutant pyrrolysyl-tRNA synthetase described herein and a tRNA (e.g., tRNA Pyl In one aspect, the complex described herein includes a mutant pyrrolysyl-tRNA synthetase described herein, an amino acid substrate (eg, FSY), and a tRNA (eg, tRNA Pyl In one aspect, the complex described herein includes a mutant pyrrolysyl-tRNA synthetase described herein, an amino acid substrate (eg, FSY), a polypeptide containing FSY, and a tRNA (eg, tRNA Pyl ) of at least two components.

[0119] The terms "transfection", "transduction", "transfecting" or "transducing" are used interchangeably and are defined as the process of introducing a nucleic acid molecule or protein into a cell. Nucleic acids are introduced into cells using non-viral or viral-based methods. The nucleic acid molecule can be a gene sequence encoding a complete protein or a functional portion thereof. Non-viral transfection methods include any suitable transfection method that does not use viral DNA or viral particles as a delivery system for introducing nucleic acid molecules into cells. Exemplary non-viral transfection methods include calcium phosphate transfection, liposome transfection, nucleofection, sonoporation, transfection by heat shock, magnetofection and electroporation. In aspects, electroporation is used to introduce nucleic acid molecules into cells according to standard procedures well known in the art. For viral-based transfection methods, any useful viral vector can be used for the methods described herein. Examples of viral vectors include, but are not limited to, retroviral, adenoviral, lentiviral and adeno-associated viral vectors. In aspects, retroviral vectors are used to introduce nucleic acid molecules into cells according to standard procedures well known in the art. The terms "transfection" or "transduction" also refer to the introduction of proteins into cells from an external environment. Typically, protein transduction or transfection relies on the binding of a peptide or protein that can cross the cell membrane to the target protein. See, for example, Ford et al. (2001) Gene Therapy 8:1-4 and Prochiantz (2007) Nat. Methods 4:119-20.

[0120] When the term "isolated" is applied to a nucleic acid or protein, it is meant that the nucleic acid or protein is substantially free of other cellular components with which it is naturally associated. It may, for example, be in a homogeneous state and may be in a dry or aqueous solution. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. A protein is substantially purified to be the major species present in a preparation.

[0121] "Contacting" is used according to its ordinary general meaning and refers to the process of bringing at least two different species (e.g., chemical compounds comprising biomolecules, biomolecule parts, or cells) into close enough proximity to react, interact, or physically touch. However, it is understood that the reaction product produced can be produced directly from a reaction between the added reagents or from intermediates that can be produced in the reaction mixture from one or more of the added reagents.

[0122] The term "contacting" can include allowing two species to react, interact, or physically touch, wherein the two species can be biomolecules and / or biomolecule moieties as described herein. In aspects, contacting includes allowing two biomolecule moieties as described herein to interact, wherein the biomolecule moieties are covalently bonded to form a conjugate.

[0123] As used herein, the terms "bioconjugate reactive moiety" and "bioconjugate reactive group" refer to a moiety or group that is capable of forming a bioconjugate (e.g., a covalent linker) due to association between atoms or molecules of the bioconjugate reactive group. The association can be direct or indirect. For example, the conjugation between a first bioconjugate reactive group (e.g., -NH2, -COOH, -N-hydroxysuccinimide, or -maleimide) provided herein and a second bioconjugate reactive group (e.g., a sulfhydryl, a sulfur-containing amino acid, an amine, an amine side chain containing an amino acid, or a carboxylate) can be directly performed, for example, by a covalent bond or a linker (e.g., a first linker of a second linker), or indirectly performed, for example, by a non-covalent bond (e.g., an electrostatic interaction (e.g., an ionic bond, a hydrogen bond, a halogen bond), a van der Waals interaction (e.g., a dipole-dipole, a dipole-induced dipole, a London dispersion), a ring stacking (π effect), a hydrophobic interaction, etc.). In aspects, the bioconjugate or bioconjugate linker is formed using bioconjugate chemistry (i.e., association of two bioconjugate reactive groups), including but not limited to nucleophilic substitution (e.g., reaction of amines and alcohols with acyl halides, active esters), electrophilic substitution (e.g., enamine reaction), and addition of carbon-carbon and carbon-heteroatom multiple bonds (e.g., Michael reaction, Diels-Alder addition). These and other useful reactions are discussed in, e.g., March, Advanced Organic Chemistry, 3rd ed., John Wiley & Sons, New York, 1985; Hermanson, Bioconjugate Techniques, Academic Press, San Diego, 1996; and Feeney et al., Modification of Proteins; Progress in Chemistry Series, Vol. 1, 198, American Chemical Society, Washington, DC, 1982. In one aspect, a first bioconjugate reactive group (e.g., a maleimide moiety) is covalently linked to a second bioconjugate reactive group (e.g., a sulfhydryl group). In one aspect, a first bioconjugate reactive group (e.g., a haloacetyl moiety) is covalently linked to a second bioconjugate reactive group (e.g., a sulfhydryl group). In one aspect, a first bioconjugate reactive group (e.g., a pyridyl moiety) is covalently linked to a second bioconjugate reactive group (e.g., a sulfhydryl group). In one aspect, a first bioconjugate reactive group (e.g., an N-hydroxysuccinimide moiety) is covalently linked to a second bioconjugate reactive group (e.g., an amine).In one aspect, a first bioconjugate reactive group (e.g., a maleimide moiety) is covalently linked to a second bioconjugate reactive group (e.g., a sulfhydryl group). In one aspect, a first bioconjugate reactive group (e.g., a -sulfo-N-hydroxysuccinimide moiety) is covalently linked to a second bioconjugate reactive group (e.g., an amine).

[0124] Useful bioconjugate reactive moieties for use in the bioconjugate chemistry herein include, for example: (a) carboxyl groups and their various derivatives, including, but not limited to, N-hydroxysuccinimide esters, N-hydroxybenzotriazole esters, acyl halides, acyl imidazoles, thioesters, p-nitrophenyl esters, alkyl, alkenyl, alkynyl and aromatic esters; (b) hydroxyl groups that can be converted to esters, ethers, aldehydes, etc.; (c) haloalkyl groups in which the halide can subsequently be displaced by a nucleophilic group such as an amine, carboxylate anion, thiol anion, carbanion or alkoxyl ion, resulting in a new group covalently attached in place of the halogen atom; (d) dienophilic groups capable of participating in a Diels-Alder reaction, such as a maleimido or maleimide group; (e) aldehyde or ketone groups, allowing for subsequent derivatization by formation of a carbonyl derivative (e.g., imines, semicarbazolones or oximes) or by mechanisms such as Grignard addition or alkyllithium addition; (f) ) sulfonyl halide groups for subsequent reaction with amines, e.g. to form sulfonamides; (g) thiol groups, which can be converted to disulfides, reacted with acyl halides, or bonded to metals such as gold, or reacted with maleimides; (h) amine or sulfhydryl groups (e.g., present in cysteine) which can be, for example, acylated, alkylated, or oxidized; (i) olefins which can undergo, for example, cycloadditions, acylations, Michael additions, etc.; (j) epoxides which can react with, for example, amines and hydroxy compounds; (k) phosphoramidites and other standard functional groups useful for nucleic acid synthesis; (l) metal-silicon oxide bonding; (m) metals bound to reactive phosphorus groups (e.g., phosphines), e.g. to form phosphodiester bonds; (n) coupling of azides to alkynes using copper-catalyzed cycloaddition click chemistry; (o) biotin conjugates which can react with avidin or streptavidin to form avidin-biotin complexes or streptavidin-biotin complexes.

[0125] The bioconjugate reactive groups can be selected so that they do not participate in or interfere with the chemical stability of the conjugates described herein. Alternatively, the reactive functional groups can be protected from participating in the cross-linking reaction by the presence of a protecting group. In aspects, the bioconjugate includes a molecular entity derived from the reaction of an unsaturated bond such as maleimide with a sulfhydryl group.

[0126] The terms "fluorosulfate-L-tyrosine" and "FSY" refer to an unnatural amino acid having the following structure: FSY comprises amino acid side chains of the formula:

[0127] The term "FSY biomolecule" refers to a biomolecule comprising a FSY unnatural amino acid and / or its amino acid side chain.

[0128] The term "biomolecule conjugate" refers to any biomolecule comprising a bioconjugate linker of the formula:

[0129] The term "FSY protein" refers to a protein comprising FSY unnatural amino acids and / or amino acid side chains thereof.

[0130] The term "protein conjugate" refers to any protein comprising a bioconjugate linker of the formula:

[0131] The term "sulfur-fluorine exchange reaction" or "SuFEx" refers to a type of click chemistry as described in detail, for example, in Dong et al., Angewandte Chemie, 53(36): 9340-9448 (2014); Wang et al., J. Am. Chem. Soc., 140(15): 4995-4999 (2018); and as described in the Examples herein. The term "nearby-implemented" SuFEx refers to a sulfur-fluorine exchange reaction that occurs when the reactive species are in proximity to each other, i.e., spatially close enough for a SuFEx reaction to occur. The proximity can occur within a single biomolecule (e.g., a protein) or between two different biomolecules (e.g., proteins). A skilled person can readily determine whether the reactive species are in close enough proximity for the reaction to occur (e.g., a sulfur-fluorine exchange reaction between FSY and lysine, histidine, or tyrosine to form a bioconjugate, i.e., a moiety of formula (A), (B), (C) or a protein of formula (I), (II), or (III)).

[0132] The term "intermolecular linker" refers to a linking group between two biomolecules. For example, when a moiety of formula (A), (B) or (C) is an intermolecular linker, then R 1 The peptidyl part is the first protein, and R 2 The peptidyl moiety of is a second protein, such that the first protein and the second protein are covalently bonded via a moiety of formula (A), (B) or (C). In aspects, the first protein and the second protein can be the same protein, for example, providing an intermolecular linker between two proteins having the same amino acid sequence. In aspects, the first protein and the second protein can be different proteins, for example, providing an intermolecular linker between two different proteins such as a hormone and a receptor for the hormone.

[0133] The term "intramolecular linker" refers to a linking group within a biomolecule. For example, when the moiety of formula (A), (B) or (C) is an intramolecular linker, then R1 The peptidyl part and R 2 The peptidyl moieties of the compounds are in the same protein. Compounds with intramolecular linkers may also be referred to as intramolecularly bound biomolecule conjugates or intramolecularly bound biomolecule proteins.

[0134] Biomolecules and Biomolecule Conjugates

[0135] Provided herein are biomolecules and biomolecule conjugates formed by the interaction of potential bioreactive non-natural amino acids with naturally occurring amino acids. A potential bioreactive non-natural amino acid fluorosulfate-L-tyrosine (FSY) helps to form covalent bonds with nearby target amino acid residues (e.g., lysine, histidine, tyrosine) by undergoing click chemistry reactions (e.g., sulfur-fluorine exchange reactions (SuFEx)). For example, FSY can be inserted into or replace amino acids in naturally occurring proteins, thereby giving the protein the ability to form covalent bonds with target amino acid residues (e.g., lysine, histidine, tyrosine) located nearby on the protein itself or with proteins that naturally interact with it. At least in part due to its nontoxicity to cells, FSY can be used to promote the formation of covalent bonds between or within proteins under in vitro and in vivo conditions. In this way, the potential bioreactive non-natural amino acid FSY can be used to covalently link biomolecules (e.g., proteins, carbohydrates, nucleic acids) to form biomolecule conjugates. In some aspects, the potential bioreactive non-natural amino acid FSY can be used to covalently link biomolecule moieties (e.g., peptidyl moieties) within a single biomolecule (e.g., protein). In various aspects, the potentially bioreactive unnatural amino acid FSY can be used to covalently link biomolecule moieties (eg, peptidyl moieties) in different biomolecules (eg, covalently link two proteins).

[0136] As shown herein, FSY has shown superior chemical functionality (i.e., superior properties) as a potential bioreactive non-natural amino acid compared to previously described bioreactive non-natural amino acids. For example, FSY is stable, non-toxic, and non-reactive inside cells, but when placed near target residues, it becomes reactive under cellular conditions. Under physiological conditions, FSY can react specifically with lysine, histidine, and tyrosine with high selectivity through SuFEx reactions achieved near the inside and between proteins. There are no reports of bioreactive non-natural amino acids that are non-toxic inside cells and can react with more than two amino acid residues.

[0137] Provided herein are biomolecules comprising one or more potential bioreactive non-natural amino acids. In one aspect, the biomolecule is a protein, a nucleic acid, or a carbohydrate. In one aspect, the biomolecule is a protein. In one aspect, the potential bioreactive non-natural amino acid is fluorosulfate-L-tyrosine (FSY) having the formula: In one aspect, the biomolecule is a protein comprising a FYS unnatural amino acid. In one aspect, the biomolecule is a protein comprising a FYS amino acid side chain represented by the formula: In aspects, the protein comprises a FSY near a lysine, a histidine, a tyrosine, or a combination of two or more thereof. In aspects, the protein comprises a FSY near a lysine. In aspects, the protein comprises a FSY near a histidine. In aspects, the protein comprises a FSY near a tyrosine. In aspects, "near" means that the FSY and the lysine, histidine, or tyrosine are close enough to each other for a successful SuFEx reaction to occur. In aspects, "near" means that the FSY is within 1 to 20 amino acids of a lysine, histidine, or tyrosine. In aspects, "near" means that the FSY is within 1 to 15 amino acids of a lysine, histidine, or tyrosine. In aspects, "near" means that the FSY is within 1 to 10 amino acids of a lysine, histidine, or tyrosine. In aspects, "near" means that the FSY is within 1 to 9 amino acids of a lysine, histidine, or tyrosine. In aspects, "near" means that the FSY is within 1 to 8 amino acids of a lysine, histidine, or tyrosine. In aspects, "near" means that FSY is within 1 to 7 amino acids of lysine, histidine or tyrosine. In aspects, "near" means that FSY is within 1 to 6 amino acids of lysine, histidine or tyrosine. In aspects, "near" means that FSY is within 1 to 5 amino acids of lysine, histidine or tyrosine. In aspects, "near" means that FSY is within 1 to 4 amino acids of lysine, histidine or tyrosine. In aspects, "near" means that FSY is within 1 to 3 amino acids of lysine, histidine or tyrosine. In aspects, "near" means that FSY is within 1 to 2 amino acids of lysine, histidine or tyrosine. In aspects, "near" means that FSY is adjacent to lysine, histidine or tyrosine. In aspects, FSY and lysine, histidine or tyrosine are in the alpha chain of the protein. In aspects, FSY and lysine, histidine or tyrosine are in the beta chain of the protein. In aspects, the protein is a hormone. In aspects, the protein is a hormone receptor.

[0138] Provided herein are biomolecule conjugates comprising a first biomolecule moiety conjugated to a second biomolecule moiety via a bioconjugate linker, wherein the bioconjugate linker has the formula: In aspects, the first biomolecule moiety and the second biomolecule moiety are each independently a peptidyl moiety. In aspects, the biomolecule conjugate is a protein conjugate. In aspects, the biomolecule conjugate is a protein conjugate, wherein the bioconjugate linker is an intramolecular linker. In aspects, the protein conjugate comprises a plurality of intramolecular linkers. In aspects, the biomolecule conjugate is a protein conjugate, wherein the bioconjugate linker is an intermolecular linker. In aspects, the protein conjugate comprises a plurality of intermolecular linkers. In aspects, the protein conjugate comprises an intramolecular linker and an intermolecular linker.

[0139] In an embodiment, the biomolecule conjugate has the formula: R 1 -L 1 -AX 1 -L 2 -R 2 ; wherein A is a bioconjugate linker; R 1 is the first biomolecule part; R 2 is the second bioconjugate moiety; L 1 is a bond or the first covalent linker; L 2 is a bond of the second covalent linker; and X 1 Yes - NR 5 -, -O-, -S-, or wherein Ring A is a substituted or unsubstituted heteroarylene or a substituted or unsubstituted heterocycloalkylene, and wherein the nitrogen in A is attached to a bioconjugate linker. 5 is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl or substituted or unsubstituted heteroaryl.

[0140] In an embodiment, L 1 is a bond, -S(O)2- 、-NR 3A -, -O-, -S-, -C(O)-, -C(O)NR 3A -、-NR 3A C(O)-、-NR 3A C(O)NR 3B -, -C(O)O-, -OC(O)-, substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene. In the embodiment, L 2 is a bond, -S(O)2-, -NR 4A -, -O-, -S-, -C(O)-, -C(O)NR 4A -、-NR4A C(O)-、-NR 4A C(O)NR 4B -, -C(O)O-, -OC(O)-, substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene or substituted or unsubstituted heteroarylene. 3A , R 3B , R 4A and R 4B and R is independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl.

[0141] In an embodiment, X 1 Yes - NR 5 -, -O-, -S-, or Wherein ring A is a substituted or unsubstituted heteroarylene In this aspect, X 1 Yes – NR 5 -. In terms of 1 It is -O-. In aspect, X 1 It is -S-. In aspect, X 1 yes Wherein ring A is substituted or unsubstituted heteroarylene or substituted or unsubstituted heterocycloalkylene. In an embodiment, ring A is substituted or unsubstituted heteroaryl. In an embodiment, ring A is substituted or unsubstituted heterocycloalkylene. In an aspect, ring A is unsubstituted heteroarylene. In an aspect, ring A is unsubstituted heterocycloalkylene. In an embodiment, ring A is substituted heterocycloalkylene (e.g., 3 to 8 yuan, 3 to 6 yuan, 4 to 6 yuan, 4 to 5 yuan or 5 to 6 yuan). In an embodiment, ring A is unsubstituted heterocycloalkylene (e.g., 3 to 8 yuan, 3 to 6 yuan, 4 to 6 yuan, 4 to 5 yuan or 5 to 6 yuan). In an embodiment, ring A is substituted or unsubstituted heteroarylene (e.g., 5 to 10 yuan, 5 to 9 yuan or 5 to 6 yuan). In an embodiment, ring A is substituted heteroarylene (e.g., 5 to 10 yuan, 5 to 9 yuan or 5 to 6 yuan). In an embodiment, Ring A is unsubstituted heteroarylene (eg, 5-10 membered, 5-9 membered, or 5-6 membered).

[0142] In an embodiment, R 5is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl. 5 It's hydrogen.

[0143] In an embodiment, R 5 is hydrogen, substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted alkyl, substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted heteroalkyl, substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted cycloalkyl, substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted heterocycloalkyl, substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted aryl, or substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted heteroaryl.

[0144] In an embodiment, R 5 is hydrogen, substituted or unsubstituted (e.g. C1-C 20 、C1-C 10 , C1-C5) alkyl, substituted or unsubstituted (e.g., 2-20, 2-10, 2-5 membered) heteroalkyl, substituted or unsubstituted (e.g., C3-C8, C3-C6, C3-C5) cycloalkyl, substituted or unsubstituted (e.g., 3-8, 3-6, 3-5 membered) heterocycloalkyl, substituted or unsubstituted (e.g., C6-C 10 , C6-C8, C6-C5) aryl or substituted or unsubstituted (e.g., 5- to 10-membered, 5- to 8-membered, 5- to 6-membered) heteroaryl.

[0145] In an embodiment, R 5 is hydrogen, unsubstituted (e.g. C1-C 20 、C1-C 10 , C1-C5) alkyl, unsubstituted (e.g., 2 to 20-membered, 2 to 10-membered, 2 to 5-membered) heteroalkyl, unsubstituted (e.g., C3-C8, C3-C6, C3-C5) cycloalkyl, unsubstituted (e.g., 3 to 8-membered, 3 to 6-membered, 3 to 5-membered) heterocycloalkyl, unsubstituted (e.g., C6-C 10 , C6-C8, C6-C5) aryl or unsubstituted (e.g., 5- to 10-membered, 5- to 8-membered, 5- to 6-membered) heteroaryl.

[0146] In an embodiment, L 1 is a bond, -S(O)2-, -NR 3A -, -O-, -S-, -C(O)-, -C(O)NR3A -、-NR 3A C(O)-、-NR 3A C(O)NR 3B -, -C(O)O-, -OC(O)-, substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene.

[0147] In an embodiment, L 1 is a bond, -S(O)2- 、-NR 3A -, -O-, -S-, -C(O)-, -C(O)NR 3A -、-NR 3A C(O)-、-NR 3A C(O)NR 3B -, -C(O)O-, -OC(O)-, substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene. In one aspect, L 1 is a bond, a substituted or unsubstituted alkylene group, or a substituted or unsubstituted heteroalkylene group. 1 is a bond, unsubstituted alkylene or unsubstituted heteroalkylene. 1 is an unsubstituted alkylene group. 1 is an unsubstituted heteroalkylene. 1 is the key.

[0148] In an embodiment, L 1 Yes -O-, -S-, R 32 Substituted or unsubstituted C1-C2 alkylene (eg C1 or C2) or R 32 is a substituted or unsubstituted 2-membered heteroalkylene. 1 Is R 32 Substituted or unsubstituted alkylene (e.g., C1-C8 alkylene, C1-C6 alkylene or C1-C4 alkylene), 32 Substituted or unsubstituted heteroalkylene (e.g., 2 to 8-membered heteroalkylene, 2 to 6-membered heteroalkylene, or 2 to 4-membered heteroalkylene), 32 Substituted or unsubstituted cycloalkylene (e.g., C3-C8 cycloalkylene, C3-C6 cycloalkylene or C5-C6 cycloalkylene), 32Substituted or unsubstituted heterocycloalkylene (e.g., 3- to 8-membered heterocycloalkylene, 3- to 6-membered heterocycloalkylene, or 5- to 6-membered heterocycloalkylene), 32 Substituted or unsubstituted arylene (e.g., C6-C 10 Arylene, C 10 Arylene, or phenylene) or R 32 substituted or unsubstituted heteroarylene (eg, 5- to 10-membered heteroarylene, 5- to 9-membered heteroarylene, or 5- to 6-membered heteroarylene). 1 is independently -O-, -S-, unsubstituted C1-C2 alkylene (eg, C1 or C2), or unsubstituted 2-membered heteroalkylene. 1 is independently unsubstituted methylene. 1 is independently unsubstituted ethylene. 1 is a substituted 2-membered heteroalkylene. 1 is a substituted 3-membered heteroalkylene. 1 is a substituted 4-membered heteroalkylene. 1 is an unsubstituted 2-membered heteroalkylene. 1 is an unsubstituted 3-membered heteroalkylene. 1 is an unsubstituted 4-membered heteroalkylene group.

[0149] R 32 are independently oxo, halogen, -CX 32 3. -CHX 32 2. -CH2X 32 、-OCX 32 3. -OCH2X 32 、-OCHX 32 2. -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, NHNH2, ONH2, NHC=(O)NHNH2, NHC=(O)NH2, -NHSO2H, -NHC=(O)H, -NHC(O)-OH, -NHOH, -N3, R 33 Substituted or unsubstituted alkyl (e.g., C1-C8, C1-C6, C1-C4 or C1-C2), R 33 substituted or unsubstituted heteroalkyl (eg, 2-8, 2-6, 4-6, 2-3 or 4-5 membered), R 33 Substituted or unsubstituted cycloalkyl (e.g., C3-C8, C3-C6, C4-C6 or C5-C6), R 33 substituted or unsubstituted heterocycloalkyl (eg, 3- to 8-membered, 3- to 6-membered, 4- to 6-membered, 4- to 5-membered, or 5- to 6-membered), R33 Substituted or unsubstituted aryl (e.g., C6-C 10 or phenyl) or R 33 substituted or unsubstituted heteroaryl (eg, 5-10 membered, 5-9 membered, or 5-6 membered). 32 are independently oxo, halogen, -CX 32 3. -CHX 32 2. -CH2X 32 、-OCX 32 3. -OCH2X 32 、-OCHX 32 2, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, NHNH2, ONH2, NHC=(O)NHNH2, NHC=(O)NH2, -NHSO2H, -NHC=(O)H, -NHC(O)-OH, -NHOH, -N3, unsubstituted alkyl (e.g., C1-C8, C1-C6, C1-C4, or C1-C2), unsubstituted heteroalkyl (e.g., 2-8, 2-6, 4-6, 2-3, or 4-5 members), unsubstituted cycloalkyl (e.g., C3-C8, C3-C6, C4-C6, or C5-C6), unsubstituted heterocycloalkyl (e.g., 3-8, 3-6, 4-6, 4-5, or 5-6 members), unsubstituted aryl (e.g., C6-C 10 or phenyl) or unsubstituted heteroaryl (eg, 5 to 10-membered, 5 to 9-membered, or 5 to 6-membered). 32 are independently -F, -Cl, -Br or -I.

[0150] In an embodiment, R 32 is independently unsubstituted methyl. 32 is independently unsubstituted ethyl.

[0151] R 33 are independently oxo, halogen, -CX 33 3. -CHX 33 2. -CH2X 33 、-OCX 33 3. -OCH2X 33 、-OCHX 33 2. -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, NHNH2, ONH2, NHC=(O)NHNH2, NHC=(O)NH2, -NHSO2H, -NHC=(O)H, -NHC(O)-OH, -NHOH, -N3, R 34Substituted or unsubstituted alkyl (e.g., C1-C8, C1-C6, C1-C4 or C1-C2), R 34 substituted or unsubstituted heteroalkyl (e.g., 2-8, 2-6, 4-6, 2-3 or 4-5 members), R 34 Substituted or unsubstituted cycloalkyl (e.g., C3-C8, C3-C6, C4-C6 or C5-C6), R 34 substituted or unsubstituted heterocycloalkyl (eg, 3- to 8-membered, 3- to 6-membered, 4- to 6-membered, 4- to 5-membered, or 5- to 6-membered), R 34 Substituted or unsubstituted aryl (e.g., C6-C 10 or phenyl) or R 34 substituted or unsubstituted heteroaryl (eg, 5-10 membered, 5-9 membered, or 5-6 membered). 33 are independently oxo, halogen, -CX 33 3. -CHX 33 2. -CH2X 33 、-OCX 33 3. -OCH2X 33 、-OCHX 33 2, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, NHNH2, ONH2, NHC=(O)NHNH2, NHC=(O)NH2, -NHSO2H, -NHC=(O)H, -NHC(O)-OH, -NHOH, -N3, unsubstituted alkyl (e.g., C1-C8, C1-C6, C1-C4, or C1-C2), unsubstituted heteroalkyl (e.g., 2-8, 2-6, 4-6, 2-3, or 4-5 members), unsubstituted cycloalkyl (e.g., C3-C8, C3-C6, C4-C6, or C5-C6), unsubstituted heterocycloalkyl (e.g., 3-8, 3-6, 4-6, 4-5, or 5-6 members), unsubstituted aryl (e.g., C6-C 10 or phenyl) or unsubstituted heteroaryl (eg, 5 to 10-membered, 5 to 9-membered, or 5 to 6-membered). 33 are independently -F, -Cl, -Br or -I.

[0152] In an embodiment, R 33 is independently unsubstituted methyl. 33 is independently unsubstituted ethyl.

[0153] R 34 are independently oxo, halogen, -CX 34 3. -CHX 34 2. -CH2X 34、-OCX 34 3. -OCH2X 34 、-OCHX 34 2, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, NHNH2, ONH2, NHC=(O)NHNH2, NHC=(O)NH2, -NHSO2H, -NHC=(O)H, -NHC(O)-OH, -NHOH, -N3, unsubstituted alkyl (e.g., C1-C8, C1-C6, C1-C4, or C1-C2), unsubstituted heteroalkyl (e.g., 2-8, 2-6, 4-6, 2-3, or 4-5 members), unsubstituted cycloalkyl (e.g., C3-C8, C3-C6, C4-C6, or C5-C6), unsubstituted heterocycloalkyl (e.g., 3-8, 3-6, 4-6, 4-5, or 5-6 members), unsubstituted aryl (e.g., C6-C 10 or phenyl) or unsubstituted heteroaryl (eg, 5 to 10-membered, 5 to 9-membered, or 5 to 6-membered). 34 are independently -F, -Cl, -Br or -I.

[0154] In an embodiment, R 34 is independently unsubstituted methyl. 34 is independently unsubstituted ethyl.

[0155] In an embodiment, R 3A is hydrogen, substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene.

[0156] In an embodiment, R 3A is hydrogen, substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted alkyl, substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted heteroalkyl, substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted cycloalkyl, substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted heterocycloalkyl, substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted aryl, or substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted heteroaryl.

[0157] In an embodiment, R 3A is hydrogen, substituted or unsubstituted (e.g. C1-C 20、C1-C 10 , C1-C5) alkyl, substituted or unsubstituted (e.g., 2-20, 2-10, 2-5 membered) heteroalkyl, substituted or unsubstituted (e.g., C3-C8, C3-C6, C3-C5) cycloalkyl, substituted or unsubstituted (e.g., 3-8, 3-6, 3-5 membered) heterocycloalkyl, substituted or unsubstituted (e.g., C6-C 10 , C6-C8, C6-C5) aryl or substituted or unsubstituted (e.g., 5- to 10-membered, 5- to 8-membered, 5- to 6-membered) heteroaryl.

[0158] In an embodiment, R 3A is hydrogen, unsubstituted (e.g. C1-C 20 、C1-C 10 , C1-C5) alkyl, unsubstituted (e.g., 2 to 20-membered, 2 to 10-membered, 2 to 5-membered) heteroalkyl, unsubstituted (e.g., C3-C8, C3-C6, C3-C5) cycloalkyl, unsubstituted (e.g., 3 to 8-membered, 3 to 6-membered, 3 to 5-membered) heterocycloalkyl, unsubstituted (e.g., C6-C 10 , C6-C8, C6-C5) aryl or unsubstituted (e.g., 5- to 10-membered, 5- to 8-membered, 5- to 6-membered) heteroaryl.

[0159] In an embodiment, R 3B is hydrogen, substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene.

[0160] In an embodiment, R 3B is hydrogen, substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted alkyl, substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted heteroalkyl, substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted cycloalkyl, substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted heterocycloalkyl, substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted aryl, or substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted heteroaryl.

[0161] In an embodiment, R 3B is hydrogen, substituted or unsubstituted (e.g. C1-C 20 、C1-C 10, C1-C5) alkyl, substituted or unsubstituted (e.g., 2-20, 2-10, 2-5 membered) heteroalkyl, substituted or unsubstituted (e.g., C3-C8, C3-C6, C3-C5) cycloalkyl, substituted or unsubstituted (e.g., 3-8, 3-6, 3-5 membered) heterocycloalkyl, substituted or unsubstituted (e.g., C6-C 10 , C6-C8, C6-C5) aryl or substituted or unsubstituted (e.g., 5- to 10-membered, 5- to 8-membered, 5- to 6-membered) heteroaryl.

[0162] In an embodiment, R 3B is hydrogen, unsubstituted (e.g. C1-C 20 、C1-C 10 , C1-C5) alkyl, unsubstituted (e.g., 2 to 20-membered, 2 to 10-membered, 2 to 5-membered) heteroalkyl, unsubstituted (e.g., C3-C8, C3-C6, C3-C5) cycloalkyl, unsubstituted (e.g., 3 to 8-membered, 3 to 6-membered, 3 to 5-membered) heterocycloalkyl, unsubstituted (e.g., C6-C 10 , C6-C8, C6-C5) aryl or unsubstituted (e.g., 5- to 10-membered, 5- to 8-membered, 5- to 6-membered) heteroaryl.

[0163] In an embodiment, L 2 yes bond, -S(O)2-, -NR 4A -, -O-, -S-, -C(O)-, -C(O)NR 4A -、-NR 4A C(O)-、-NR 4A C(O)NR 4B -, -C(O)O-, -OC(O)-, substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene.

[0164] In an embodiment, L 2 is a bond, a substituted or unsubstituted alkylene group, or a substituted or unsubstituted heteroalkylene group. 2 is a bond, unsubstituted alkylene or unsubstituted heteroalkylene. 2 is an unsubstituted alkylene group. 2 is an unsubstituted heteroalkylene. 2 is the key.

[0165] In an embodiment, L 2 Yes -O-, -S-, R 35Substituted or unsubstituted C1-C2 alkylene (eg C1 or C2) or R 35 is a substituted or unsubstituted 2-membered heteroalkylene. 2 Is R 35 Substituted or unsubstituted alkylene (e.g., C1-C8 alkylene, C1-C6 alkylene or C1-C4 alkylene), 35 Substituted or unsubstituted heteroalkylene (e.g., 2 to 8-membered heteroalkylene, 2 to 6-membered heteroalkylene, or 2 to 4-membered heteroalkylene), 35 Substituted or unsubstituted cycloalkylene (e.g., C3-C8 cycloalkylene, C3-C6 cycloalkylene or C5-C6 cycloalkylene), 35 Substituted or unsubstituted heterocycloalkylene (e.g., 3- to 8-membered heterocycloalkylene, 3- to 6-membered heterocycloalkylene, or 5- to 6-membered heterocycloalkylene), 35 Substituted or unsubstituted arylene (e.g., C6-C 10 Arylene, C 10 Arylene, or phenylene) or R 35 substituted or unsubstituted heteroarylene (eg, 5 to 10-membered heteroarylene, 5 to 9-membered heteroarylene, or 5 to 6-membered heteroarylene). 2 is -O-, -S-, unsubstituted C1-C2 alkylene (eg, C1 or C2), or unsubstituted 2-membered heteroalkylene. 2 is an unsubstituted methylene group. 2 is unsubstituted ethylene. 2 is a substituted 2-membered heteroalkylene. 2 is a substituted 3-membered heteroalkylene. 2 is a substituted 4-membered heteroalkylene. 2 is an unsubstituted 2-membered heteroalkylene. 2 is an unsubstituted 3-membered heteroalkylene. 2 is an unsubstituted 4-membered heteroalkylene group.

[0166] R 35 are independently oxo, halogen, -CX 35 3. -CHX 35 2. -CH2X 35 、-OCX 35 3. -OCH2X 35 、-OCHX 352. -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, NHNH2, ONH2, NHC=(O)NHNH2, NHC=(O)NH2, -NHSO2H, -NHC=(O)H, -NHC(O)-OH, -NHOH, -N3, R 36 Substituted or unsubstituted alkyl (e.g., C1-C8, C1-C6, C1-C4 or C1-C2), R 36 substituted or unsubstituted heteroalkyl (eg, 2-8, 2-6, 4-6, 2-3 or 4-5 membered), R 36 Substituted or unsubstituted cycloalkyl (e.g., C3-C8, C3-C6, C4-C6 or C5-C6), R 36 substituted or unsubstituted heterocycloalkyl (eg, 3- to 8-membered, 3- to 6-membered, 4- to 6-membered, 4- to 5-membered, or 5- to 6-membered), R 36 Substituted or unsubstituted aryl (e.g., C6-C 10 or phenyl) or R 36 substituted or unsubstituted heteroaryl (eg, 5-10 membered, 5-9 membered, or 5-6 membered). 35 are independently oxo, halogen, -CX 35 3. -CHX 35 2. -CH2X 35 、-OCX 35 3. -OCH2X 35 、-OCHX 35 2, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, NHNH2, ONH2, NHC=(O)NHNH2, NHC=(O)NH2, -NHSO2H, -NHC=(O)H, -NHC(O)-OH, -NHOH, -N3, unsubstituted alkyl (e.g., C1-C8, C1-C6, C1-C4, or C1-C2), unsubstituted heteroalkyl (e.g., 2-8, 2-6, 4-6, 2-3, or 4-5 members), unsubstituted cycloalkyl (e.g., C3-C8, C3-C6, C4-C6, or C5-C6), unsubstituted heterocycloalkyl (e.g., 3-8, 3-6, 4-6, 4-5, or 5-6 members), unsubstituted aryl (e.g., C6-C 10 or phenyl) or unsubstituted heteroaryl (eg, 5 to 10-membered, 5 to 9-membered, or 5 to 6-membered). 35 are independently -F, -Cl, -Br or -I.

[0167] In an embodiment, R 35is independently unsubstituted methyl. 35 is independently unsubstituted ethyl.

[0168] R 36 are independently oxo, halogen, -CX 36 3. -CHX 36 2. -CH2X 36 、-OCX 36 3. -OCH2X 36 、-OCHX 36 2. -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, NHNH2, ONH2, NHC=(O)NHNH2, NHC=(O)NH2, -NHSO2H, -NHC=(O)H, -NHC(O)-OH, -NHOH, -N3, R 37 Substituted or unsubstituted alkyl (e.g., C1-C8, C1-C6, C1-C4 or C1-C2), R 37 substituted or unsubstituted heteroalkyl (e.g., 2-8, 2-6, 4-6, 2-3 or 4-5 members), R 37 Substituted or unsubstituted cycloalkyl (e.g., C3-C8, C3-C6, C4-C6 or C5-C6), R 37 substituted or unsubstituted heterocycloalkyl (eg, 3- to 8-membered, 3- to 6-membered, 4- to 6-membered, 4- to 5-membered, or 5- to 6-membered), R 37 Substituted or unsubstituted aryl (e.g., C6-C 10 or phenyl) or R 37 substituted or unsubstituted heteroaryl (eg, 5-10 membered, 5-9 membered, or 5-6 membered). 36 are independently oxo, halogen, -CX 36 3. -CHX 36 2. -CH2X 36 、-OCX 36 3. -OCH2X 36 、-OCHX 362, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, NHNH2, ONH2, NHC=(O)NHNH2, NHC=(O)NH2, -NHSO2H, -NHC=(O)H, -NHC(O)-OH, -NHOH, -N3, unsubstituted alkyl (e.g., C1-C8, C1-C6, C1-C4, or C1-C2), unsubstituted heteroalkyl (e.g., 2-8, 2-6, 4-6, 2-3, or 4-5 members), unsubstituted cycloalkyl (e.g., C3-C8, C3-C6, C4-C6, or C5-C6), unsubstituted heterocycloalkyl (e.g., 3-8, 3-6, 4-6, 4-5, or 5-6 members), unsubstituted aryl (e.g., C6-C 10 or phenyl) or unsubstituted heteroaryl (eg, 5 to 10-membered, 5 to 9-membered, or 5 to 6-membered). 36 are independently -F, -Cl, -Br or -I.

[0169] In an embodiment, R 36 is independently unsubstituted methyl. 36 is independently unsubstituted ethyl.

[0170] R 37 are independently oxo, halogen, -CX 37 3. -CHX 37 2. -CH2X 37 、-OCX 37 3. -OCH2X 37 、-OCHX 37 2, -CN, -OH, -NH2, -COOH, -CONH2, -NO2, -SH, -SO3H, -SO4H, -SO2NH2, NHNH2, ONH2, NHC=(O)NHNH2, NHC=(O)NH2, -NHSO2H, -NHC=(O)H, -NHC(O)-OH, -NHOH, -N3, unsubstituted alkyl (e.g., C1-C8, C1-C6, C1-C4, or C1-C2), unsubstituted heteroalkyl (e.g., 2-8, 2-6, 4-6, 2-3, or 4-5 members), unsubstituted cycloalkyl (e.g., C3-C8, C3-C6, C4-C6, or C5-C6), unsubstituted heterocycloalkyl (e.g., 3-8, 3-6, 4-6, 4-5, or 5-6 members), unsubstituted aryl (e.g., C6-C 10 or phenyl) or unsubstituted heteroaryl (eg, 5 to 10-membered, 5 to 9-membered, or 5 to 6-membered). 37 are independently -F, -Cl, -Br or -I.

[0171] In an embodiment, R 37 is independently unsubstituted methyl. 37 is independently unsubstituted ethyl.

[0172] In an embodiment, R 4A is hydrogen, substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene.

[0173] In an embodiment, R 4A is hydrogen, substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted alkyl, substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted heteroalkyl, substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted cycloalkyl, substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted heterocycloalkyl, substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted aryl, or substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted heteroaryl.

[0174] In an embodiment, R 4A is hydrogen, substituted or unsubstituted (e.g. C1-C 20 、C1-C 10 , C1-C5) alkyl, substituted or unsubstituted (e.g., 2-20, 2-10, 2-5 membered) heteroalkyl, substituted or unsubstituted (e.g., C3-C8, C3-C6, C3-C5) cycloalkyl, substituted or unsubstituted (e.g., 3-8, 3-6, 3-5 membered) heterocycloalkyl, substituted or unsubstituted (e.g., C6-C 10 , C6-C8, C6-C5) aryl or substituted or unsubstituted (e.g., 5- to 10-membered, 5- to 8-membered, 5- to 6-membered) heteroaryl.

[0175] In an embodiment, R 4A is hydrogen, unsubstituted (e.g. C1-C 20 、C1-C 10 , C1-C5) alkyl, unsubstituted (e.g., 2 to 20-membered, 2 to 10-membered, 2 to 5-membered) heteroalkyl, unsubstituted (e.g., C3-C8, C3-C6, C3-C5) cycloalkyl, unsubstituted (e.g., 3 to 8-membered, 3 to 6-membered, 3 to 5-membered) heterocycloalkyl, unsubstituted (e.g., C6-C 10, C6-C8, C6-C5) aryl or unsubstituted (e.g., 5- to 10-membered, 5- to 8-membered, 5- to 6-membered) heteroaryl.

[0176] In an embodiment, R 4B is hydrogen, substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene.

[0177] In an embodiment, R 4B is hydrogen, substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted alkyl, substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted heteroalkyl, substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted cycloalkyl, substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted heterocycloalkyl, substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted aryl, or substituted (e.g., substituted with a substituent, a size-restricted substituent, or a lower substituent) or unsubstituted heteroaryl.

[0178] In an embodiment, R 4B is hydrogen, substituted or unsubstituted (e.g. C1-C 20 、C1-C 10 , C1-C5) alkyl, substituted or unsubstituted (e.g., 2-20, 2-10, 2-5 membered) heteroalkyl, substituted or unsubstituted (e.g., C3-C8, C3-C6, C3-C5) cycloalkyl, substituted or unsubstituted (e.g., 3-8, 3-6, 3-5 membered) heterocycloalkyl, substituted or unsubstituted (e.g., C6-C 10 , C6-C8, C6-C5) aryl or substituted or unsubstituted (e.g., 5- to 10-membered, 5- to 8-membered, 5- to 6-membered) heteroaryl.

[0179] In an embodiment, R 4B is hydrogen, unsubstituted (e.g. C1-C 20 、C1-C 10 , C1-C5) alkyl, unsubstituted (e.g., 2 to 20-membered, 2 to 10-membered, 2 to 5-membered) heteroalkyl, unsubstituted (e.g., C3-C8, C3-C6, C3-C5) cycloalkyl, unsubstituted (e.g., 3 to 8-membered, 3 to 6-membered, 3 to 5-membered) heterocycloalkyl, unsubstituted (e.g., C6-C 10 , C6-C8, C6-C5) aryl or unsubstituted (e.g., 5- to 10-membered, 5- to 8-membered, 5- to 6-membered) heteroaryl.

[0180] In an embodiment, X 1 is imidazolyl, -NH- or -O-. In the aspect, X 1 is an imidazolylidene group (ie, a divalent imidazole). 1 is -NH-. In aspect, X 1 Yes -O-.

[0181] In embodiments, the first biomolecule moiety is a peptidyl moiety. In aspects, the second biomolecule moiety is a peptidyl moiety. In aspects, the first biomolecule moiety is a peptidyl moiety and the second biomolecule moiety is a peptidyl moiety. In aspects, the peptidyl moieties in the first biomolecule moiety and the second biomolecule moiety are in the same protein. In aspects, the peptidyl moieties in the first biomolecule moiety and the second biomolecule moiety are in different proteins.

[0182] In the implementation scheme, –L 1 -R 1 is a peptidyl moiety. In an embodiment, –L 2 -R 2 is a peptidyl moiety. In the aspect, –L 1 -R 1 and –L 2 -R 2 The peptidyl moiety of the same protein. In the aspect, –L 1 -R 1 and –L 2 -R 2 The peptidyl part of different proteins.

[0183] In embodiments, the first biomolecule moiety is a nucleic acid moiety or a carbohydrate moiety. In embodiments, the first biomolecule moiety is a nucleic acid moiety. In embodiments, the first biomolecule moiety is a carbohydrate moiety. In embodiments, the second biomolecule moiety is a nucleic acid moiety or a carbohydrate moiety. In embodiments, the second biomolecule moiety is a nucleic acid moiety. In embodiments, the second biomolecule moiety is a carbohydrate moiety.

[0184] In the implementation scheme, –L 1 -R 1 is a nucleic acid moiety or a carbohydrate moiety. In one aspect, –L 1 -R 1 is a nucleic acid moiety. In one aspect, –L 1 -R 1 is the carbohydrate part. In aspect, –L 2 -R 2 is a nucleic acid moiety or a carbohydrate moiety. In one aspect, –L 2 -R 2 is a nucleic acid moiety. In one aspect, –L2 -R 2 It's the carbohydrate part.

[0185] In embodiments, the first biomolecule moiety is selected from a peptidyl moiety, a nucleic acid moiety, and a carbohydrate moiety. In aspects, the second biomolecule moiety is selected from a peptidyl moiety, a nucleic acid moiety, and a carbohydrate moiety. In aspects, the first biomolecule moiety is the same as the second biomolecule moiety. In aspects, the first biomolecule moiety is different from the second biomolecule moiety. In aspects, the first biomolecule moiety and the second biomolecule moiety are in the same biomolecule. In aspects, the first biomolecule moiety and the second biomolecule moiety are in different biomolecules. In aspects, the first biomolecule moiety and the second biomolecule moiety are each independently a peptidyl moiety.

[0186] In the implementation scheme, –L 1 -R 1 is selected from a peptidyl moiety, a nucleic acid moiety and a carbohydrate moiety. In one aspect, -L 2 -R 2 is selected from a peptidyl moiety, a nucleic acid moiety and a carbohydrate moiety. In one aspect, -L 1 -R 1 Yes with –L 2 -R 2 Same. In aspect, –L 1 -R 1 Yes with –L 2 -R 2 Different. In terms of -L 1 -R 1 and -L 2 -R 2 Each is independently a peptidyl moiety.

[0187] In aspects, the disclosure provides a protein comprising a moiety of formula (A), a moiety of formula (B), a moiety of formula (C), or a combination of two or more thereof: In aspects, the protein comprises a portion of formula (A). In aspects, the protein comprises a portion of formula (B). In aspects, the protein comprises a portion of formula (C). In aspects, the protein comprises a portion of formula (A) and a portion of formula (B). In aspects, the protein comprises a portion of formula (A) and a portion of formula (C). In aspects, the protein comprises a portion of formula (B) and a portion of formula (C). In aspects ZH, the protein comprises a portion of formula (A), a portion of formula (B), and a portion of formula (C). In aspects, the portions of formula (A), (B), (C), or a combination thereof form an intramolecular covalent bond. In aspects, the portion of formula (A) forms an intramolecular covalent bond. In aspects, the portion of formula (B) forms an intramolecular covalent bond. In aspects, the portion of formula (C) forms an intramolecular covalent bond. In aspects, the portions of formula (A) and (B) form an intramolecular covalent bond. In aspects, the portions of formula (A) and (C) form an intramolecular covalent bond. In aspects, the moieties of formula (B) and (C) form intramolecular covalent bonds. In aspects, the moieties of formula (A), (B), and (C) form intramolecular covalent bonds. In aspects, the moieties of formula (A), (B), (C), or a combination thereof, form intermolecular covalent bonds. In aspects, the moieties of formula (A) form intermolecular covalent bonds. In aspects, the moieties of formula (B) form intermolecular covalent bonds. In aspects, the moieties of formula (C) form intermolecular covalent bonds. In aspects, the moieties of formula (A) and (B) form intermolecular covalent bonds. In aspects, the moieties of formula (A) and (C) form intermolecular covalent bonds. In aspects, the moieties of formula (B) and (C) form intermolecular covalent bonds. In aspects, the moieties of formula (A), (B), and (C) form intermolecular covalent bonds.

[0188] In aspects, the disclosure provides proteins of Formula (I), Formula (II), or Formula (III): Where R 1 and R 2 Each independently is a peptidyl moiety linked together, i.e., the proteins of formula (I), (II) and (III) contain intramolecular covalent bonds. In one aspect, the protein is of formula (I). In one aspect, the protein is of formula (II). In one aspect, the protein is of formula (III). In one aspect, R 1 The peptidyl part and R 2 The peptidyl portion of comprises a protein α chain. 1 The peptidyl part and R 2 The peptidyl portion of comprises a protein beta chain. 1 The peptidyl portion of the protein contains the α chain and R 2 The peptidyl portion of comprises a protein beta chain. 1 The peptidyl portion contains protein β chains and R 2The peptidyl portion contains the protein α chain.

[0189] In aspects, the disclosure provides proteins of Formula (I), Formula (II), or Formula (III): Where R 1 is the peptidyl portion of the first protein, R 2 It is the peptidyl portion of the second protein, i.e., there is an intermolecular covalent bond between the two proteins. In one aspect, the intermolecular bond is between two different proteins. In one aspect, the intermolecular bond is between two identical proteins (e.g., two proteins with the same amino acid sequence are intermolecularly bonded). In one aspect, the first protein is covalently bonded to the second protein via a portion of formula (A) to form an intermolecularly bonded protein of formula (I). In one aspect, the first protein is covalently bonded to the second protein via a portion of formula (B) to form an intermolecularly bonded protein of formula (II). In one aspect, the first protein is covalently bonded to the second protein via a portion of formula (C) to form an intermolecularly bonded protein of formula (III). In one aspect, the first protein is covalently bonded to the second protein via a portion of formula (A) and a portion of formula (A). In one aspect, the first protein is covalently bonded to the second protein via a portion of formula (A) and a portion of formula (C). In one aspect, the first protein is covalently bonded to the second protein via a portion of formula (B) and a portion of formula (C). In one aspect, the first protein is covalently bonded to the second protein via a moiety of formula (A), a moiety of formula (B), and a moiety of formula (C). In one aspect, the first protein is a hormone and the second protein is a receptor for the hormone. In one aspect, the peptidyl moiety R 1 and R 2 In one aspect, the peptidyl moiety R 1 and R 2 In one aspect, the peptidyl moiety R 1 Contains protein α chain and peptidyl part R 2 In one aspect, the peptidyl moiety R 1 Contains protein β-chain and peptidyl part R 2 Contains protein alpha chain.

[0190] In aspects, the protein conjugate may comprise three or more different and / or separate proteins. For example, a first protein is covalently bonded to a second protein via a portion of formula (A), a portion of formula (B), a portion of formula (C), or a combination of two or more thereof; and the second protein is covalently bonded to a third protein via a portion of formula (A), a portion of formula (B), a portion of formula (C), or a combination of two or more thereof. As another example, a first protein is covalently bonded to a second protein via a portion of formula (A), a portion of formula (B), a portion of formula (C), or a combination of two or more thereof; and the first protein is also covalently bonded to a third protein via a portion of formula (A), a portion of formula (B), a portion of formula (C), or a combination of two or more thereof. In each of these aspects, the first protein, the second protein, and the third protein may each optionally further comprise a portion of formula (A), a portion of formula (B), a portion of formula (C), or a combination of two or more thereof, wherein R 1 and R 2 The peptidyl portion of forms an intramolecular bond within the first protein, the second protein or the third protein, respectively.

[0191] Pyrrolysyl-tRNA synthetase

[0192] As described herein, non-natural amino acids (e.g., FSY) can be inserted into or replaced naturally occurring amino acids in biomolecules (e.g., proteins). In order to insert or replace non-natural amino acids in biomolecules (e.g., proteins), it must be able to be incorporated during protein production. Therefore, non-natural amino acids must be present on transfer RNA molecules (tRNA) so that they can be used for translation. The loading of amino acids is carried out by aminoacyl-tRNA synthetase, which is an enzyme that helps to attach suitable amino acids to tRNA molecules. However, the attachment of non-natural amino acids to tRNA may not necessarily be completed by naturally occurring aminoacyl-tRNA synthetase. Engineered aminoacyl-tRNA synthetase (e.g., mutant pyrrolysyl-tRNA synthetase (PyIRS)) may help to connect non-natural amino acids to tRNA. A PyIRS mutant library is generated. Compared with the previously described PyIRS mutant library, the PyIRS mutant library generated herein is constructed using a new small intelligent mutagenesis method, which allows simultaneous mutation of more amino acid residues (e.g., 10 amino acid residues). Of the total 2.76 x 10 7 Among the clones, one PyIRS mutant (out of 6 clones) was identified that was able to ligate FSY (see, e.g., Example 1).

[0193] The present disclosure provides mutant pyrrolysyl-tRNA synthetases, including at least 5 amino acid residue substitutions within the substrate binding site of the mutant pyrrolysyl-tRNA synthetases. In one aspect, the mutant pyrrolysyl-tRNA synthetases comprise at least 5 amino acid residue substitutions in the amino acid sequence of SEQ ID NO: 3. In one aspect, the substrate binding site comprises residues alanine at position 302, leucine at position 305, tyrosine at position 306, leucine at position 309, isoleucine at position 322, asparagine at position 346, cysteine ​​at position 348, tyrosine at position 384, valine at position 401, and tryptophan at position 417, as shown in the amino acid sequence of SEQ ID NO: 3. In one aspect, the at least 5 amino acid residue substitutions are substitutions of alanine at position 302, substitutions of asparagine at position 346, substitutions of cysteine ​​at position 348, substitutions of tyrosine at position 384, and substitutions of tryptophan at position 417, as shown in the amino acid sequence of SEQ ID NO: 3. In one aspect, the at least 5 amino acid residue substitutions are alanine at position 302 to isoleucine, asparagine at position 346 to threonine, cysteine ​​at position 348 to isoleucine, tyrosine at position 384 to leucine, and tryptophan at position 417 to lysine, as shown in the amino acid sequence of SEQ ID NO:3.

[0194] In an embodiment, the mutant pyrrolysyl-tRNA synthetase has an amino acid sequence of SEQ ID NO: 1. In an aspect, the mutant pyrrolysyl-tRNA synthetase comprises an amino acid sequence of SEQ ID NO: 1. In an aspect, the mutant pyrrolysyl-tRNA synthetase has an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 1. In an aspect, the mutant pyrrolysyl-tRNA synthetase has an amino acid sequence that is at least 80% identical to SEQ ID NO: 1. In an aspect, the mutant pyrrolysyl-tRNA synthetase has an amino acid sequence that is at least 85% identical to SEQ ID NO: 1. In an aspect, the mutant pyrrolysyl-tRNA synthetase has an amino acid sequence that is at least 90% identical to SEQ ID NO: 1. In aspects, the mutant pyrrolysyl-tRNA synthetase has an amino acid sequence that is at least 95% identical to SEQ ID NO: 1. In aspects, the mutant pyrrolysyl-tRNA synthetase has an amino acid sequence that is at least 98% identical to SEQ ID NO:1.

[0195] In an embodiment, the mutant pyrrolysyl-tRNA synthetase is encoded by the nucleic acid sequence of SEQ ID NO: 2. In an aspect, the mutant pyrrolysyl-tRNA synthetase is encoded by a nucleic acid sequence comprising the sequence of SEQ ID NO: 2. In an aspect, the mutant pyrrolysyl-tRNA synthetase is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO: 2. In an aspect, the mutant pyrrolysyl-tRNA synthetase has an amino acid sequence having at least 80% identity with SEQ ID NO: 2. In an aspect, the mutant pyrrolysyl-tRNA synthetase has an amino acid sequence having at least 85% identity with SEQ ID NO: 2. In an aspect, the mutant pyrrolysyl-tRNA synthetase has an amino acid sequence having at least 90% identity with SEQ ID NO: 2. In aspects, the mutant pyrrolysyl-tRNA synthetase has an amino acid sequence that is at least 95% identical to SEQ ID NO: 2. In aspects, the mutant pyrrolysyl-tRNA synthetase has an amino acid sequence that is at least 98% identical to SEQ ID NO:2.

[0196] Carrier

[0197] It is contemplated that the components provided herein (e.g., mutant pyrrolysyl-tRNA synthetases, tRNA Pyl Delivery to a cell. Thus, in one aspect, a vector is provided comprising a nucleic acid sequence encoding a mutant pyrrolysyl-tRNA synthetase as described herein, including embodiments thereof. In one aspect, the vector comprises a nucleic acid sequence encoding a mutant pyrrolysyl-tRNA synthetase, the synthetase comprising at least 5 amino acid residue substitutions within the substrate binding site of the mutant pyrrolysyl-tRNA synthetase. In one aspect, the vector further comprises a tRNA encoding Pyl In one aspect, the vector comprises a nucleic acid sequence encoding a mutant pyrrolysyl-tRNA synthetase comprising at least 5 amino acid residue substitutions in the amino acid sequence of SEQ ID NO: 3. In one aspect, the vector further comprises a nucleic acid sequence encoding a tRNA PylIn one aspect, the vector comprises a nucleic acid sequence encoding a mutant pyrrolysyl-tRNA synthetase comprising the following amino acid substitutions: alanine at position 302, leucine at position 305, tyrosine at position 306, leucine at position 309, isoleucine at position 322, asparagine at position 346, cysteine ​​at position 348, tyrosine at position 384, valine at position 401, and tryptophan at position 417, as shown in the amino acid sequence of SEQ ID NO: 3. In one aspect, the vector further comprises a nucleic acid sequence encoding a tRNA Pyl In one aspect, the vector comprises a nucleic acid sequence encoding a mutant pyrrolysyl-tRNA synthetase comprising the following amino acid substitutions: alanine at position 302, asparagine at position 346, cysteine ​​at position 348, tyrosine at position 384, and tryptophan at position 417, as shown in the amino acid sequence of SEQ ID NO: 3. In one aspect, the vector further comprises a nucleic acid sequence encoding a tRNA Pyl In one aspect, the vector comprises a nucleic acid sequence encoding a mutant pyrrolosyl-tRNA synthetase comprising an amino acid substitution of the following residues: alanine at position 302 isoleucine, asparagine at position 346 is threonine, cysteine ​​at position 348 isoleucine, tyrosine at position 384 is leucine, and tryptophan at position 417 is lysine, as shown in the amino acid sequence of SEQ ID NO: 3. In one aspect, the vector further comprises a nucleic acid sequence encoding a tRNA Pyl of the nucleic acid sequence.

[0198] In one embodiment, the tRNA encoding Pyl The nucleic acid sequence is the sequence shown in SEQ ID NO: 4. In one aspect, the tRNA encoding Pyl The nucleic acid sequence comprises the sequence shown in SEQ ID NO: 4. In one aspect, the tRNA encoding Pyl The nucleic acid sequence has an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 4. In one aspect, the tRNA encoding Pyl The nucleic acid sequence has an amino acid sequence that is at least 80% identical to SEQ ID NO: 4. In one aspect, the tRNA encoding Pyl The nucleic acid sequence has an amino acid sequence that is at least 85% identical to SEQ ID NO: 4. In one aspect, the tRNA encoding Pyl The nucleic acid sequence has an amino acid sequence that is at least 90% identical to SEQ ID NO: 4. In one aspect, the tRNA encoding PylThe nucleic acid sequence has an amino acid sequence that is at least 95% identical to SEQ ID NO: 4. In one aspect, the tRNA encoding Pyl The nucleic acid sequence has an amino acid sequence that is at least 98% identical to SEQ ID NO:4.

[0199] As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid connected thereto. One type of vector is a "plasmid", which refers to a linear or circular double-stranded DNA loop, in which other DNA segments can be connected. Another type of vector is a viral vector, in which other DNA segments can be connected to the viral genome. Some vectors can replicate autonomously in the host cell into which they are introduced (e.g., bacterial vectors and additional mammalian vectors with bacterial replication origins). Other vectors (e.g., non-additional mammalian vectors) are integrated into the genome of the host cell after being introduced into the host cell, thereby replicating together with the host genome. In addition, some vectors can guide the expression of genes operably connected thereto. Such vectors are referred to herein as "expression vectors". Generally, expression vectors useful in recombinant DNA technology are usually in the form of plasmids. The terms "plasmid" and "vector" can be used interchangeably because plasmids are the most commonly used vector forms. However, the disclosure is intended to include such other forms of expression vectors with equivalent functions, such as viral vectors (e.g., replication-defective retroviruses, adenoviruses, and adeno-associated viruses). In addition, some viral vectors can specifically or non-specifically target specific cell types. Exemplary vectors that can be used include, but are not limited to, pEvol vectors, pMP vectors, pET vectors, pTak vectors, pBad vectors (see, e.g., Example 1).

[0200] Compound

[0201] In one aspect, a complex is provided, comprising a mutant pyrrolysyl-tRNA synthetase described herein, including embodiments thereof; and fluorosulfate-L-tyrosine (FSY) having the formula:

[0202] In one aspect, the complex comprises a mutant pyrrolysyl-tRNA synthetase comprising at least 5 amino acid residue substitutions within the substrate binding site of the pyrrolysyl-tRNA synthetase of SEQ ID NO: 3. In one aspect, the mutant pyrrolysyl-tRNA synthetase comprises amino acid residue substitutions within the substrate binding site at residues alanine at position 302, leucine at position 305, tyrosine at position 306, leucine at position 309, isoleucine at position 322, asparagine at position 346, cysteine ​​at position 348, tyrosine at position 384, valine at position 401, and tryptophan at position 417, as shown in the amino acid sequence of SEQ ID NO: 3. In one aspect, the mutant pyrrolysyl-tRNA synthetase comprises the following amino acid residue substitutions within the substrate binding site: alanine at position 302, asparagine at position 346, cysteine ​​at position 348, tyrosine at position 384, and tryptophan at position 417, as shown in the amino acid sequence of SEQ ID NO: 3. In one aspect, the at least 5 amino acid residue substitutions are alanine at position 302 to isoleucine, asparagine at position 346 to threonine, cysteine ​​at position 348 to isoleucine, tyrosine at position 384 to leucine, and tryptophan at position 417 to lysine, as shown in the amino acid sequence of SEQ ID NO: 3. In one aspect, the mutant pyrrolysyl-tRNA comprises the amino acid sequence of SEQ ID NO: 1. In one aspect, the mutant pyrrolysyl-tRNA has at least 80% sequence identity to the amino acid sequence of SEQ ID NO: 1. In aspects, the mutant pyrrolysyl-tRNA has at least 85% sequence identity with the amino acid sequence of SEQ ID NO: 1. In aspects, the mutant pyrrolysyl-tRNA has at least 90% sequence identity with the amino acid sequence of SEQ ID NO: 1. In aspects, the mutant pyrrolysyl-tRNA has at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 1. In aspects, the mutant pyrrolysyl-tRNA comprises the amino acid sequence of SEQ ID NO: 2. In aspects, the mutant pyrrolysyl-tRNA has at least 80% sequence identity with the amino acid sequence of SEQ ID NO: 2. In aspects, the mutant pyrrolysyl-tRNA has at least 85% sequence identity with the amino acid sequence of SEQ ID NO: 2. In aspects, the mutant pyrrolysyl-tRNA has at least 90% sequence identity with the amino acid sequence of SEQ ID NO: 2. In aspects, the mutant pyrrolysyl-tRNA has at least 95% sequence identity to the amino acid sequence of SEQ ID NO:2.

[0203] In embodiments, the complex comprises a mutant pyrrolysyl-tRNA synthetase described herein, including embodiments thereof; fluorosulfate-L-tyrosine (FSY); and a tRNA described herein. Pyl , including embodiments thereof. In one aspect, tRNA Pyl The amino acid sequence comprising SEQ ID NO: 4. In some aspects, the tRNA Pyl The amino acid sequence of SEQ ID NO: 4 has at least 80% sequence identity. In some aspects, the tRNA Pyl The amino acid sequence of SEQ ID NO: 4 has at least 85% sequence identity. In some aspects, the tRNA Pyl The amino acid sequence of SEQ ID NO: 4 has at least 90% sequence identity. In some aspects, the tRNA Pyl The amino acid sequence has at least 95% sequence identity to that of SEQ ID NO:4.

[0204] Cell composition

[0205] The present disclosure provides cells comprising the compositions and complexes provided herein, including embodiments thereof. Thus, in one aspect, cells comprising fluorosulfate-L-tyrosine (FSY) having the formula:

[0206] In embodiments, the cell further comprises a mutant pyrrolysyl-tRNA synthetase as described herein, including aspects thereof. In aspects, the cell further comprises a vector as described herein, including aspects thereof. In aspects, the cell further comprises a tRNA Pyl .

[0207] In embodiments, FSY is biosynthesized inside a cell, thereby producing a cell comprising FSY. In aspects, FSY is contained in a culture medium outside a cell and permeates into a cell, thereby producing a cell comprising FSY. In aspects, a cell comprises an FSY biomolecule. In aspects, a cell comprises an FSY protein. In aspects, a cell comprises an FSY biomolecule synthesized inside a cell. In aspects, a cell comprises an FSY protein synthesized inside a cell. In aspects, a cell comprises an FSY biomolecule synthesized outside a cell and permeates into a cell. In aspects, a cell comprises an FSY protein synthesized outside a cell and permeates into a cell.

[0208] In embodiments, the cell comprises a biomolecule conjugate described herein. In aspects, the cell comprises a biomolecule conjugate comprising a first biomolecule moiety conjugated to a second biomolecule moiety via a bioconjugate linker, wherein the bioconjugate linker has the formula: In one aspect, the cell comprises the formula R 1 -L 1 -AX 1 -L 2 -R 2 In one aspect, the first and second biomolecule moieties are each independently a peptidyl moiety, a nucleic acid moiety, or a carbohydrate moiety. In one aspect, the first and second biomolecule moieties are each peptidyl moieties within the same protein. In one aspect, the first and second biomolecule moieties are each peptidyl moieties within different proteins.

[0209] In embodiments, the cell comprises a protein comprising a moiety of formula (A), a moiety of formula (B), a moiety of formula (C), or a combination of two or more thereof: In aspects, the moiety of formula (A), (B) or (C) forms an intramolecular covalent bond within a protein. In aspects, the moiety of formula (A), (B) or (C) forms an intermolecular covalent bond between two proteins.

[0210] In embodiments, the cell comprises a protein of Formula (I), Formula (II), or Formula (III): Where R 1 and R 2 Each independently is a peptidyl moiety. 1 and R 2 are bound together such that the proteins of Formula (I), (II) and (III) contain intramolecular bonds. 1 and R 2 is a peptidyl moiety in two different proteins such that the proteins of formula (I), (II) and (III) comprise an intermolecular bond between the two proteins.

[0211] The cell can be any prokaryotic or eukaryotic cell. For example, any composition described herein can be expressed in bacterial cells such as E. coli, insect cells, yeast or mammalian cells (such as Hela cells, Chinese hamster ovary cells (CHO) or COS cells). In aspects, the cell is a bacterial cell. In aspects, the cell can be a precocious mammalian cell, i.e., a pluripotent stem cell. In aspects, the cell can be derived from other human tissues. In aspects, the cell is a mammalian cell. Other suitable cells are known to those skilled in the art.

[0212] Methods of forming biomolecules or biomolecule conjugates

[0213] The compositions provided herein can be used to form biomolecules or biomolecule conjugates. Thus, in one aspect, a method of forming a biomolecule, a mutant pyrrolysyl-tRNA synthetase, a tRNA Pyl A method of contacting with fluorosulfate-L-tyrosine (FSY) having the formula to form an FSY biomolecule: Thus, a FSY biomolecule is produced, i.e., a biomolecule comprising an unnatural amino acid of FSY. The biomolecule produced by this method will contain an unnatural amino acid side chain of the formula: The mutant pyrrolysyl-tRNA synthetase used in the method of producing a biomolecule is any of the ones described herein. Pyl is any of those described herein. In one aspect, the biomolecule is a protein. In one aspect, the biomolecule is a nucleic acid. In one aspect, the biomolecule is a carbohydrate. In one aspect, the reaction is performed in vitro. In one aspect, the reaction is performed in vivo. In one aspect, the reaction is performed in one or more living cells. In one aspect, the reaction is performed in one or more living bacterial cells. In one aspect, the reaction is performed in one or more living mammalian cells.

[0214] In an embodiment, the present disclosure provides a method for synthesizing a protein, a mutant pyrrolysyl-tRNA synthetase, a tRNA Pyl A method for producing a FSY protein by contacting with fluorosulfate-L-tyrosine (FSY) having the formula: Thus, an FSY protein is produced, i.e., a protein comprising an unnatural amino acid of FSY. The protein produced by this method will contain an unnatural amino acid side chain of the formula: The mutant pyrrolysyl-tRNA synthetase used in the method for producing a protein is any of those described herein. Pylis any of those described herein. In aspects, the FSY protein further comprises lysine, histidine, tyrosine, or two or more thereof. In aspects, the FSY protein comprises FSY near lysine, histidine, tyrosine, or two or more thereof. In aspects, the FSY protein comprises FSY near lysine. In aspects, the FSY protein comprises FSY near histidine. In aspects, the FSY protein comprises FSY near tyrosine. The term "nearby" is described herein. In aspects, the reaction is performed in vitro. In aspects, the reaction is performed in vivo. In aspects, the reaction is performed in one or more living cells. In aspects, the reaction is performed in one or more living bacterial cells. In aspects, the reaction is performed in one or more living mammalian cells.

[0215] In embodiments, the present disclosure provides proteins (e.g., protein conjugates) comprising one or more intramolecular covalent bonds. In aspects, FSY reacts with a nearby lysine, histidine, or tyrosine to form an intramolecular covalent bond, thereby producing a moiety of formula (A), a moiety of formula (B), a moiety of formula (C), or a combination of two or more thereof: FSY and the lysine, histidine or tyrosine close thereto can be on the α chain of the protein and / or the β chain of the protein. In one aspect, the reaction of forming an intramolecular covalent bond between FSY and lysine, histidine or tyrosine is completed by click chemistry. In one aspect, the reaction of forming an intramolecular covalent bond between FSY and lysine, histidine or tyrosine is completed by click chemistry realized nearby. In one aspect, the reaction of forming an intramolecular covalent bond between FSY and lysine, histidine or tyrosine is completed by sulfur-fluorine exchange reaction. In one aspect, the reaction of forming an intramolecular covalent bond between FSY and lysine, histidine or tyrosine is completed by sulfur-fluorine exchange reaction realized nearby. In one aspect, the reaction is carried out in vitro. In one aspect, the reaction is carried out in vivo. In one aspect, the reaction is carried out in one or more living cells. In one aspect, the reaction is carried out in one or more living bacterial cells. In one aspect, the reaction is carried out in one or more living mammalian cells.

[0216] In an embodiment, the disclosure provides a protein conjugate of formula (I), (II) or (III), wherein R 1 and R 2 Each independently is a peptidyl moiety: In terms of 1 and R 2 The proteins are linked together to form an intramolecular conjugate.1 and R 2 Not connected together. In one aspect, the reaction to form the protein conjugate is accomplished by click chemistry. In one aspect, the reaction to form the protein conjugate is accomplished by click chemistry achieved nearby. In one aspect, the reaction to form the protein conjugate is accomplished by a sulfur-fluorine exchange reaction. In one aspect, the reaction to form the protein conjugate is accomplished by a sulfur-fluorine exchange reaction achieved nearby. In one aspect, the reaction is performed in vitro. In one aspect, the reaction is performed in vivo. In one aspect, the reaction is performed in one or more living cells. In one aspect, the reaction is performed in one or more living bacterial cells. In one aspect, the reaction is performed in one or more living mammalian cells.

[0217] In embodiments, two or more proteins can be covalently linked by the methods and compositions described herein. In aspects, FSY is a non-natural amino acid in a first protein, and lysine, histidine, or tyrosine is an amino acid in a second protein, wherein the first protein and the second protein are different. FSY in the first protein reacts with lysine, histidine, or tyrosine in the second protein to form an intermolecular covalent bond between the first protein and the second protein. The intermolecular covalent bond linking the two proteins is represented by a portion of formula (A), a portion of formula (B), a portion of formula (C), or a combination of two or more thereof: FSY and lysine, histidine or tyrosine can be on the alpha chain of their respective proteins and / or on the beta chain of their respective proteins. In one aspect, the reaction of forming an intermolecular covalent bond between FSY in the first protein and lysine, histidine or tyrosine in the second protein is completed by click chemistry. In one aspect, the reaction of forming an intermolecular covalent bond between FSY in the first protein and lysine, histidine or tyrosine in the second protein is completed by click chemistry realized nearby. In one aspect, the reaction of forming an intermolecular covalent bond between FSY in the first protein and lysine, histidine or tyrosine in the second protein is completed by sulfur-fluorine exchange. In one aspect, the reaction of forming an intermolecular covalent bond between FSY in the first protein and lysine, histidine or tyrosine in the second protein is completed by sulfur-fluorine exchange realized nearby. In one aspect, the reaction is carried out in vitro. In one aspect, the reaction is carried out in vivo. In one aspect, the reaction is carried out in one or more living cells. In one aspect, the reaction is carried out in one or more living bacterial cells. In one aspect, the reaction is carried out in one or more living mammalian cells.

[0218] In an embodiment, the present disclosure provides a biomolecule conjugate comprising a first biomolecule moiety conjugated to a second biomolecule moiety via a bioconjugate linker, wherein the bioconjugate linker has the formula: In one aspect, the biomolecule conjugate has the formula R 1 -L 1 -AX 1 -L 2 -R 2 , wherein the substituents are as defined herein. In one aspect, the reaction to form the biomolecule conjugate is accomplished by click chemistry. In one aspect, the reaction to form the biomolecule conjugate is accomplished by click chemistry implemented nearby. In one aspect, the reaction to form the biomolecule conjugate is accomplished by a sulfur-fluorine exchange reaction. In one aspect, the reaction to form the biomolecule conjugate is accomplished by a sulfur-fluorine exchange reaction performed nearby. In one aspect, the reaction is performed in vitro. In one aspect, the reaction is performed in vivo. In one aspect, the reaction is performed in one or more living cells. In one aspect, the reaction is performed in one or more living bacterial cells. In one aspect, the reaction is performed in one or more living mammalian cells.

[0219] Implementation Plan 1-53

[0220] Embodiment 1. A biomolecule conjugate comprising a first biomolecule moiety conjugated to a second biomolecule moiety via a bioconjugate linker, wherein the bioconjugate linker has the formula:

[0221] Embodiment 2. The biomolecule conjugate of embodiment 1, wherein the biomolecule conjugate has the formula: R 1 -L 1 -AX 1 -L 2 -R 2 ; wherein A is a bioconjugate linker; R 1 is the first biomolecule part; R 2 is the second bioconjugate moiety; L 1 is a bond or the first covalent linker; L 2 is a bond or a second covalent linker; and X 1 Yes – NR 5 -, -O-, -S-, or wherein Ring A is a substituted or unsubstituted heteroarylene or a substituted or unsubstituted heterocycloalkylene, and wherein the nitrogen in A is attached to the bioconjugate linker; and R 5is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; wherein R 1 and R 2 Optionally linked together to form an intramolecularly conjugated biomolecule conjugate.

[0222] Embodiment 3. The biomolecule conjugate of embodiment 2, wherein L 1 yes bond, -S(O)2-, -NR 3A -, -O-, -S-, -C(O)-, -C(O)NR 3A -、-NR 3A C(O)-、-NR 3A C(O)NR 3B -, -C(O)O-, -OC(O)-, substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene; L 2 is a bond, -S(O)2-, -NR 4A -, -O-, -S-, -C(O)-, -C(O)NR 4A -、-NR 4A C(O)-、-NR 4A C(O)NR 4B -, -C(O)O-, -OC(O)-, substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene; and R 3A , R 3B , R 4A and R 4B and R and R are independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl.

[0223] Embodiment 4. The biomolecule conjugate of embodiment 2 or 3, wherein X 1 It is -NH-, -O- or imidazolyl.

[0224] Embodiment 5. The biomolecule conjugate of any of Embodiments 1-4, wherein the first biomolecule moiety is a peptidyl moiety, a nucleic acid moiety, or a carbohydrate moiety.

[0225] Embodiment 6. The biomolecule conjugate of embodiment 5, wherein the first biomolecule moiety is a peptidyl moiety; and wherein the peptidyl moiety is covalently bonded to the bioconjugate linker through a lysine, histidine, or tyrosine.

[0226] Embodiment 7. The biomolecule conjugate of any of Embodiments 1-6, wherein the second biomolecule moiety is a peptidyl moiety, a nucleic acid moiety, or a carbohydrate moiety.

[0227] Embodiment 8. The biomolecule conjugate of embodiment 7, wherein the second biomolecule moiety is a peptidyl moiety; and wherein the peptidyl moiety is covalently bonded to the bioconjugate linker through a lysine, histidine, or tyrosine.

[0228] Embodiment 9. The biomolecule conjugate of embodiment 2 or 3, wherein -L 1 -R 1 is a peptidyl moiety, a nucleic acid moiety or a carbohydrate moiety.

[0229] Embodiment 10. The biomolecule conjugate of embodiment 2, 3 or 9, wherein -L 2 -R 2 is a peptidyl moiety, a nucleic acid moiety or a carbohydrate moiety.

[0230] Embodiment 11. The biomolecule conjugate of any of Embodiments 1-10, wherein the bioconjugate linker is an inter-molecular linker.

[0231] Embodiment 12. The biomolecule conjugate of any of Embodiments 1-10, wherein the bioconjugate linker is an intramolecular linker.

[0232] Embodiment 13. Protein of formula (I), formula (II) or formula (III): Where R 1 and R 2 Each independently is peptidyl moiety; and wherein R 1 and R 2 Proteins optionally linked together to form intramolecular associations

[0233] Embodiment 14. The protein of Embodiment 13, wherein the protein has formula (I).

[0234] Embodiment 15. The protein of Embodiment 13, wherein the protein has formula (II).

[0235] Embodiment 16. The protein of Embodiment 13, wherein the protein has formula (III).

[0236] Embodiment 17. The protein of any one of embodiments 13 to 18, wherein R 1 and R 2 Each independently comprises a protein α chain or a protein β chain.

[0237] Embodiment 18. The protein of any one of embodiments 13 to 17, wherein R 1 and R 2 Proteins that are linked together to form intramolecular conjugates.

[0238] Embodiment 19. The protein of any one of embodiments 13 to 17, wherein R 1 and R 2 Not connected together.

[0239] Embodiment 20. A pyrrolysyl-tRNA synthetase comprising at least 5 amino acid residue substitutions within the substrate binding site of the pyrrolysyl-tRNA synthetase having the amino acid sequence of SEQ ID NO: 3.

[0240] Embodiment 21. The pyrrolysyl-tRNA synthetase of Embodiment 20, wherein the substrate binding site comprises residues alanine at position 302, leucine at position 305, tyrosine at position 306, leucine at position 309, isoleucine at position 322, asparagine at position 346, cysteine ​​at position 348, tyrosine at position 384, valine at position 401, and tryptophan at position 417, as shown in the amino acid sequence of SEQ ID NO: 3.

[0241] Embodiment 22. The pyrrolysyl-tRNA synthetase of Embodiment 21, wherein the at least 5 amino acid residue substitutions are alanine at position 302, asparagine at position 346, cysteine ​​at position 348, tyrosine at position 384, and tryptophan at position 417, as shown in the amino acid sequence of SEQ ID NO: 3.

[0242] Embodiment 23. The pyrrolysyl-tRNA synthetase of Embodiment 22, wherein the at least 5 amino acid residues are substituted with isoleucine at alanine at position 302, with threonine at asparagine at position 346, with isoleucine at cysteine ​​at position 348, with leucine at tyrosine at position 384, and with lysine at tryptophan at position 417, as shown in the amino acid sequence of SEQ ID NO: 3.

[0243] Embodiment 24. The pyrrolysyl-tRNA synthetase of any one of Embodiments 20 to 23, wherein the pyrrolysyl-tRNA synthetase has the amino acid sequence of SEQ ID NO: 1.

[0244] Embodiment 25. The pyrrolysyl-tRNA synthetase of any one of Embodiments 20 to 24, wherein the pyrrolysyl-tRNA synthetase is encoded by the nucleic acid sequence of SEQ ID NO: 2.

[0245] Embodiment 26. A vector comprising a nucleic acid sequence encoding the pyrrolysyl-tRNA synthetase according to any one of embodiments 20 to 25.

[0246] Embodiment 27. The vector of embodiment 26, further comprising a tRNA encoding Pyl of the nucleic acid sequence.

[0247] Embodiment 28. A complex comprising the pyrrolysyl-tRNA synthetase of any one of embodiments 20 to 27 and fluorosulfate-L-tyrosine having the formula:

[0248] Embodiment 29. The complex of embodiment 28, further comprising tRNA Pyl .

[0249] Embodiment 30. A cell comprising the biomolecule conjugate of any one of embodiments 1 to 12.

[0250] Embodiment 31. A cell comprising the protein of any one of embodiments 13 to 19.

[0251] Embodiment 32. A cell comprising the pyrrolysyl-tRNA synthetase of any one of embodiments 20 to 25.

[0252] Embodiment 33. A cell comprising the vector of embodiment 26 or 27.

[0253] Embodiment 34. A cell comprising the complex of embodiment 28 or 29.

[0254] Embodiment 35. A cell comprising fluorosulfate-L-tyrosine of the formula:

[0255] Embodiment 36. The cell of embodiment 35, further comprising a pyrrolysyl-tRNA synthetase comprising at least 5 amino acid residue substitutions within the substrate binding site of the pyrrolysyl-tRNA synthetase shown in SEQ ID NO:3.

[0256] Embodiment 37. The cell of Embodiment 35, further comprising a vector comprising a nucleic acid sequence encoding a pyrrolysyl-tRNA synthetase, wherein the synthetase comprises at least 5 amino acid residue substitutions within the substrate binding site of the pyrrolysyl-tRNA synthetase shown in SEQ ID NO:3.

[0257] Embodiment 38. The cell of any one of embodiments 35 to 37, further comprising tRNA Pyl .

[0258] Embodiment 39. The cell of any one of Embodiments 30 to 38, wherein the cell is a bacterial cell or a mammalian cell.

[0259] Embodiment 40. A method for forming the biomolecule conjugate described in embodiment 11, the method comprising: (i) contacting the FSY portion of the FSY biomolecule with a compound comprising a second biomolecule portion, wherein the second biomolecule reacts with the FSY portion; thereby forming a biomolecule conjugate having an intermolecular linker.

[0260] Embodiment 41. A method for forming the biomolecule conjugate described in embodiment 12, the method comprising: (i) contacting the FSY portion within the FSY biomolecule with a second biomolecule portion in the FSY biomolecule, wherein the second biomolecule reacts with the FSY portion; thereby forming a biomolecule conjugate having an intramolecular linker.

[0261] Embodiment 42. The method of Embodiment 40 or 41, wherein the contacting in (i) is performed intracellularly.

[0262] Embodiment 43. The method of embodiment 40 or 41 further comprises, before the contacting in step (i): performing (ii) making the biomolecule, the pyrrolysyl-tRNA synthetase of any one of embodiments 20 to 25, the tRNA Pyl and fluorosulfate-L-tyrosine having the formula: To form the FSY biomolecule.

[0263] Embodiment 44. The method of Embodiment 43, wherein the contacting in (ii) is performed intracellularly.

[0264] Embodiment 45. A method of forming the protein of embodiment 18, the method comprising contacting the FSY protein with a second protein comprising lysine, histidine, or tyrosine; thereby forming an intramolecularly conjugated protein.

[0265] Embodiment 46. A method of forming the protein of embodiment 19, the method comprising contacting fluorosulfate-L-tyrosine in the FSY protein with lysine, histidine or tyrosine in a second protein; thereby forming an intermolecular conjugate protein.

[0266] Embodiment 47. The method of embodiment 45 or 46, further comprising producing the FSY protein, the method comprising making the protein, the pyrrolysyl-tRNA synthetase of any one of embodiments 20 to 25, the tRNA Pyl and fluorosulfate-L-tyrosine having the formula: Thereby, the FSY protein is produced.

[0267] Embodiment 48. The method of any one of Embodiments 40 to 47, wherein the contacting comprises a sulfur-fluorine exchange reaction.

[0268] Embodiment 49. The method of Embodiment 48, wherein the contacting comprises a sulfur-fluorine exchange reaction carried out nearby.

[0269] Embodiment 50. The method of any one of Embodiments 46 to 50, wherein the contacting is performed intracellularly.

[0270] Embodiment 51. A protein comprising an unnatural amino acid adjacent to a lysine, histidine, or tyrosine; wherein the unnatural amino acid has a side chain of the formula:

[0271] Embodiment 52. A protein comprising a moiety of formula (A), a moiety of formula (B), a moiety of formula (C), or a combination of two or more thereof:

[0272] Embodiment 53. A cell comprising the protein of embodiment 51 or 52.

[0273] Implementation Plan P1-P29

[0274] Embodiment P1. A biomolecule conjugate comprising a first biomolecule moiety conjugated to a second biomolecule moiety via a bioconjugate linker, wherein the bioconjugate linker has the formula:

[0275] Embodiment P2. The biomolecule conjugate of embodiment P1, wherein the biomolecule conjugate has the formula: R 1 -L 1 -AX 1 -L 2 -R 2 ; wherein A is the bioconjugate linker; R 1 is the first biomolecule portion; R 2 is the second bioconjugate moiety; L 1 is a bond or the first covalent linker; L 2 is a bond or a second covalent linker; X 1 Yes – NR 5 -, -O-, -S-, or wherein Ring A is a substituted or unsubstituted heteroarylene or a substituted or unsubstituted heterocycloalkylene, and wherein the nitrogen in A is attached to the bioconjugate linker; and R 5 is hydrogen, substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene.

[0276] Embodiment P3. The biomolecule conjugate of embodiment P2, wherein L 1 yes bond, -S(O)2-, -NR 3A -, -O-, -S-, -C(O)-, -C(O)NR 3A -、-NR 3A C(O)-、-NR 3A C(O)NR 3B -, -C(O)O-, -OC(O)-, substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene; L 2 yes bond, -S(O)2-, -NR 4A -, -O-, -S-, -C(O)-, -C(O)NR 4A -、-NR 4A C(O)-、-NR 4A C(O)NR 4B -, -C(O)O-, substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene; R 3A , R 3B , R 4Aand R 4B and R and R are independently hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl.

[0277] Embodiment P4. The biomolecule conjugate of embodiment P2, wherein X 1 is imidazole, -NH- or -O-.

[0278] Embodiment P5. The biomolecule conjugate of Embodiment P1, wherein the first biomolecule moiety is a peptidyl moiety.

[0279] Embodiment P6. The biomolecule conjugate of Embodiment P1, wherein the second biomolecule moiety is a peptidyl moiety.

[0280] Embodiment P7. The biomolecule conjugate of any one of Embodiments P2 to P4, wherein -L 1 -R 1 It is the peptidyl part.

[0281] Embodiment P8. The biomolecule conjugate of any one of Embodiments P2 to P4, wherein -L 2 -R 2 It is the peptidyl part.

[0282] Embodiment P9. The biomolecule conjugate of embodiment P1, wherein the first biomolecule moiety is a nucleic acid moiety or a carbohydrate moiety.

[0283] Embodiment P10. The biomolecule conjugate of embodiment P1, wherein the second biomolecule moiety is a nucleic acid moiety or a carbohydrate moiety.

[0284] Embodiment P11. The biomolecule conjugate of any one of Embodiments P2 to P4, wherein -L 1 -R 1 is a nucleic acid portion or a carbohydrate portion.

[0285] Embodiment P12. The biomolecule conjugate of any one of Embodiments P2 to P4, wherein -L 2 -R 2 is a nucleic acid portion or a carbohydrate portion.

[0286] Embodiment P13. A mutant pyrrolysyl-tRNA synthetase comprising at least 5 amino acid residue substitutions within the substrate binding site of the mutant pyrrolysyl-tRNA synthetase.

[0287] Embodiment P14. The mutant pyrrolysyl-tRNA synthetase described in Embodiment P13, wherein the substrate binding site includes residues alanine at position 302, leucine at position 305, tyrosine at position 306, leucine at position 309, isoleucine at position 322, asparagine at position 346, cysteine ​​at position 348, tyrosine at position 384, valine at position 401, and tryptophan at position 417, as shown in the amino acid sequence of SEQ ID NO: 3.

[0288] Embodiment P15. The mutant pyrrolysyl-tRNA synthetase described in Embodiment P14, wherein the at least 5 amino acid residue substitutions are alanine at position 302, asparagine at position 346, cysteine ​​at position 348, tyrosine at position 384 and tryptophan at position 417, as shown in the amino acid sequence of SEQ ID NO:3.

[0289] Embodiment P16. The mutant pyrrolysyl-tRNA synthetase described in Embodiment P15, wherein the at least 5 amino acid residues are substituted by alanine at position 302 with isoleucine, asparagine at position 346 with threonine, cysteine ​​at position 348 with isoleucine, tyrosine at position 384 with leucine, and tryptophan at position 417 with lysine, as shown in the amino acid sequence of SEQ ID NO: 3.

[0290] Embodiment P17. The mutant pyrrolysyl-tRNA synthetase of any one of Embodiments P13 to P16, wherein the mutant pyrrolysyl-tRNA synthetase has the amino acid sequence of SEQ ID NO: 1.

[0291] Embodiment P18. The mutant pyrrolysyl-tRNA synthetase of any one of Embodiments P13 to P17, wherein the mutant pyrrolysyl-tRNA synthetase is encoded by the nucleic acid sequence of SEQ ID NO: 2.

[0292] Embodiment P19. A vector comprising a nucleic acid sequence encoding the mutant pyrrolysyl-tRNA synthetase according to any one of embodiments P13 to P18.

[0293] Embodiment P20. The vector of embodiment P19 further comprises a vector encoding tRNA Pyl of the nucleic acid sequence.

[0294] Embodiment P21. A complex comprising the mutant pyrrolysyl-tRNA synthetase of any one of embodiments P13 to P18; and fluorosulfate-L-tyrosine (FSY) having the formula:

[0295] Embodiment P22. The complex of embodiment P21, further comprising tRNA Pyl .

[0296] Embodiment P23. A modified cell comprising a biomolecule conjugate according to any one of embodiments P1 to P12, a mutant pyrrolysyl-tRNA synthetase according to any one of embodiments P13 to P18, a vector according to embodiment P19 or P20, or a complex according to embodiment P21 or P22.

[0297] Embodiment P24. A modified cell comprising fluorosulfate-L-tyrosine (FSY) having the formula:

[0298] Embodiment P25. The modified cell of embodiment P24, further comprising the mutant pyrrolysyl-tRNA synthetase of any one of embodiments P13 to P18.

[0299] Embodiment P26. The modified cell of embodiment P24, further comprising the vector of embodiment P19 or P20.

[0300] Embodiment P27. The modified cell of embodiment P24, further comprising tRNA Pyl .

[0301] Embodiment P28. A method of forming a biomolecule conjugate, the method comprising reacting a mutant pyrrolysyl-tRNA synthetase, a tRNA according to any one of embodiments P13 to P18, Pyl and contacting with fluorosulfate-L-tyrosine (FSY) having the formula:

[0302] Embodiment P29. The method of Embodiment 28, wherein the contacting is performed intracellularly. Example

[0303] The following examples are intended to further illustrate certain embodiments and aspects of the present disclosure. These examples are not intended to limit the spirit or scope of the present disclosure or claims.

[0304] Example 1

[0305] Gene encodes fluorosulfate-L-tyrosine to react with lysine, histidine, and tyrosine in proteins in vivo via SuFEx

[0306] Introducing new chemical reactivity into proteins in living cells will endow proteins with innovative covalent bonding capabilities for in vivo studies and engineering. Potentially bioreactive unnatural amino acids (Uaas) can be incorporated into proteins to react with target natural amino acid residues through proximity-enabled reactivity. To expand the diversity of in vivo proteins suitable for such reactivity, chemical functions that are biocompatible and capable of reacting with a variety of natural residues under physiological conditions are highly desirable. Here, the inventors report the genetic encoding of fluorosulfate-L-tyrosine (FSY), the first potentially bioreactive Uaa for sulfur-fluoride exchange (SuFEx) on proteins in vivo. FSY was found to be nontoxic to Escherichia coli and mammalian cells; after incorporation into proteins, it selectively reacts with nearby lysine, histidine, and tyrosine through SuFEx to directly generate covalent intraprotein bridges and interprotein crosslinks of interacting proteins in living cells. The proximity-activatable reactivity, multi-target capability, and excellent biocompatibility of FSY will be invaluable for the covalent manipulation of proteins in vivo. Moreover, genetically encoded FSYs are thereby used to enhance the functionality of universal proteins via next-generation click chemistry, SuFEx, which will offer broad applications in chemical biology, drug discovery, and biotherapeutics.

[0307] A new tRNA synthetase pair was developed to convert fluorosulfate-L-tyrosine (FSY) ( Figure 1A ) is genetically incorporated into proteins in E. coli and mammalian cells. The inventors found that FSY is generally non-toxic to cells and can react with Lys, His and Tyr under physiological conditions through SuFEx reactions achieved by intra-protein and inter-protein proximity ( Figure 1B ). The inventors demonstrated direct cross-linking of FSY-interacting proteins in vivo.

[0308] FSY was synthesized using the SO2F2 / borax method (yield 88%). Dong et al, Angew. Chem. Int. Ed. Engl, 53: 9430-9448 (2014); Chen et al, Angew. Chem. Int. Ed. Engl., 55: 1835-1838 (2016). In order to genetically encode FSY, the inventors developed a mutant pyrrolysyl-tRNA synthetase (PylRS) specific for FSY. By using the small intelligent mutagenesis method, residues Ala302, Leu305, Tyr306, Leu309, Ile322, Asn346, Cys348, Tyr384, Val401 and Trp417 of PylRS of Methanosarcina mazei were mutated to generate a PylRS mutant library, and selection was performed as described. Lacey et al, ChemBioChem, 14:2100-2105 (2013); Wang et al, Angew.Chem.Int.Ed.Engl., 44:34-66 (2005); Takimoto et al, ACS Chem.Biol., 6:733-743 (2011). Six hits showing FSY-dependent phenotypes were identified; they all converged on the same amino acid sequence (302I / 346T / 348I / 384L / 417K), referred to herein as FSYRS.

[0309] The incorporation specificity of FSY into proteins in Escherichia coli was evaluated. Pyl / FSYRS pair co-expressed in Z containing TAG codon at position 36 spa Affibody (Afb) gene (Afb-36TAG). In the absence of FSY, full-length Afb was not detected; when 1 mM FSY was added to the growth medium, full-length Afb36FSY was produced at a yield of 1.6 mg / L ( Figure 1C The purified Afb36FSY was analyzed by electrospray ionization time-of-flight mass spectrometry (ESI-TOF MS) ( Figure 1D). The peak observed at 7855.96 Da corresponds to intact Afb containing FSY at position 36 (Afb36FSY: expected 7856.69 Da). The peak measured at 7724.77 Da corresponds to Afb36FSY lacking the starting Met (Afb36FSY-Met: expected 7725.50 Da). The two small peaks observed at 7836.55 and 7705.16 Da correspond to Afb36FSY lacking F (expected 7836.69 Da) and Afb36FSY-Met lacking F (expected 7705.49 Da), respectively, indicating that F was slightly eliminated during the MS measurement. Notably, no peak corresponding to Afb containing other amino acids at position 36 was observed. FSY was also incorporated at position 24 of the Z protein and analyzed by tandem MS. A series of b and y ions clearly indicated that FSY was incorporated at position 24 designated by TAG ( Figure 1E ). The presence of 1 mM FSY did not affect the growth of E. coli, indicating no significant cytotoxicity. These results suggest that the evolved tRNA Pyl The / FSYRS pair can efficiently and specifically incorporate FSY in Escherichia coli.

[0310] The incorporation of FSY into the protein in mammalian cells was tested. HeLa-EGFP-182TAG reporter cells were transfected with the plasmid pMP-FSYRS-3xtRNA, which expresses FSYRS and tRNA Pyl gene. Wang et al, Nat. Neurosci., 10: 1063-1072 (2007). 182 Suppression of the TAG codon will produce full-length EGFP presenting cell fluorescence. After transfection, cells were incubated with various concentrations of FSY at 37°C for 24 or 48 h, and then flow cytometry was performed. Strong EGFP fluorescence was measured from cells only when FSY was added ( Figure 2A ). The fluorescence intensity increases with FSY concentration and incubation time ( Figure 2B , Figure 6 As a positive control, p-azido-L-phenylalanine (AzF) was introduced into reporter cells in parallel using plasmid pIre-Azi3, which is the most efficient Uaa introduction system in mammalian cells in our hands. Coin et al, Cell, 155:1258-1269 (2013). FSY was incorporated favorably compared to AzF, reaching 76% of the level of AzF. It is noteworthy that, although cytotoxicity is often a problem with bioreactive Uaas, no significant toxicity of FSY was observed against HeLa or 293T cells ( Figure 7), which is a valuable feature of FSY, probably due to the extremely low background activity of aryl fluorosulfate in cells. Chen et al, J. Am. Chem. Soc., 138: 7353-7364 (2016). These results were also confirmed by fluorescence confocal microscopy ( Figure 2C ). In the presence of FSY, strong EGFP fluorescence was observed throughout the cells, and the cell morphology remained normal. No fluorescence signal was detected when FSY was not added. These results indicate that FSY is incorporated into proteins in mammalian cells with high efficiency and specificity without causing harmful effects.

[0311] The inventors then determined whether the incorporated FSY could react directly with natural amino acid residues in E. coli through proximity-enabled reactivity. Afb binds to its substrate Z protein with moderate affinity, providing a suitable protein framework for studying FSY cross-linking in vivo. Based on the crystal structure of the Afb-Z complex (Hogbom, et al, P. Proc. Natl. Acad. Sci. USA, 100: 3191-3196 (2003)), the inventors introduced FSY at position 24 of the Z protein and the target natural residue at position 7 of Afb, so that the two residues are closely adjacent when Afb-Z binds ( Figure 3A ). Since aryl fluorosulfates are weak electrophiles, the inventors decided to use Ala as a negative control to test the reactivity of FSY towards Lys, His, Tyr, Cys, Ser and Thr. In order to better separate Afb and Z proteins of similar molecular weight, we fused maltose binding protein (MBP) to the N-terminus of Z (MBP-Z). Both MBP-Z and Afb had a 6xHis tag attached to the C-terminus. To determine whether chemical cross-linking can occur in living cells, we co-expressed MBP-Z24FSY and Afb-7X (X = target residue) in Escherichia coli. After 6 hours of incubation at 37°C, equal numbers of cells were analyzed using Western blotting under denaturing conditions. From cells expressing Afb-7Lys, Afb-7His or Afb-7Tyr, cross-linked bands were observed with molecular weights corresponding to the adducts of MBP-Z24FSY and Afb ( Figure 3B ). 6xHis-tagged proteins were purified from the cells and analyzed by SDS-PAGE. Consistently, for Afb-7Lys, Afb-7His, and Afb-7Tyr, protein bands corresponding to MBP-Z cross-linked with Afb were clearly observed ( Figure 3B), the cross-linking efficiencies were 59%, 53% and 35%, respectively. In comparison, no cross-linking bands were observed when MBP-Z24FSY was co-expressed with Afb-7Cys, Afb-7Ser, Afb-7Thr or Afb-7Ala. Although aryl carbamates require alkaline pH to cross-link Lys or Tyr at the Afb / Z interface in vitro (Xuan et al, Angew. Chem. Int. Ed. Engl., 56:5096-5100 (2017)), FSY is able to cross-link Lys, His or Tyr directly in living E. coli cells.

[0312] To further validate the in vivo chemical cross-linking capability of FSY, the purified protein was analyzed using tandem MS. As expected, a strong signal corresponding to the covalently linked peptide of MBP-Z24FSY and Afb-7Lys was identified ( Figure 3C ). A series of b and y fragment ions clearly indicated that the incorporated FSY was cross-linked only to Lys 7 of Afb. Similar MS results were obtained for MBP-Z24FSY co-expressed with Afb-7His, confirming that FSY cross-linked to the target His7 ( Figure 3D ). Meanwhile, consistent with the results of western blotting and SDS-PAGE, no cross-linked peptides of MBP-Z24FSY with Afb-7Ser, Afb-7Thr, Afb-7Cys, or Afb-7Ala were detected by tandem MS. Although cross-linking of MBP-Z24FSY with Afb-7Tyr was detected by western blotting and SDS-PAGE ( Figure 3B ), but cross-linked peptides could not be identified using tandem MS.

[0313] To search for additional evidence that FSY reacts with Tyr, we incorporated FSY and Tyr into a single protein for intramolecular cross-linking in vivo. Pyl The / FSYRS pair was co-expressed with a mutant calmodulin gene (CaM-76TAG), which encodes 76TAG for FTAG incorporation and a nearby Tyr at position 80. The CaM protein was expressed in the presence of 1 mM FSY, purified, and analyzed by tandem MS ( Figure 4 ). A series of b and y fragment ions clearly indicate that FSY formed a covalent bond with Tyr80 through SuFEx and lost the mass of HF.

[0314] To demonstrate that FSY can cross-link interacting proteins by targeting native Tyr residues, we tested whether FSY-armed thioredoxin (Trx) can covalently capture 3'-phosphoadenosine-5'-phosphosulfate (PAPS) reductase. Trx interacts with PAPS reductase to promote the reduction of adenylate sulfate to sulfite, thereby synthesizing cysteine ​​de novo. Chartron et al. Biochemistry, 46: 3942-3951 (2007). Based on the complex structure of PAPS reductase and Trx1 (Chartron et al. Biochemistry, 46: 3942-3951 (2007)), FSY was incorporated into Escherichia coli Trx1 at site 62, targeting the proximal Tyr191 of PAPS reductase ( Figure 5A ). Trx1(62FSY) and WT PAPS reductase were expressed, purified and incubated in Tris buffer at pH 7.4 or 8.0 for 12 h. SDS-PAGE showed a clear band corresponding to the covalent complex of Trx1 and PAPS reductase ( Figure 5B , Figure 8 The samples were further analyzed using tandem MS, which clearly showed that FSY of Trx1 was covalently cross-linked to the target Tyr191 of PAPS reductase via the SuFEx reaction ( Figure 5C ). In summary, the intramolecular CaM cross-linking and the intermolecular Trx1-PAPS reductase cross-linking confirmed that FSY reacted with Tyr in proximity via the SuFEx reaction.

[0315] In summary, the live cell-friendly FSY gene is encoded into proteins in E. coli and mammalian cells, which selectively react with nearby Lys, His and Tyr residues directly in live E. coli cells through SuFEx. Intermolecular cross-linking using bioreactive Uaas is mainly limited to in vitro use and rarely targets Cys (Coin et al, Cell, 155: 1258-1269 (2013); Yang et al, Nat. Commun., 8: 2240 (2017)), FSY can cross-link intermolecular interaction proteins in vivo and target three different residues. Since the target residues of FSY often appear on the surface and interface of proteins, FSY will greatly expand the diversity of proteins suitable for covalent bonding and enable innovative in vivo applications to utilize the covalent bonding ability of proteins. Moreover, by genetically encoding FSY, protein functions can now be conferred through a new generation of click chemistry SuFEx, which will find wide application in chemical biology, drug discovery and biotherapeutics.

[0316] Materials and methods

[0317] Chemical synthesis of FSY: Fluorosulfate-L-tyrosine hydrochloride was synthesized based on the classic SO2F2 / borax method. Chen et al, Angew.Chem.Int.Ed.Engl.2016,55,1835-1838; Dong et al, Angew.Chem.Int.Ed.Engl.2014,53,9430-9448.

[0318] Boc-Tyr-OH (5.00 g, 17.8 mmol), 210 mL of CH2Cl2 and 860 mL of saturated borax solution were added to a 2L two-necked round-bottom flask equipped with a magnetic stirring bar. The mixture was stirred vigorously for 20 minutes. The reaction system was evacuated until the two-phase solution began to degas and refilled with SO2F2 three times. The reaction mixture was stirred vigorously overnight at 25 ° C. CH2Cl2 was carefully removed with a rotary evaporator. Then 1M HCl aqueous solution (210 mL) was slowly added to the reaction mixture under stirring, and a white solid was precipitated. The mixture was filtered and the solid was washed with water (80 mL×3). The white solid was dried at 40 ° C for 4 hours under vacuum (1 mmHg) to obtain 6.07 g (16.7 mmol) of Boc-Tyr-OSO2F, which can be directly used in the next step without further purification.

[0319] Boc-Tyr-OSO2F (2.0 g, 5.5 mmol) was treated with 4M HCl in dioxane (11 mL), and the reaction mixture was stirred overnight, during which time a white solid precipitated. The solid was filtered and washed with cold ether (5 mL x 2) to give the target fluorosulfate-L-tyrosine hydrochloride as a white solid (1.46 g, 88% yield). 1 H NMR (400MHz, CD3OD): δ (ppm) 3.23-3.41 (m, 2H), 4.32-4.34 (m, 1H), 7.45-7.53 (m, 4H); 13 C NMR (400MHz, CD3OD): δ (ppm) 38.9, 57.2, 125.0, 135.3, 139.5, 153.5, 173.3; MS: 264.0 [NH3-Tyr-OSO2F] + ,286.0[NH2-Tyr-OSO2F+Na] +

[0320] Construction and selection of synthetase library: The pBK-TK3 mutant library of MmPylRS was constructed using a new small smart mutagenesis method that uses a single codon for each amino acid, so more residues can be mutated simultaneously. The following residues of MmPylRS were mutated using the method previously described by Lacey et al, ChemBioChem, 14:2100-2105 (2013): 302NYT, 305WTG, 306WTG / TAC, 309KYA, 322AYA, 346NDT / VMA / ATG / TGG, 348NDT / VMA / ATG / TGG, 384TTM / TAT, 401VTT, 417NDT / VMA / ATG / TGG.

[0321] DH10B cells (100 uL) with pREP positive selection reporter gene were transformed with 100 ng pBK-TK3 library by electroporation. The electroporated cells were immediately recovered with 1 mL preheated SOC medium and vigorously stirred at 37 °C for 1 h. The recovered cells were directly inoculated in 4% paraformaldehyde supplemented with 1 mM FSY, 12.5 μg mL -1 Tetracycline (Tet), 25 μg mL -1 Kanamycin (Kan) and 68 μg mL -1 LB-agar selection plates containing chloramphenicol (Cm). The selection plates were incubated at 37°C for 48 hours and then stored at room temperature. Colonies showing green fluorescence were diluted in 100uL of LB and replicated on LB-agar screening plates containing 1) Tet12.5Kan25; 2) Tet12.5Kan25Cm100; 3) Tet12.5Kan25Cm100 supplemented with 1mM FSY. After incubation at 37°C for 48 hours, 6 clones that showed FSY-dependent fluorescence and growth were considered hits and further characterized. The pBK plasmid encoding the PylRS mutant was extracted by microprep and then separated from the reporter plasmid by DNA gel electrophoresis. The purified pBK plasmid was analyzed by Sanger sequencing.

[0322] Plasmid construction

[0323] pEvol-FSY: The pEvol-FSY plasmid was generated by introducing the FSYRS encoding gene into the pEvol vector by ligation-independent cloning. Li et al, SJ Nat. Methods, 4:251-256 (2007). Briefly, the FSYRS gene was amplified with the following primers, purified and ligated into the pEvol vector (linearized with Bgl II and Sal I) using T4 DNA polymerase. FSRYS-BglII-F is SEQ ID NO: 5. FSYRS-SalI-R is SEQ ID NO: 6.

[0324] pMP-3×tRNA Pyl -FSYRS: Plasmids were constructed by introducing the FSYRS gene into the pMP vector by standard cloning. The FSYRS gene was amplified with the following primers, digested with Nco I and Nhe I, and ligated into the pMP vector pretreated with the same restriction enzymes. FSYRS-NcoI-F is SEQ ID NO: 7. FSYRS-NheI-R is SEQ ID NO: 8.

[0325] pET-Duet-Afb 4A -7X-MBP-Z24TAG: To evaluate the in vivo cross-linking ability of FSY, site-directed mutagenesis was performed on Afb in the pET-Duet-MBP-Z24TAG expression vector. 4A -7X (X = Lys, Tyr, Cys, Ser, Thr, His or Ala) gene, introducing a mutation at residue 7, resulting in pET-Duet-Afb 4A -7X-MBP-Z24TAG plasmid. Yang et al, Nat. Communi, 8:2240 (2017). The following primers were used. Afb-4A7A-F is SEQ ID NO: 9. Afb-4A7K-F is SEQ ID NO: 10.

[0326] pTak-CaM-76TAG-80Tyr: To investigate the intramolecular cross-linking ability of FSY, residues 76 and 80 of the calmodulin encoding gene CaM were mutated to amber stop codons TAG and Tyr, respectively. At the same time, residues 75, 77, 79, and 81 of CaM were mutated to Ala by overlapping PCR to aid the cross-linking reaction. The CaM gene was amplified with the following primers, digested with Spe I and Blp I, and ligated into the pTak-CaM vector pretreated with the same restriction enzymes. CaM-SpeI-F is SEQ ID NO: 18. 80Tyr-R is SEQ ID NO: 19. 80Tyr-F is SEQ ID NO: 20.

[0327] pBad-CysH: To generate the pBad-CysH plasmid, the PAPS reductase encoding gene CysH was amplified by colony PCR, digested with Nde I and Hind III, and ligated into the pBad vector pretreated with the same restriction enzymes. CysH-NdeI-F is SEQ ID NO: 22. CysH-Hind3-R is SEQ ID NO: 23.

[0328] pBad-Trx35A62TAG: To generate the pBad-Trx35A62TAG plasmid, residue 62 of the Trx35A gene was mutated to the amber stop codon TAG by site-directed mutagenesis using the following primers: Trx-62TAG-F is SEQ ID NO: 24. Trx-62TAG-R is SEQ ID NO: 25.

[0329] Protein expression:

[0330] Afb36FSY: pTak-Afb36TAG-His and pBK-FSYRS were co-transformed into DH10B E. coli chemically competent cells. The transformants were plated on LB-Kan50Cm34 agar plates and incubated overnight at 37°C. A single colony was inoculated into 5 mL of 2xYT-Kan50Cm34 and incubated overnight at 37°C. The next day, 2 mL of the overnight cell culture was diluted into 100 mL of 2xYT-Kan50Cm34 and incubated at 37°C with vigorous stirring. When the OD 600 When the p-value reached 0.4-0.6, 1 mM FSY and 0.5 mM IPTG were added to half of the cell culture (50 mL), and then induced at 30°C for 6 h. As a negative control, the remaining 50 mL of cells were induced with 0.5 mM IPTG at 30°C for 6 h. The cell pellet was collected by centrifugation at 4200 g for 30 minutes at 4°C and stored at -80°C.

[0331] Afb 4A -7X and MBP-Z24FSY: pEvol-FSYRS and pET-Duet-Afb 4A -7X-MBP-Z24TAG was co-transformed into BL21(DE3) E. coli chemically competent cells. The transformants were plated on LB-Amp100Cm34 agar plates and incubated overnight at 37°C. A single colony was inoculated into 5 mL of 2xYT-Amp100Cm34 and cultured overnight at 37°C. On the second day, 1 mL of the overnight cell culture was diluted into 50 mL of 2xYT-Amp100Cm34 and stirred vigorously at 37°C. When the OD 600When the p-value reached 0.4-0.6, the cell culture was induced with 0.5 mM IPTG and 0.2% arabinose and then incubated for 6 hours at 37°C. The cell pellet was collected by centrifugation at 4200 g for 30 minutes at 4°C and stored at -80°C.

[0332] CaM-76FSY-80Tyr: Co-transform pBad-CaM76TAG80Tyr and pEvol-FSYRS into BL21(DE3) E. coli chemically competent cells. Plate the transformants on LB-Amp100Cm34 agar plates and incubate overnight at 37°C. Inoculate a single colony into 5 mL of 2xYT-Amp100Cm34 and grow overnight at 37°C. On the next day, dilute 1 mL of the overnight cell culture into 50 mL of 2xYT-Amp100Cm34 and stir vigorously at 37°C. When OD 600 When the pH reached 0.4-0.6, the cell culture was induced with 0.2% arabinose and then incubated for 6 hours at 37°C. The cell pellet was collected by centrifugation at 4200 g for 30 minutes at 4°C and stored at -80°C.

[0333] Trx35A62FSY: pBad-Trx35A62TAG and pEvol-FSYRS were co-transformed into BL21(DE3) E. coli chemically competent cells. The transformants were plated on LB-Amp100Cm34 agar plates and incubated overnight at 37°C. A single colony was inoculated into 5 mL of 2xYT-Amp100Cm34 and grown overnight at 37°C. The next day, 1 mL of the overnight cell culture was diluted into 50 mL of 2xYT-Amp100Cm34 and stirred vigorously at 37°C. When the OD 600 When the pH reached 0.4-0.6, the cell culture was induced with 0.2% arabinose and then incubated for 6 hours at 30°C. The cell pellet was collected by centrifugation at 4200 g for 30 minutes at 4°C and stored at -80°C.

[0334] PAPS Reductase: Transform pBad-CysH into DH10B E. coli chemically competent cells. Plate transformants on LB-Amp100 agar plates and incubate overnight at 37°C. Inoculate a single colony into 10 mL of 2xYT-Amp100 and grow overnight at 37°C. The next day, dilute 10 mL of the overnight cell culture into 1 L of 2xYT-Amp100 and stir vigorously at 37°C. When OD 600 When the pH reached 0.4-0.6, the cell culture was induced with 0.2% arabinose and then incubated for 6 hours at 30°C. The cell pellet was collected by centrifugation at 4200 g for 30 minutes at 4°C and stored at -80°C.

[0335] His-tag protein purification: The above cell pellet was resuspended in 14 mL lysis buffer (50 mM Tris-HCl pH 8.0, 500 mM NaCl, 20 mM imidazole, 1% v / v Tween 20, 10% v / v glycerol, lysozyme 1 mg / mL, DNA enzyme 0.1 mg / mL and protease inhibitors). The cell suspension was lysed at 4°C for 30 minutes. The cell lysate was sonicated in an ice water bath using a Sonic Dismembrator (Fisher Scientific, 30% yield, 3 minutes, 1 second off, 1 second on) and then centrifuged (20,000 g, 30 minutes, 4°C). The soluble fraction was collected and mixed with the pre-equilibrated -NTA agarose resin (400 μL) was incubated at 4 °C with constant mechanical rotation for 1 h. The slurry was loaded onto the Poly- On the column, wash 3 times with 5 mL of wash buffer (50 mM Tris-HCl pH 8.0, 500 mM NaCl, 20 mM imidazole and 10% v / v glycerol), and then elute 5 times with 200 μL of elution buffer (50 mM Tris-HCl, pH 8.0, 500 mM NaCl, 250 mM imidazole and 10% v / v glycerol). The eluate was concentrated and the buffer was exchanged into 100 μL of protein storage buffer (50 mM Tris-HCl, pH 7.4 or 8.0, and 150 mM NaCl) using an Amicon Ultra column and stored at -80°C for future analysis.

[0336] FACS analysis of Uaa incorporation into HeLa-GFP-182TAG reporter cells: One day before transfection, 4.5 × 10 4 HeLa-EGFP-182TAG reporter gene cells (Wang et al, Nat. Neurosci., 10: 1063-1072 (2007)) were seeded in a Greiner bio-one 24-well cell culture dish containing 500 μL of DMEM medium and 10% FBS and cultured in a CO2 incubator at 37°C. According to the manufacturer's instructions, 2.5 μL of lipofectamine 2000 was used to infect the plasmid pMP-3xtRNA-FSYRS (500 ng, encoding FSYRS and 3 copies of tRNA Pyl) was transfected into target cells. Six hours after transfection, the medium containing the transfection complex was replaced with fresh DMEM medium containing 10% FBS in the presence or absence of 1 mM FSY. For AzF incorporation, the plasmid pIre-Azi3 (Coin et al, Cell, 155: 1258-1269 (2013)) was similarly transfected and DMEM medium containing 10% FBS was used, with or without 1 mM AzF. After incubation at 37°C for 24-48 hours, the transfected cells were trypsinized and collected by centrifugation (1500 rpm, 5 min, rt). The cells were resuspended in 300 μL of FACS buffer (1×PBS, 2% FBS, 1 mM EDTA, 0.1% sodium azide, 0.28 μM DAPI) and stained by BDLS RFortessa TM Analyze with a cell analyzer.

[0337] Fluorescence confocal microscopy of HeLa-EGFP-182TAG reporter gene cells: One day before transfection, 4.5 × 10 4 HeLa-EGFP-182TAG cells were seeded in Greiner bio-one CELLview glass bottom vessels containing 500 μL of DMEM medium and 10% FBS and cultured in a CO2 incubator at 37°C. Plasmid pMP-3xtRNA-FSYRS (500 ng) was transfected into target cells using 2.5 μL of lipofectamine 2000 according to the manufacturer's instructions. Six hours after transfection, the medium was replaced with complete DMEM medium containing or not containing 1 mM FSY. The cells were incubated at 37°C for another 24-48 hours and then imaged with a Nikon Eclipse Ti confocal microscope.

[0338] Mass spectrometry analysis: The intact Afb containing FSY was analyzed by ESI-TOF MS using an Agilent 6210 mass spectrometer connected to an Agilent 1100 HPLC system. 2 micrograms of protein sample was injected by an autosampler and separated by a reverse phase gradient of 0-80% acetonitrile for 15 minutes on an Agilent Zorbax SB-C8 column (2.1 mm ID×10 cm long). Mass calibration was performed just before analysis. Protein spectra were averaged and deconvoluted for charge states using Agilent MassHunter software.

[0339] Protein digestion and tandem mass spectrometry were performed as previously described by Yang et al, Nat. Communi., 8:2240 (2017). Afb / MBP-Z samples were digested with Glu-C. CaM and Trx1 / PAPS reductase samples were digested with trypsin. The digested peptides were analyzed using an online EASY spray source and a nano-LC UltiMate 3000 HPLC system (Thermo Fisher) connected to an Elite mass spectrometer (Thermo Fisher). The peptides were extracted from an EASY-Spray PepMap C18 column (50 cm; particle size, 2 μm; pore size, 10 μm) in a gradient of 2% to 40% buffer B (80% acetonitrile, 20% H2O, 0.1% formic acid). ThermoFisher) was eluted at a flow rate of 300 nL / min. The separation method was slightly modified for different samples. The Elite mass spectrometer was operated in data-dependent mode, where the mass range from 375 to 1800 (AGC target 1×10 6 A full MS scan was performed at R = 60,000 (m / z = 200) followed by ten CID MS / MS scans. A dynamic exclusion time of 30 s was used to exclude singly charged ions. The mass spectrometry raw data were searched by Maxquant.

[0340] Example 2

[0341] FSY is used to covalently crosslink a ligand with its natural receptor. Human growth hormone (hGH) is a hormone secreted by the anterior pituitary gland. hGH binds to hGH receptors and stimulates growth, cell proliferation, and cell regeneration in humans. It also stimulates the production of insulin-like growth factor. hGH is an interesting therapeutic target because growth hormone deficiency affects 1:4000 children in the United States and is expensive to treat (Stanley, T. Curr. Opin. Endocrinol Diabetes Obes. 2012, 19. 47-52). In addition, excessive hGH is associated with the occurrence, development, and metastasis of breast cancer (Subramani, R. et al. Endocrinology, 6: 1543-1555 (2017)).

[0342] Based on the crystal structure of hGH bound to its receptor, FSY was genetically integrated into hGH at site 68 to target residue Lys166 ( Fig.10 ). hGH(FSY68) was expressed in E. coli and then purified, and then hGH(FSY) was incubated with the extracellular domain of the hGH receptor in PBS buffer for different times. The reaction mixture was then separated by SDS-PAGE and detected using Western blotting, in which an antibody specific for the Hisx6 tag was attached to the C-terminus of hGH.

[0343] like Fig.11As shown, hGH (FSY) is covalently cross-linked to the hGH receptor, indicated by a new band at approximately 50 kD. When wild-type (WT) hGH was used under the same conditions, no cross-linked band at 50 kD was detected. These results indicate that FSY incorporated into hGH causes hGH to irreversibly bind to its receptor.

[0344] It was also examined whether the incorporation of FSY into hGH would affect its biological activity. After hGH binds to its receptor, STAT5 is phosphorylated as a downstream signal through the JAK / STAT pathway, leading to the transcription of genes important for cellular immunity, proliferation, and apoptosis (Waters, MJ. et al. Clin. Exp. Pharmacol. Physiol. 1999, 10760-764). The inventors stimulated BAF3 cells (a cell line with hGH receptor expression) with hGH (WT) and hGH (FSY), and then used Western blot analysis of cell lysates to detect pSTAT5 expression. Fig.12 As shown, hGH(FSY) exhibited the same effect of stimulating STAT5 phosphorylation as hGH(WT), while the negative control using PBS buffer did not produce pSTAT5. Therefore, these results indicate that the incorporation of FSY into hGH does not affect the signal transduction ability of hGH.

[0345] Sequence Listing

[0346] SEQ ID NO: 1 (amino acid sequence of FSYR) MDKKPLNTLISATGLWMSRTGTIHKIKHHEVSRSKIYIEMACGDHLVVNNSRSSRTARALRHHKYRKTCKRCRVSDEDLNKFLTKANEDQTSVKVKVVSAPTRTKKAMPKSVARAPKPLENTEAAQAQPSGSKFSPAIPVSTQESVSVPASVSTSISSISTGATASALVKGNTNPITSMSPAVQASAPALTKSQTDRLEVLLNPKDEISLNSGKPFRELESELLSRRKKDLQQIYAEERENYLGKLEREITRFFVDRGFLEIKSPILIPLEYIERMGIDNDTELSKQIFRVDKNFCLRPMLIPNLYNYLRKLDRALPDPIKIFEIGPCYRKESDGKEHLEEFTMLTFIQMGSGCTRENLESIITDFLNHLGIDFKIVGDSCMVLGDTLDVMHGDLELLSAVVGPIPLDREWGIDKPKIGAGFGLERLLKVKHDFKNIKRAARSESYYNGISTNL*

[0347] SEQ ID NO:2

[0348] SEQ ID NO: 3 (Wild-type amino acid sequence of Methanosarcina mazei PylRS) MDKKPLNTLISATGLWMSRTGTIHKIKHHEVSRSKIYIEMACGDHLVVNNSRSSRTARALRHHKYRKTCKRCRVSDEDLNKFLTKANEDQTSVKVKVVSAPTRTKKAMPKSVARAPKPLENTEAAQAQPSGSKFSPAIPVSTQESVSVPASVSTSISSISTGATASALVKGNTNPITSMSAPVQASAPALTKSQTDRLEVLLNPKDEISLNSGKPFRELESELLSRRKKDLQQIYAEERENYLGKLEREITRFFVDRGFLEIKSPILIPLEYIERMGIDNDTELSKQIFRVDKNFCLRPMLAPNLYNYLRKLDRALPDPIKIFEIGPCYRKESDGKEHLEEFTMLNFCQMGSGCTRENLESIITDFLNHLGIDFKIVGDSCMVYGDTLDVMHGDLELSSAVVGPIPLDREWGIDKPWIGAGFGLERLLKVKHDFKNIKRAARSESYYNGISTNL*

[0349] SEQ ID NO: 4 (Nucleic acid sequence of tRNA Pyl (end) ggaaacctgatcatgtagatcgaatggactctaaatccgttcagccgggttagattcccggggtttccg

[0350] SEQ ID NO: 5 is CTAACAGGAGGAATTAGATCTATGGATAAAAAGCCT

[0351] SEQ ID NO: 6 is GATGATGATGATGATGGTCGACTTACAGGTTAGTAGAA

[0352] SEQ ID NO: 7 is TATGCCATGGATAAAAAGCCTTTG

[0353] SEQ ID NO: 8 is CTATGCTAGCTTACAGGTTAGTAGA

[0354] SEQ ID NO:9 is AACGCGGAACTATCAGTCGCCGGC

[0355] SEQ ID NO:10 is AACAAAGAACTATCAGTCGCCGGC

[0356] SEQ ID NO:11 is AACTGCGAACTATCAGTCGCCGGC

[0357] SEQ ID NO:12 is AACAGCGAACTATCAGTCGCCGGC

[0358] SEQ ID NO:13 is AACACCGAACTATCAGTCGCCGGC

[0359] SEQ ID NO:14 is AACCATGAACTATCAGTCGCCGGC

[0360] SEQ ID NO:15 is GAACGCGTTGTCTACCATGGTATATCTCC

[0361] SEQ ID NO:16 is CCATGGTAGACAACGCGTTCAACTATGAACTATCAGTCGCC

[0362] SEQ ID NO:17 is TATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGGGG

[0363] SEQ ID NO:18 is AACTATGACTAGTCATGACCAACTGAC

[0364] SEQ ID NO:19 is CGCATACGCGTCCGCCTACGCTCTAGCCATCATAGT

[0365] SEQ ID NO:20 is TGGCTAGAGCGTAGGCGGACGCGTATGCGGAAGAGGAAATCCG

[0366] SEQ ID NO:21 is CCAAGCTCAGCTTATTAGTGATGGTGATG

[0367] SEQ ID NO:22 is TATACATATGTCCAAACTCGATCTAAACG

[0368] SEQ ID NO:23 AGCCAAGCTTTTAATGATGATGATGATGATGCCCTTCGTGTAACCCACATTCC

[0369] SEQ ID NO:24 is GAACATCGATTAGAACCCTGGCAC

[0370] SEQ ID NO:25 is AGTTTTGCAACGGTCAGTTTG

Claims

1. A pyrrolysyl-tRNA synthetase having at least 90% sequence identity to SEQ ID NO: 1; wherein SEQ ID NO: 1 comprises an isoleucine at a position corresponding to position 302 of SEQ ID NO: 1, a threonine at a position corresponding to position 346 of SEQ ID NO: 1, an isoleucine at a position corresponding to position 348 of SEQ ID NO: 1, a leucine at a position corresponding to position 384 of SEQ ID NO: 1, and a lysine at a position corresponding to position 417 of SEQ ID NO:

1.

2. A vector comprising a nucleic acid sequence encoding the pyrrolysyl-tRNA synthetase of claim 1.

3. A cell comprising the pyrrolysyl-tRNA synthetase of claim 1.

4. A cell comprising the vector of claim 2.

5. A cell comprising the pyrrolysyl-tRNA synthetase of claim 1 and fluorosulfate-L-tyrosine having the formula:

6. A complex comprising the pyrrolysyl-tRNA synthetase of claim 1 and fluorosulfate-L-tyrosine having the formula:

7. A cell comprising the complex of claim 6.

8. A cell comprising fluorosulfate-L-tyrosine of the formula:

9. A method of forming a protein comprising fluorosulfated-L-tyrosine in a cell in vivo, the method comprising contacting in the cell: (a) pyrrolysyl-tRNA synthetase, and (b) Fluorosulfate-L-tyrosine having the formula: Thus, a protein containing fluorosulfate-L-tyrosine is produced, wherein the protein containing fluorosulfate-L-tyrosine has an amino acid side chain with the following structure:

10. The method of claim 9, wherein the pyrrolysyl-tRNA synthetase has at least 90% sequence identity to SEQ ID NO: 1; wherein SEQ ID NO: 1 comprises an isoleucine at a position corresponding to position 302 of SEQ ID NO: 1, a threonine at a position corresponding to position 346 of SEQ ID NO: 1, an isoleucine at a position corresponding to position 348 of SEQ ID NO: 1, a leucine at a position corresponding to position 384 of SEQ ID NO: 1, and a lysine at a position corresponding to position 417 of SEQ ID NO:

1.

11. A mammalian cell comprising a protein comprising fluorosulfate-L-tyrosine produced by the method of claim 9 or 10.

12. A biomolecule conjugate comprising a first biomolecule moiety conjugated to a second biomolecule moiety via a bioconjugate linker, wherein the bioconjugate linker has the formula:

13. The biomolecule conjugate of claim 12, wherein the biomolecule conjugate has the formula: R 1 -L 1 -A-X 1 -L 2 -R 2 ; in: A is the bioconjugate linker; R 1 It is the first biomolecule part; R 2 is the second biomolecule portion; L 1 is a bond or first covalent linker; L 2 is a bond or a second covalent linker; and X 1 Yes – NR 5 -, -O-, -S-, or wherein Ring A is a substituted or unsubstituted heteroarylene or a substituted or unsubstituted heterocycloalkylene, and wherein the nitrogen in A is attached to the bioconjugate linker; and R 5 is hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl or substituted or unsubstituted heteroaryl; Where R 1 and R 2 Optionally linked together to form an intramolecularly conjugated biomolecule conjugate.

14. A method of forming the biomolecule conjugate of claim 12, the method comprising: (i) contacting the FSY moiety within the first biomolecule moiety with a compound comprising a second biomolecule moiety, wherein the second biomolecule is reactive with the FSY moiety; thereby forming a biomolecule conjugate having an intermolecular linker.

15. The method of claim 14, further comprising, prior to the contacting in step (i), exposing the biomolecule, pyrrolysyl-tRNA synthetase, tRNA Pyl and contacting with fluorosulfate-L-tyrosine having the formula: To form FSY biomolecules.

16. A protein of formula (I), formula (II) or formula (III): Where R 1 and R 2 are each independently a peptidyl moiety; and wherein R 1 and R 2 The proteins are optionally linked together to form an intramolecular conjugate.

17. A complex comprising a first biomolecule and a second biomolecule, wherein the first biomolecule comprises an unnatural amino acid adjacent to a lysine, histidine, or tyrosine of the second biomolecule; wherein the unnatural amino acid has a side chain of the formula:

18. A cell comprising the protein of claim 16 or 17.

Images