P450 enzyme mutant, fusion protein and application thereof

Abstract

The invention provides a P450 enzyme mutant, a fusion protein and application thereof, the mutant is selected from any one of the following items: the 282nd site and the 387th site of a sequence shown as SEQ ID NO: 1 are mutated into leucine, the 286th site and the 391th site of a sequence shown as SEQ ID NO: 2 are mutated into leucine, the 290th site and the 395th site of a sequence shown as SEQ ID NO: 3 are mutated into leucine, and the 282nd site and the 387th site of a sequence shown as SEQ ID NO: 4 are mutated into leucine. The 286th site and the 391st site of the sequence as shown in SEQ ID NO: 5 are mutated into leucine. The P450 enzyme mutant can catalyze intramolecular C-S bonding, and specific synthesis of high-purity sulfur-containing compounds is achieved by improving the product selectivity of P450 enzyme.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a P450 enzyme mutant, a fusion protein and applications thereof. Background Art

[0002] Organosulfur compounds are important components and structural skeletons of many natural metabolites, drugs and functional materials. Traditional chemical methods, such as cross-coupling reactions involving transition metals, usually face the challenges of harsh reaction conditions, low catalytic efficiency and poor sustainability when synthesizing C-S bonds. In contrast, the bioenzymatic method can greenly synthesize compounds containing C-S bonds under mild conditions. As a "golden catalyst", cytochrome P450 enzyme has the advantages of broad substrate spectrum and diverse catalytic functions, and has been widely studied and applied in many fields such as drug synthesis and fine chemical production.

[0003] The electron transfer system is required in the process of P450 enzyme catalysis, and it is divided into Class I-X according to the electron transfer system. Among them, for example: Class I consists of three parts: heme, ferredoxin containing iron-sulfur clusters, and ferredoxin reductase containing FAD, and the typical representative is CYP101A1; Class II consists of two parts: Heme and cytochrome P450 enzyme reductase containing FAD / FMN; Class VII is a single-component catalytic system that is a natural fusion of Heme and a reducing partner protein containing FMN / Fe2S2, such as P450RhF. Since Narhi and Fulco identified the P450 BM3 self-sufficient catalytic system in 1986, P450 enzyme fusion proteins have been widely studied and applied. Protein fusion engineering can not only improve the catalytic efficiency of P450 enzymes, but also may improve the stability of proteins. Researchers usually fuse the heme domain and the reductase domain of P450 enzymes to obtain artificial self-sufficient P450 enzymes.

[0004] In recent years, research on key P450 enzymes in the synthesis pathway of sulfur-containing compounds has made some progress, such as glaucocyanin, phytoalexin and innovomycin. Among them, P450 TleB enzyme can catalyze the formation of C-S bond within (S)-N-((S)-1-hydroxy-3-(1H-indol-3-yl)propan-2-yl)-2-mercapto-3-methylbutanamide molecules, thereby obtaining two sulfur-containing indole lactam derivatives. However, there are still few P450 enzymes reported that can catalyze the synthesis of C-S bonds. In addition, the natural TleB enzyme has a mixture problem when catalyzing (S)-N-((S)-1-hydroxy-3-(1H-indol-3-yl)propan-2-yl)-2-mercapto-3-methylbutanamide to generate products, which makes it difficult to specifically synthesize high-purity sulfur-containing indole lactam derivatives by enzymatic method. Therefore, in order to solve this problem, it is necessary to develop new P450 enzymes or their mutants with high product specificity. This will help to further analyze the molecular mechanism of P450 TleB enzyme selectively catalyzing the formation of CS bonds and provide new ideas and methods for the synthesis of sulfur-containing compounds. Summary of the invention

[0005] In order to solve the problems existing in the background technology, the present invention provides a P450 enzyme mutant and its application, wherein the mutant can catalyze the synthesis of CS bonds in substrate molecules and can significantly improve the selectivity of the catalytic reaction.

[0006] The technical solution of the present invention to solve the above technical problems is as follows:

[0007] In a first aspect, the present invention provides a P450 enzyme mutant, wherein the mutant is selected from any one of the following:

[0008] (a) the amino acid sequence corresponds to the P450 enzyme shown in SEQ ID NO: 1, with the amino acid at position 282 mutated to leucine and the amino acid at position 387 mutated to leucine;

[0009] (b) an amino acid sequence corresponding to the P450 enzyme shown in SEQ ID NO: 2, with the amino acid at position 286 mutated to leucine and the amino acid at position 391 mutated to leucine;

[0010] (c) an amino acid sequence corresponding to the P450 enzyme shown in SEQ ID NO: 3, with the amino acid at position 290 mutated to leucine and the amino acid at position 395 mutated to leucine;

[0011] (d) an amino acid sequence corresponding to the P450 enzyme shown in SEQ ID NO: 4, with the amino acid at position 282 mutated to leucine and the amino acid at position 387 mutated to leucine;

[0012] (e) The amino acid sequence corresponds to the P450 enzyme shown in SEQ ID NO: 5, with the amino acid at position 286 mutated to leucine and the amino acid at position 391 mutated to leucine.

[0013] Furthermore, the amino acid at position 234 of the amino acid sequence shown in SEQ ID NO:1 mutates to phenylalanine or histidine, the amino acid at position 238 of the amino acid sequence shown in SEQ ID NO:2 mutates to phenylalanine or histidine, the amino acid at position 242 of the amino acid sequence shown in SEQ ID NO:3 mutates to phenylalanine or histidine, the amino acid at position 234 of the amino acid sequence shown in SEQ ID NO:4 mutates to phenylalanine or histidine, and the amino acid at position 238 of the amino acid sequence shown in SEQ ID NO:5 mutates to phenylalanine or histidine.

[0014] The P450 enzymes with amino acid sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5 are TleB (CYP107E48), CYP107E49, CYP107E50, CYP107E51 and CYP107E52, respectively.

[0015] In one or more embodiments, the nucleotide sequences of TleB (CYP107E48), CYP107E49, CYP107E50, CYP107E51 and CYP107E52 are shown in SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10 and SEQ ID NO:11, respectively.

[0016] Furthermore, the mutant may also be selected from a polypeptide formed by adding a tag sequence, an enzyme cleavage site sequence or a signal sequence to one or both ends of any one of the amino acid sequences (a) to (e).

[0017] In a second aspect, the present invention provides a P450 enzyme mutant fusion protein, comprising:

[0018] (i) a fusion protein formed by connecting the CYP116B46 reductase domain to the C-terminus of the above-mentioned P450 enzyme mutant;

[0019] (ii) A polypeptide formed by adding a tag sequence, a restriction site sequence, or a signal sequence to one or both ends of the amino acid sequence of the fusion protein described in (i).

[0020] Furthermore, the amino acid sequence of the CYP116B46 reductase domain is shown in SEQ ID NO:6.

[0021] In a third aspect, the present invention provides a polynucleotide encoding the above-mentioned P50 enzyme mutant or the above-mentioned P450 enzyme mutant fusion protein.

[0022] In a fourth aspect, the present invention provides an expression vector comprising the above-mentioned polynucleotide.

[0023] In a fifth aspect, the present invention provides a genetically engineered host cell comprising the above-mentioned expression vector.

[0024] The host cell includes a prokaryotic cell or a eukaryotic cell. In one or more embodiments, the host cell is Escherichia coli (E. coli), Corynebacterium glutamicum, Bacillus subtilis, Saccharomyces cerevisiae, Pichia pastoris, Aspergillus oryzae; more preferably, the host cell is Escherichia coli (E. coli).

[0025] In a sixth aspect, the present invention provides the use of the above-mentioned P450 enzyme mutant, P450 enzyme mutant fusion protein, expression vector or genetically engineered host cell in catalyzing CS bonding within a substrate molecule.

[0026] Preferably, it is used to catalyze the (S)-N-((S)-1-hydroxy-3-(1H-indol-3-yl)propan-2-yl)-2-mercapto-3-methylbutanamide substrate to generate a product containing a CS bond and significantly improve the selectivity of the generated product P2, wherein the structural formula of the substrate is:

[0027] The catalytic reaction is as follows:

[0028]

[0029] In one or more embodiments, when the P450 enzyme mutant fusion protein is used for substrate catalysis, NADP is added to the reaction system. + , glucose and glucose dehydrogenase (GDH);

[0030] In another or more embodiments, when the P450 enzyme mutant fusion protein is used for substrate catalysis, NADPH is added to the reaction system;

[0031] In a preferred embodiment, a reducing agent such as TCEP may be added to the reaction system to avoid oxidation of the substrate.

[0032] Compared with the P450 enzyme mutant fusion protein, when the P450 enzyme mutant is used for substrate catalysis, it is necessary to additionally add ferredoxin (Fdx) containing an iron-sulfur cluster and ferredoxin reductase (Fdr) containing FAD.

[0033] The beneficial effects of the present invention are:

[0034] The P450 enzyme mutant provided by the present invention can catalyze the formation of intramolecular CS bonds and improve the product selectivity of the P450 enzyme, thereby realizing the specific synthesis of high-purity sulfur-containing indole lactam derivatives. When the P450 enzyme mutant of the present invention is used to catalyze the substrate (S)-N-((S)-1-hydroxy-3-(1H-indol-3-yl)propan-2-yl)-2-mercapto-3-methylbutanamide, the selectivity of the catalytic synthesis product P2 can be improved, and even a single product P2 can be catalyzed to be generated, and the yield of the product P2 is higher than 89%;

[0035] When the P450 enzyme mutant is fused with the CYP116B46 reductase domain to form a P450 enzyme mutant fusion protein for enzyme catalysis reaction, no additional reductase needs to be added, thus achieving self-sufficiency, improving the catalytic efficiency of the enzyme and improving the stability of the enzyme. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 HPLC chromatogram of the catalytic products of TleB and TleB-CYP116B46 in Example 6 of the present invention;

[0037] Figure 2 HPLC chromatogram of the catalytic products of TleB TPM and TleB TPM-CYP116B46 in Example 6 of the present invention. DETAILED DESCRIPTION

[0038] The principles and features of the present invention are described below in conjunction with the accompanying drawings and specific embodiments. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.

[0039] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0040] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the invention pertains. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention.

[0041] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present application description and examples are exemplary only.

[0042] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0043] In the present invention, the terms "P450 enzyme TleB" or "TleB" or "CYP107E48" have the same meaning and can be used interchangeably herein, and are all wild-type TleB enzymes with an amino acid sequence as shown in SEQ ID NO: 1, which are derived from Streptomyces blastmyceticus and have a publication number of BAP27940.1 in NCBI. The enzyme can catalyze the synthesis of intramolecular CS bonds and catalyze the substrate (S)-N-((S)-1-hydroxy-3-(1H-indol-3-yl)propan-2-yl)-2-mercapto-3-methylbutana mide to generate products P1 and P2, wherein the structural formulas of the substrate, product P1 and product P2 are respectively:

[0044] Substrate

[0045] Product P1

[0046] Product P2

[0047] The yield ratios of the two products P1 and P2 generated by the catalysis are 60% and 40% respectively.

[0048] The P450 enzyme mutant of the present invention can be a product of chemical synthesis, or can be produced from a prokaryotic or eukaryotic host using recombinant technology.

[0049] In the present invention, the terms "CYP116B46" or "CYP116B46 reductase domain" have the same meaning and can be used interchangeably herein, and both refer to the reductase domain of CYP116B46 with an amino acid sequence as shown in SEQ ID NO:6, such as TleB-CYP116B46 is a fusion protein formed by TleB and the reductase domain of CYP116B46, CYP107E49-CYP116B46 is a fusion protein formed by CYP107E49 and the reductase domain of CYP116B46, and the like.

[0050] Using bioinformatics methods, sequence retrieval was performed in the NCBI database, and four P450 enzymes were analyzed and mined, namely CYP107E49, CYP107E50, CYP107E51, and CYP107E52. These four P450 enzymes were derived from Kitasatospora humi, Streptomyces clavuligerus, Streptomyces alkaliphilus, and Streptomyces luteoverticillatus (their publication numbers in NCBI are WP_230051513.1, WP_065757225.1, WP_182604341.1, and WP_126913049.1, respectively), and their amino acid sequences are SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID As shown in NO:5, the sequence identities with TleB are 83.59%, 84.09%, 81.66% and 79.34% respectively, with only about 100 amino acids not being exactly the same. The 40 amino acids within are basically the same. According to the naming committee of P450 enzymes, TleB and four P450 enzymes belong to the CYP107E family, and TleB is named CYP107E48.

[0051] The four P450 enzymes CYP107E49, CYP107E50, CYP107E51, and CYP107E52 can also catalyze the substrate (S)-N-((S)-1-hydroxy-3-(1H-indol-3-yl)propan-2-yl)-2-mercapto-3-methylbutanamide to generate carbon-sulfur heterocyclic products P1 and P2. Among them, CYP107E49 catalyzes the production of P1 and P2 in a ratio of 67% and 33%, CYP107E50 catalyzes the production of P1 and P2 in a ratio of 69% and 31%, CYP107E51 catalyzes the production of P1 and P2 in a ratio of 65% and 35%, and CYP107E52 catalyzes the production of P1 and P2 in a ratio of 67% and 33%.

[0052] In order to improve the catalytic activity of TleB and enhance the product selection specificity, the inventors first obtained the three-dimensional structure of TleB through the PDB database (PDB: 6J83), and then used Yasara to molecularly dock the TleB structure with the substrate molecule, determined the hotspot amino acids around the active pocket and some amino acid sites that may interact, and through rational analysis and semi-rational design, used the means of directed evolution to perform site-directed mutagenesis and saturation mutagenesis on these amino acids to construct a mutant library, and finally screened out mutants TleB DPM, TleB TPM1 and TleB TPM2, wherein the 282nd amino acid of the mutant TleB DPM mutated to leucine, and the 387th amino acid mutated to leucine; the 282nd amino acid of the mutant TleB TPM1 mutated to leucine, the 387th amino acid mutated to leucine, and the 234th amino acid mutated to phenylalanine; the 282nd amino acid of the mutant TleB TPM2 mutated to leucine, the 387th amino acid mutated to leucine, and the 234th amino acid mutated to histidine. The mutants TleB DPM, TleB TPM1 and TleB TPM2 can significantly increase the yield of product P2, and the selectivity for product P2 is 74%, 90% and 77%, respectively.

[0053] When TleB and its mutants catalyze the above reaction, additional reductase (ferredoxin (Fdx) containing an iron-sulfur cluster and ferredoxin reductase (Fdr) containing FAD) needs to be added. In order to achieve self-sufficiency in the catalytic reaction, the inventors prepared a fusion protein combining the above mutants with the reductase domain of CYP116B46, wherein the amino acid sequence of the reductase domain of CYP116B46 is shown in SEQ ID NO:5. Specifically, the inventors performed protein fusion on the basis of the original wild-type TleB, used T5 exonuclease for Gibson assembly, and connected the reductase domain of CYP116B46 (CYP116B46) to the C-terminus of TleB to obtain TleB-CYP116B46. In this way, electrons are directly transferred to the active center of TleB through CYP116B46, making TleB-CYP116B46 self-sufficient without the need to add reductase to participate in the reaction, and at the same time facilitating protein purification and mutant library screening.

[0054] In one or more embodiments, when the P450 enzyme mutant fusion protein is used for substrate catalysis, NADP is added to the reaction system. + , glucose and glucose dehydrogenase (GDH);

[0055] In another or more embodiments, when the P450 enzyme mutant fusion protein is used for substrate catalysis, NADPH is added to the reaction system;

[0056] In a preferred embodiment, a reducing agent such as TCEP may be added to the reaction system to avoid oxidation of the substrate.

[0057] Compared with the P450 enzyme mutant fusion protein, when the P450 enzyme mutant is used for substrate catalysis, it is necessary to additionally add ferredoxin (Fdx) containing an iron-sulfur cluster and ferredoxin reductase (Fdr) containing FAD.

[0058] Preferably, the catalytic reaction temperature is 25°C.

[0059] The mutation sites of the fusion protein are consistent with the mutation of TleB. The amino acid at position 282 of the fusion protein TleB-CYP116B46 mutates to leucine, and the amino acid at position 387 mutates to leucine to form the mutant TleB DPM-CYP116B46. The amino acid at position 282 of the fusion protein TleB-CYP116B46 mutates to leucine, the amino acid at position 387 mutates to leucine, and the amino acid at position 234 mutates to phenylalanine to form the mutant TleB TPM1-CYP116B46. The amino acid at position 282 of the fusion protein TleB-CYP116B46 mutates to leucine, the amino acid at position 387 mutates to leucine, and the amino acid at position 234 mutates to histidine to form the mutant TleB TPM2-CYP116B46. All of them can significantly increase the yield of the product P2, and the selectivity for the product P2 is 77%, 95% and 81%, respectively.

[0060] At the same time, the inventors used AlphaFold to construct 3D models of four P450 enzymes CYP107E49, CYP107E50, CYP107E51, and CYP107E52, and compared them with the sequence and spatial structure of TleB, respectively, to find out the sites of the four enzymes corresponding to the key sites I234, I282, and Q387 of TleB, and then performed site-directed mutagenesis, and finally obtained the mutants CYP107E49 DPM (mutation sites: I286L, I391L), CYP107E49 TPM1 (mutation sites: I238F, I286L, I391L), CYP107E49TPM2 (mutation sites: I238H, I286L, I391L), CYP107E50 DPM (mutation sites: I290L, Q395L), CYP107E50 TPM1 (mutation site: I242F, I290L, Q395L), CYP107E50 TPM2 (mutation site: I242H, I290L, Q395L), CYP107E51 DPM (mutation site: I282L, I387L), CYP107E51 TPM1 (mutation site: I234F, I282L, I387L), CYP107E51 TPM2 (mutation site: I234H, I282L, I387L), CYP107E52DPM (mutation site: I286L, I391L), CYP107E52 TPM1 (mutation sites: I238F, I286L, I391L), CYP107E52TPM2 (mutation sites: I238H, I286L, I391L), the mutants obtained can significantly increase the yield of product P2.

[0061] The above-mentioned TleB DPM, TleB TPM1, TleB TPM2, CYP107E49 DPM, CYP107E49TPM1, CYP107E49 TPM2, CYP107E50 DPM, CYP107E50 TPM1, CYP107E50 TPM2, CYP107E51 DPM, CYP107E51 TPM1, CYP107E51 TPM2, CYP107E52 DPM, CYP107E52 TPM1, and CYP107E52 TPM2 all belong to the "P450 enzyme mutants" described in the present invention.

[0062] Similarly, the inventors combined the mutants CYP107E49 DPM, CYP107E49 TPM1, CYP107E49 TPM2, CYP107E50 DPM, CYP107E50 TPM1, CYP107E50TPM2, CYP107E51 DPM, CYP107E51 TPM1, CYP107E51 TPM2, CYP107E52 DPMM, CYP107E52 TPM1, and CYP107E52 TPM2 with the reducing domain of CYP116B46, respectively, to prepare fusion proteins CYP107E49DPM-CYP116B46, CYP107E49 TPM1-CYP116B46, CYP107E49TPM2-CYP116B46, and CYP107E50 DPM-CYP116B46, CYP107E50TPM1-CYP116B46, CYP107E50 TPM2-CYP116B46, CYP107E51DPM-CYP116B46, CYP107E51 TPM1-CYP116B46, CYP107E51TPM2-CYP116B46, CYP107E52 DPM-CYP116B46, CYP107E52TPM1-CYP116B46 and CYP107E52 TPM2-CYP116B46, the obtained P450 enzyme mutant fusion proteins can significantly increase the yield of product P2.

[0063] The above TleB DPM-CYP116B46, TleB TPM1-CYP116B46, TleB TPM2-CYP116B46, CYP107E49 DPM-CYP116B46, CYP107E49TPM1-CYP116B46, CYP107E49 TPM2-CYP116B46, CYP107E50DPM-CYP116B46, CYP107E50 TPM1-CYP116B46, CYP107E50TPM2-CYP116B46, CYP107E51 DPM-CYP116B46, CYP107E51TPM1-CYP116B46, CYP107E51 TPM2-CYP116B46, CYP107E52DPM-CYP116B46, CYP107E52 TPM1-CYP116B46 and CYP107E52TPM2-CYP116B46 all belong to the "P450 enzyme mutant fusion protein" described in the present invention.

[0064] In the present invention, the term "P450 enzyme mutant" should also include: deletion, insertion or substitution of several amino acids, and addition or deletion of one or several amino acids at the C-terminus and / or N-terminus, but the derivatives formed by maintaining the activity and function of the P450 enzyme of the present invention, for example, in the art, when replacing with amino acids with similar or similar properties, it usually does not change the function of the protein, and adding one or several amino acids at the C-terminus and / or N-terminus, such as adding a tag sequence, a restriction site sequence, a signal sequence or a secretion signal sequence, usually does not change the function of the resulting protein. However, in these derivatives, the following mutations exist: the amino acid at position 282 of the amino acid sequence shown in SEQ ID NO:1 mutates to leucine, and the amino acid at position 387 mutates to leucine; or the amino acid at position 286 of the amino acid sequence shown in SEQ ID NO:2 mutates to leucine, and the amino acid at position 391 mutates to leucine; or the amino acid at position 290 of the amino acid sequence shown in SEQ ID NO:3 mutates to leucine, and the amino acid at position 395 mutates to leucine; or the amino acid at position 282 of the amino acid sequence shown in SEQ ID NO:4 mutates to leucine, and the amino acid at position 387 mutates to leucine; or the amino acid at position 286 of the amino acid sequence shown in SEQ ID NO:5 mutates to leucine, and the amino acid at position 391 mutates to leucine. More preferably, the amino acid at position 234 of the amino acid sequence shown in SEQ ID NO:1 mutates to phenylalanine or histidine, the amino acid at position 238 of the amino acid sequence shown in SEQ ID NO:2 mutates to phenylalanine or histidine, the amino acid at position 242 of the amino acid sequence shown in SEQ ID NO:3 mutates to phenylalanine or histidine, the amino acid at position 234 of the amino acid sequence shown in SEQ ID NO:4 mutates to phenylalanine or histidine, and the amino acid at position 238 of the amino acid sequence shown in SEQ ID NO:5 mutates to phenylalanine or histidine.

[0065] In the present invention, the term "P450 enzyme mutant" should also include: a derived protein that retains its protein activity and has an amino acid sequence identity of more than 80%, preferably more than 85%, more preferably more than 90%, further more preferably more than 95%, such as more than 98% or more than 99% with the amino acid sequence of the P450 enzyme mutant. Similarly, in these derived proteins, the mutations described above in the present invention must exist: the amino acid at position 282 of the amino acid sequence shown in SEQ ID NO:1 mutates to leucine, and the amino acid at position 387 mutates to leucine; or the amino acid at position 286 of the amino acid sequence shown in SEQ ID NO:2 mutates to leucine, and the amino acid at position 391 mutates to leucine; or the amino acid at position 290 of the amino acid sequence shown in SEQ ID NO:3 mutates to leucine, and the amino acid at position 395 mutates to leucine; or the amino acid at position 282 of the amino acid sequence shown in SEQ ID NO:4 mutates to leucine, and the amino acid at position 387 mutates to leucine; or the amino acid at position 286 of the amino acid sequence shown in SEQ ID NO:5 mutates to leucine, and the amino acid at position 391 mutates to leucine. More preferably, the amino acid at position 234 of the amino acid sequence shown in SEQ ID NO:1 mutates to phenylalanine or histidine, the amino acid at position 238 of the amino acid sequence shown in SEQ ID NO:2 mutates to phenylalanine or histidine, the amino acid at position 242 of the amino acid sequence shown in SEQ ID NO:3 mutates to phenylalanine or histidine, the amino acid at position 234 of the amino acid sequence shown in SEQ ID NO:4 mutates to phenylalanine or histidine, and the amino acid at position 238 of the amino acid sequence shown in SEQ ID NO:5 mutates to phenylalanine or histidine.

[0066] The present invention also provides polynucleotides encoding the above-mentioned P450 enzyme mutants and P450 enzyme mutant fusion proteins. The polynucleotides of the present invention can be in the form of DNA or RNA, the DNA form includes genomic DNA, cDNA or artificially synthesized DNA, and the DNA can be a coding strand or a non-coding strand.

[0067] The present invention also provides a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or the coding sequence of the P450 enzyme mutant or the P450 enzyme mutant fusion protein.

[0068] The polynucleotide sequence of the present invention can be used to express or produce P450 enzyme mutants or P450 enzyme mutant fusion proteins through conventional recombinant DNA technology. Generally speaking, the following steps are involved: (1) transforming or transducing suitable host cells with the polynucleotide of the P450 enzyme mutant or P450 enzyme mutant fusion protein of the present invention or a recombinant expression vector containing the polynucleotide; (2) culturing the host cells in a suitable culture medium; (3) isolating and purifying the protein from the culture medium or cells.

[0069] In the present invention, the polynucleotide sequence of the P450 enzyme mutant or the P450 enzyme mutant fusion protein can be inserted into a recombinant expression vector. As long as it can be stably replicated in the host, any plasmid and vector can be used. An important feature of the expression vector is that it usually contains a replication origin, a promoter, a marker gene and a translation control element. Methods well known to those skilled in the art can be used to construct an expression vector containing a P450 enzyme mutant or a P450 enzyme mutant fusion protein encoding DNA sequence and a suitable transcription / translation control signal. The DNA sequence can be effectively connected to an appropriate promoter of the expression vector to guide mRNA synthesis. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. The expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selecting transformed host cells.

[0070] The vector containing the above-mentioned appropriate DNA sequence and an appropriate promoter or control sequence can be used to transform appropriate host cells to enable them to express proteins.

[0071] In the present invention, the host cell can be any microorganism suitable for expressing P450 enzymes or P450 enzyme mutants or P450 enzyme mutant fusion proteins, including bacteria and fungi, preferably Escherichia coli (E. coli), Corynebacterium glutamicum, Bacillus subtilis, Saccharomyces cerevisiae, Pichia pastoris, Aspergillus oryzae, more preferably Escherichia coli. In one or more of the following embodiments, Escherichia coli BL21 (DE3) is used.

[0072] In the present invention, a polynucleotide sequence (coding sequence) encoding a P450 enzyme mutant or a P450 enzyme mutant fusion protein can also be applied to the present invention, wherein the coding sequences of TleB, CYP107E49, CYP107E50, CYP107E51, CYP107E52 and CYP116B46 reductase domains are shown in SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11 and SEQ ID NO:12, respectively, and the coding sequence of the P450 enzyme mutant or the P450 enzyme mutant fusion protein can also be a degenerate variant of the polynucleotide sequence provided by the present invention, and the degenerate variant refers to a nucleic acid sequence that encodes the P450 enzyme mutant or the P450 enzyme mutant fusion protein in the present invention, but is different from the nucleotide sequence in the examples of the present invention.

[0073] It is well known that the expression results of the same nucleotide sequence in different microbial hosts are often very different. In order to optimally express P450 enzymes or their mutants in Escherichia coli, which is the most commonly used in genetic engineering, the expression genes of these enzymes can be codon optimized.

[0074] Codon optimization is a kind of technology that can be used for maximizing protein expression in organism by increasing the translation efficiency of gene of interest.Different organisms usually show the special preference for one of some codons of the same amino acid of coding due to mutation tendency and natural selection.For example, in fast-growing microorganisms such as Escherichia coli, the composition of its genome tRNA library separately is reflected by optimizing codon.Therefore, in fast-growing microorganisms, the low-frequency codon of amino acid can be replaced with codons for the same amino acid but with high frequency.Therefore, the expression of optimized DNA sequence is improved in fast-growing microorganisms.

[0075] Those skilled in the art will appreciate how to select appropriate vectors, promoters, enhancers and host cells. The recombinant cells (host cells) established by the present invention can be cultured using conventional methods to express the polypeptide encoded by the gene of the present invention. Depending on the host cell used, the culture medium used in the culture can be selected from various conventional culture media. Culture is carried out under conditions suitable for the growth of the host cells. After the host cells grow to an appropriate cell density, the promoter selected is induced using a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

[0076] During expression, the P450 enzyme mutant or P450 enzyme mutant fusion protein of the present invention can be expressed in cells and secreted outside the cells. If necessary, the recombinant protein can be separated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of these methods include but are not limited to: conventional renaturation treatment, treatment with protein precipitants (salting out method), centrifugation, osmotic breaking, ultrasonic treatment, high-speed centrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography techniques and combinations of these methods.

[0077] The P450 enzyme mutant and the P450 enzyme mutant fusion protein of the present invention can be used to catalyze the formation of CS bonds within a molecule. The enzyme includes purified enzymes, crude enzymes, and the like.

[0078] The substrate is When the P450 enzyme mutant and the P450 mutant fusion protein of the present invention can improve the selectivity of the catalytic production of the product P2, and can be used for selectively catalyzing the synthesis of the product P2, the structural formula of P2 is:

[0079] It should be understood that host cells expressing P450 enzyme mutants or P450 enzyme mutant fusion proteins or their expression products (such as cleavage products or secretion products) also have this use.

[0080] In one or more embodiments, when the P450 enzyme mutant fusion protein is used for substrate catalysis, NADP is added to the reaction system. + , glucose and glucose dehydrogenase (GDH);

[0081] In one or more embodiments, when the P450 enzyme mutant fusion protein is used for substrate catalysis, NADP is added to the reaction system. + , glucose-6-phosphate and glucose-6-phosphate dehydrogenase;

[0082] In a preferred embodiment, a reducing agent such as TCEP may be added to the reaction system to avoid oxidation of the substrate.

[0083] Compared with the P450 enzyme mutant fusion protein, when the P450 enzyme mutant is used for substrate catalysis, it is necessary to additionally add ferredoxin (Fdx) containing an iron-sulfur cluster and ferredoxin reductase (Fdr) containing FAD.

[0084] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0085] The molecular biology experiments in the following examples include plasmid construction, enzyme digestion, ligation, competent cell preparation, transformation, culture medium preparation, etc., mainly with reference to "Molecular Cloning Laboratory Guide" (3rd Edition), edited by J. Sambrook et al., Science Press, and the specific experimental conditions can be determined by simple experiments when necessary. PCR amplification experiments are carried out according to the reaction conditions or kit instructions provided by the plasmid or DNA template supplier, and can be adjusted by simple experiments when necessary.

[0086] Materials and Methods

[0087] LB medium: 10g / L tryptone, 5g / L yeast extract, 10g / L sodium chloride, pH 7.2. (LB solid medium plus 20g / L agar powder)

[0088] TB medium: 24g / L yeast extract, 12g / L tryptone, 16.43g / L K2HPO4.3H2O, 2.31g / L KH2PO4, 5g / L glycerol, pH 7.0-7.5. (TB solid medium plus 20g / L agar powder)

[0089] Substrate Product P1 Product P2 Detection method:

[0090] HPLC was used to analyze and determine the substrate, product P1 and product P2, instrument model: SHIMADZU LC-2030Plus; column model: Yuexu Xtimate C18 (4.6×300mm, 5μm), and specific conditions were: mobile phase: methanol (0.1% formic acid), ultrapure water; 0-15min: methanol (0.1% formic acid) concentration increased from 60% to 90%; 15-16min: 90% methanol (0.1% formic acid); 16-20min: 60% methanol (0.1% formic acid); flow rate: 1.0mL / min; column temperature: 25°C; detection wavelength: 280nm; detection time: 20min; injection volume: 20μL.

[0091] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. For ease of description, in the embodiments, the strain number, plasmid number, enzyme number, and enzyme encoding gene number may share one number, which is easily understood by those skilled in the art, that is, the same number may refer to different biological forms in different environments.

[0092] Example 1 Construction of TleB / TleB-CYP116B46 genetically engineered bacteria

[0093] The amino acid sequence of the P450 enzyme TleB is shown in SEQ ID NO:1, and its encoding nucleotide sequence is shown in SEQ ID NO:7. The amino acid sequence of the reducing domain of CYP116B46 is shown in SEQ ID NO:6, and its encoding nucleotide sequence is shown in SEQ ID NO:12.

[0094] The plasmid pET28a-TleB carrying the TleB gene and the plasmid pET28a-CYP116B46 carrying the reducing domain of CYP116B46 were synthesized.

[0095] The amplification primers for pET28a-TleB are:

[0096] Primer pET28a-TleB-F: AAGCTTGCGGCCGCACT (SEQ ID NO: 13)

[0097] Primer pET28a-TleB-R: CCACAGAACCGGCAGTTCCAGC (SEQ ID NO: 14)

[0098] The primers for amplification of the reduced domain of CYP116B46 are:

[0099] Primer CYP116B46-F1: CTGCCGGTTCTGTGGGACCCGGCGCAGAAT CCGGAAC (SEQ ID NO: 15)

[0100] Primer CYP116B46-R1: TGCGGCCGCAAGCTTTTATCAGGTCCAGAAC CAGAC (SEQ ID NO: 16)

[0101] E.coli BL21(DE3) / pET28a-TleB and E.coli BL21(DE3) / pET28a-CYP116B46 were cultured in LB medium at 37°C and 200 rpm for 12-16 hours, then the cells were collected and genomic DNA was extracted using the TransZolTM UP Plus Genomic Mini Kit. pET28a-TleB was used as a template and pET28a-TleB-F and pET28a-TleB-R were used as primers to amplify pET28a-TleB; pET28a-CYP116B46 was used as a template and CYP116B46-F1 and CYP116B46-R1 were used as primers to amplify the CYP116B46 reduction domain sequence.

[0102] PCR reaction system (50 μL): 1-50 ng template, 2 μL (10 μM) of each upstream and downstream primer, 25 μL of Prime STARMax DNA polymerase (2×), and sterile water to make up to 50 μL.

[0103] PCR amplification procedure: (1) pre-denaturation at 98°C for 3 min; (2) denaturation at 98°C for 10 s; (3) annealing at 58°C for 5 sec; (4) extension at 72°C for 80 s / 20 s, using pET28a-TleB as template, extension for 80 s, using pET28a-CYP116B46 as template, extension for 20 s; steps (2) to (4) were repeated 30 times, and finally extension was performed at 72°C for 5 min, and the PCR product was stored at 12°C.

[0104] The two PCR products obtained by amplification were detected by 1% agarose gel electrophoresis and recovered by gel cutting using an OMEGA gel recovery kit. The two recovered PCR products were digested by T5 exonuclease for 3 to 5 minutes to obtain the recombinant expression vector pET28a-TleB-CYP116B46. Then pET28a-TleB-CYP116B46 was transformed into DH5α competent cells and evenly spread on LB solid culture medium containing 50 μg / mL kanamycin, and inverted overnight in a 37°C incubator. Single clones were picked, verified by colony PCR and sent to the company for sequencing. The strains with correct sequencing were cultured, plasmids were extracted, and re-transformed into E. coli BL21 (DE3) competent cells. Culture medium was added and resuscitated at 37°C for 45-60 min, and then spread on LB solid culture medium containing 50 μg / mL kanamycin. The cells were incubated at 37°C overnight to obtain the recombinant transformant E. coli BL21 (DE3) / pET28a-TleB-CYP116B46 strain for expressing TleB-CYP116B46 enzyme.

[0105] Example 2 Construction of TleB / TleB-CYP116B46 site-directed mutant library

[0106] Site-directed mutagenesis was performed on multiple sites around the active pocket of TleB and TleB / TleB-CYP116B46 to construct a mutant library.

[0107] Taking the mutation of position 282 of TleB and TleB / TleB-CYP116B46 to leucine (I282L) as an example,

[0108] Template: pET28a-TleB or pET28a-TleB-CYP116B46

[0109] Primer TleB I282L-F: GTTCCGTTGCTGAGCCACGTGACCTTCG (SEQ ID NO: 17)

[0110] Primer TleB I282L-R: CCACAGAACCGGCAGTTCCAGC (SEQ ID NO: 18)

[0111] PCR reaction system (20 μL): 1-50 ng of template, 0.5 μL (10 μM) of a pair of upstream and downstream primers, 10 μL of PrimeSTAR Max DNA polymerase (2×), and sterile water to make up to 20 μL.

[0112] The PCR amplification procedure was as follows: (1) pre-denaturation at 98°C for 3 min; (2) denaturation at 98°C for 10 s, (3) annealing at 58°C for 5 s, and (4) extension at 72°C for 80 s. Steps (2) to (4) were repeated 30 times, and the final step was extension at 72°C for 5 min. The PCR product was stored at 12°C.

[0113] The amplified PCR product was digested with Dpn I in a 37°C water bath for 3-6 hours, inactivated at 80°C for 20 minutes, transferred to E. coli BL21 (DE3) competent cells, added with culture medium and resuscitated at 37°C for 45-60 minutes, spread on LB solid culture medium containing kanamycin, and cultured inverted at 37°C overnight. A single clone was picked and sent to the company for sequencing. The sequencing result peak graph was viewed using SnapGene bioanalysis software to determine the correct mutation of the amino acid at the mutation site.

[0114] Example 3 Construction of TleB or TleB / TleB-CYP116B46 site saturation mutant library

[0115] According to the screening results of the site-directed mutant library, site-saturation mutagenesis was performed on positions I282 and Q387 of TleB or TleB-CYP116B46 to construct a mutant library.

[0116] First, perform saturation mutation of I282 site:

[0117] Template: pET28a-TleB or pET28a-TleB-CYP116B46

[0118] Primer I282-F: GTTCCGTTGNNKAGCCACTGTGACCTTCG (SEQ ID NO: 19),

[0119] Primer I282-R: CCACAGAACCGGCAGTTCCAGC (SEQ ID NO: 20).

[0120] Except for the template and primers, the PCR reaction system, PCR amplification procedure and subsequent steps were the same as those in Example 2. Single clones were picked and sent to the company for sequencing, and the peak graph of the sequencing results was viewed using SnapGene biological analysis software to obtain all 19 mutants.

[0121] The template and method for saturation mutation of Q387 site are the same as those in the above embodiment; the template used for iterative saturation mutation of I282L / Q387 is pET28a-TleB-CYP116B46-I282L, and the template used for iterative saturation mutation of I282L / Q387L / I234 is pET28a-TleB-CYP116B46-I282L / Q387L, and the method is the same as that in the above embodiment; the primers used are shown in the following table:

[0122]

[0123] Example 4 Screening of TleB / TleB-CYP116B46 mutants

[0124] The expression strains pET28a-TleB and pET28a-TleB-CYP116B46 obtained in Example 1 and the corresponding mutants obtained in Example 3 were inoculated into 2 mL of LB liquid medium containing kanamycin, cultured at 37°C, 220 rpm for 5-6 h, and then inoculated into 100 mL of TB medium containing kanamycin at an inoculum of 1 v / v%. 600 When the concentration reached 0.6-0.8, IPTG was added to a final concentration of 0.2 mM, and the cells were induced in a shaker at 25°C and 220 rpm for 18 h. The cells were collected by centrifugation at 4000 rpm for 10 min, and washed twice with 0.1 M potassium phosphate buffer at pH 7.0. The cells were then resuspended in 0.1 M potassium phosphate buffer at pH 6.5 and the OD was adjusted. 600 =20; place the 10 mL shaking tube containing the resuspended cells in an ice water bath and ultrasonically disrupt them at 500 W for 3 to 5 min; collect the lysate, centrifuge at 4°C, 12,000 rpm for 5 min, and take the supernatant for catalytic reaction.

[0125] The crude enzyme catalytic reaction system (2 mL) was as follows: 0.25 mM substrate; 2 mM TCEP; 1 mM NADP +; 1U GDH; 5% (m / V) Glucose; crude enzyme supernatant to make up. In a 25mL reaction bottle, 25℃, 220rpm, react for 2h. After the reaction, take 500μL of the reaction solution into a clean 2mL EP tube, add 1mL ethyl acetate to terminate the reaction, use a vortex to fully extract, 12000rpm, centrifuge for 5min, draw 900μL of supernatant into a clean 1.5mL EP tube, open the tube cover, place in a fume hood to evaporate, after the ethyl acetate is completely evaporated, add 200μL acetonitrile, vortex and briefly centrifuge, add to a 96-well microplate for HPLC analysis. Calculate the ratio of the two products by peak area integration to screen mutants.

[0126] The mutants screened and the catalytic products are shown in the following table:

[0127] Table 1 Catalytic performance of TleB, TleB-CYP116B46 and its mutants

[0128]

[0129]

[0130] Example 5 Expression and purification of TleB / TleB-CYP116B46 / TleB-CYP116B46 mutants

[0131] Taking the expression and purification of TleB-CYP116B46 as an example, the expression strain pET28a-TleB-CYP116B46 obtained in Example 1 was inoculated into 2 mL of LB liquid medium containing kanamycin, cultured at 37°C, 220 rpm for 5-6 h, and then inoculated into 100 mL of TB medium containing kanamycin at an inoculum of 1 v / v%. 600 When the pH value reached 0.6-0.8, IPTG was added at a final concentration of 0.2 mM and induced for 18 h in a shaking incubator at 25°C and 220 rpm.

[0132] 4000rpm, 10min, centrifuge to collect the cells, wash twice with 0.1M, pH 7.0 potassium phosphate buffer, resuspend the cells with 0.1M, pH7.0 potassium phosphate buffer (containing 10mM imidazole), ultrasonically disrupt in an ice bath, collect the supernatant by high-speed centrifugation, filter with a 0.45μm filter membrane, and purify with a nickel column in a 4℃ refrigerator. Wash with 5 times column ultrapure water; wash with 5 times column equilibration buffer; load the filtered shattered supernatant onto the nickel column, load as many times as possible to make the target protein hang on the column, elute the protein with different concentrations of equilibration buffer (10mM, 20mM, 250mM imidazole), then desalt and concentrate by ultrafiltration, freeze with liquid nitrogen, and store at -80℃.

[0133] TleB and TleB-CYP116B46 mutant were expressed and purified using the above method.

[0134] Example 6 Pure enzyme catalyzed reaction

[0135] TleB or TleB mutant pure enzyme catalytic system: 10 μM TleB or TleB mutant, 10 μM ferredoxin containing iron-sulfur cluster (Fdx), 10 μM ferredoxin reductase containing FAD (Fdr), 2 mM NADPH, 2 mM TCEP (tris(2-carboxyethyl)phosphine), 0.1 mM substrate, reaction temperature 25°C, reaction time 2 h.

[0136] TleB-CYP116B46 or its mutant pure enzyme catalytic system: 10 μM TleB-CYP116B46 or its mutant, 2 mM NADPH, 2 mM TCEP (tris(2-carboxyethyl)phosphine), 0.1 mM substrate, reaction temperature 25° C., reaction time 2 h.

[0137] The HPLC chromatograms of the catalytic products of TleB and TleB-CYP116B46 are shown in Figure 1 As shown, no enzyme solution was added to the control group.

[0138] HPLC chromatograms of the catalytic products of TleB TPM1 and TleB TPM1-CYP116B46 are shown in Figure 2 As shown, no enzyme solution was added to the control group.

[0139] Example 7

[0140] Fusion proteins were prepared using the reducing domains of CYP107E49, CYP107E50, CYP107E51, CYP107E52 and CYP116B46, and site-directed mutagenesis and saturation mutagenesis were performed. Except for the primers, the other steps were the same as those in Example 1-6.

[0141] The upstream primers of the amplification primers of pET28a-CYP107E49, pET28a-CYP107E50, pET28a-CYP107E51 and pET28a-CYP107E52 are:

[0142] pET28a-CYP107E-F:GAACGTCTGGTTCTGGACCTGTAAAAGCTTG CGGCCGCACTCGAG(SEQID NO:29)

[0143] The downstream primers are:

[0144] pET28a-CYP107E49-R: TCCGGATTCTGCGCCGGGTCCCACTGAACCGGCAGTTGCAGCAGGCTACG (SEQ ID NO: 30)

[0145] pET28a-CYP107E50-R: TCCGGATTCTGCGCCGGGTCCCACAGAACC GGCAGACGCAGCAGGC (SEQ ID NO: 31)

[0146] pET28a-CYP107E51-R: TCCGGATTCTGCGCCGGGTCCCAGGTGATCGGCAGACGCAGCAGGCTACG (SEQ ID NO: 32)

[0147] pET28a-CYP107E52-R: TCCGGATTCTGCGCCGGGTCCCAAGCAACCGGCAGTTTCAGCAGGCTACG (SEQ ID NO: 33).

[0148] The primers for amplifying the reduction domain of CYP116B46 are:

[0149] CYP116B46-F2:GACCCGGCGCAGAATCCGGAACGTCGCGATCCGG AC (SEQ ID NO:34)

[0150] CYP116B46-R2: TTACAGGTCCAGAACCAGACGTTCGGTTTTAGCA CGAGAGC (SEQ ID NO:35)

[0151] The primers for site-directed mutagenesis of CYP107E49-CYP116B46 were CYP107E49-I238F-F, CYP 107E49-I238F-R, CYP107E49-I286L-F, and CYP107E49-Q391L-R;

[0152] The primers for site-directed mutagenesis of CYP107E50-CYP116B46 were CYP107E50-I242F-F, CYP107E50-I242F-R, CYP107E50-I290L-F, and CYP107E50-Q395L-R;

[0153] The primers for site-directed mutagenesis of CYP107E51-CYP116B46 were CYP107E51-I234F-F, CYP107E51-I234F-R, CYP107E51-I282L-F, and CYP107E51-Q387L-R;

[0154] The primers for site-directed mutagenesis of CYP107E52-CYP116B46 were CYP107E52-I238F-F, CYP107E52-I238F-R, CYP107E52-I286L-F, and CYP107E52-Q391L-R;

[0155] The nucleotide sequences of the primers are shown in the following table:

[0156] Table 2 Primers for point mutations of CYP107E49-CYP116B46, CYP107E50-CYP116B46, CYP107E51-CYP116B46, and CYP107E52-CYP116B46

[0157]

[0158] The catalytic results of CYP107E49 TPM1-CYP116B46, CYP107E50 TPM1-CYP116B46, CYP107E51 TPM1-CYP116B46 and CYP107E52 TPM1-CYP116B46 are specifically given below.

[0159] The products generated by the substrates catalyzed by CYP107E49-CYP116B46, CYP107E50-CYP116B46, CYP107E51-CYP116B46, CYP107E52-CYP116B46 and the screened mutants are shown in the following table:

[0160] Table 3

[0161]

[0162] The above results show that the CYP107E49 TPM1-CYP116B46 (I238F / I286L / I391L), CYP107E50 TPM1-CYP116B46 (I242F / I290L / Q395L), CYP107E51 TPM1-CYP116B46 (I234F / I282L / I387L), and CYP107E52TPM1-CYP116B46 (I238F / I286L / I391L) mutants of the present invention have a catalytic effect that is basically equivalent to that of TleB TPM1-CYP116B46 (I234F / I282L / Q387L), and the P2 content can reach about 90%.

[0163] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A P450 enzyme mutant, characterized in that: The mutant is selected from any one of the following: (a) the amino acid sequence corresponds to the P450 enzyme shown in SEQ ID NO: 1, with the amino acid at position 282 mutated to leucine and the amino acid at position 387 mutated to leucine; (b) an amino acid sequence corresponding to the P450 enzyme shown in SEQ ID NO: 2, with the amino acid at position 286 mutated to leucine and the amino acid at position 391 mutated to leucine; (c) an amino acid sequence corresponding to the P450 enzyme shown in SEQ ID NO: 3, with the amino acid at position 290 mutated to leucine and the amino acid at position 395 mutated to leucine; (d) an amino acid sequence corresponding to the P450 enzyme shown in SEQ ID NO: 4, with the amino acid at position 282 mutated to leucine and the amino acid at position 387 mutated to leucine; (e) The amino acid sequence corresponds to the P450 enzyme shown in SEQ ID NO: 5, with the amino acid at position 286 mutated to leucine and the amino acid at position 391 mutated to leucine.

2. The P450 enzyme mutant according to claim 1, characterized in that The 234th amino acid of the amino acid sequence shown in SEQ ID NO:1 mutates to phenylalanine or histidine, the 238th amino acid of the amino acid sequence shown in SEQ ID NO:2 mutates to phenylalanine or histidine, the 242nd amino acid of the amino acid sequence shown in SEQ ID NO:3 mutates to phenylalanine or histidine, the 234th amino acid of the amino acid sequence shown in SEQ ID NO:4 mutates to phenylalanine or histidine, and the 238th amino acid of the amino acid sequence shown in SEQ ID NO:5 mutates to phenylalanine or histidine.

3. The P450 enzyme mutant according to claim 1 or 2, characterized in that: The mutants may also be selected from the following: (f) A polypeptide formed by adding a tag sequence, a restriction site sequence or a signal sequence to one or both ends of the amino acid sequence of any one of (a) to (e).

4. A P450 enzyme mutant fusion protein, characterized in that: The fusion protein comprises (i) a fusion protein formed by connecting the C-terminus of the P450 enzyme mutant according to claim 1 to the CYP116B46 reductase domain; (ii) A polypeptide formed by adding a tag sequence, a restriction site sequence, or a signal sequence to one or both ends of the amino acid sequence of the fusion protein described in (i).

5. The P450 enzyme mutant fusion protein according to claim 4, characterized in that: The amino acid sequence of the CYP116B46 reductase domain is shown in SEQ ID NO:

6.

6. A polynucleotide, characterized in that Encoding the P450 enzyme mutant according to any one of claims 1 to 3 or the P450 enzyme mutant fusion protein according to claim 4 or 5.

7. An expression vector, characterized in that: Comprising the polynucleotide of claim 6.

8. A genetically engineered host cell, characterized in that Comprising the expression vector according to claim 7.

9. Use of the P450 enzyme mutant according to any one of claims 1 to 3, the P450 enzyme mutant fusion protein according to claim 4 or 5, the expression vector according to claim 7 or the genetically engineered host cell according to claim 8 in catalyzing CS bonding within a substrate molecule.

10. The use according to claim 9, characterized in that It is used to catalyze the reaction of the following substrates to improve the selectivity of the catalytically generated product P2, wherein the structural formula of the substrate is: The catalytic reaction is as follows:

Images