Heat-resistant high-yield T7 RNA polymerase mutant as well as preparation method and application thereof

Abstract

The invention relates to the technical field of gene engineering, and discloses a heat-resistant high-yield T7RNA polymerase mutant as well as a preparation method and application thereof. The T7RNA polymerase mutant disclosed by the invention is a protein as shown in A1) or A2): A1) a protein obtained by carrying out amino acid substitution on at least four positions of V185, H205, K206, M226, D388, S430, H523 and I581 of wild type T7RNA polymerase; wherein the amino acid sequence of the wild type T7RNA polymerase is as shown in SEQ ID NO: 1; a2) a fusion protein obtained by connecting a label to the N end or / and the C end of the amino acid sequence in A1). Compared with a wild type T7RNA polymerase, the T7RNA polymerase mutant disclosed by the invention shows better heat resistance and transcriptional activity.

Description

Technical Field

[0001] The invention relates to the technical field of protein engineering, and in particular to a heat-resistant and high-yield T7 RNA polymerase mutant and a preparation method and application thereof. Background Art

[0002] RNA polymerase is an enzyme that uses a DNA chain or RNA as a template and ribonucleoside triphosphates as substrates to catalyze the polymerization of phosphodiester bonds and synthesize RNA. Since it is related to the transcription of genetic information from gene DNA into RNA in cells, it is also called transcriptase.

[0003] In the related technology, bacteriophage T7 RNA polymerase is one of the simplest enzymes that catalyzes RNA synthesis. It is isolated from Escherichia coli cells infected with bacteriophage T7. It has a total of 883 amino acids and a protein molecular weight of 99kDa. Bacteriophage T7 RNA polymerase can catalyze RNA synthesis from the 5' to 3' direction. It has a high specificity for the T7 bacteriophage promoter. It recognizes the specific T7 promoter sequence and initiates the transcription process. It uses ATP, CTP, GTP and UTP as substrates, and synthesizes RNA by base pairing with the DNA template according to the principle of base complementary pairing. T7 RNA polymerase requires DNA template and Mg 2+ As a cofactor, it participates in the RNA synthesis process. In the field of mRNA vaccines and drugs, T7 RNA polymerase is often used to produce mRNA. However, although T7 RNA polymerase is widely used in in vitro RNA synthesis, in vivo protein expression (bacterial high expression system), etc., it also has some disadvantages that cannot be ignored as an in vitro RNA synthesis tool, such as poor thermal stability. In the process of RNA synthesis, many by-products may be produced, including oligonucleotides produced during transcription initiation, interrupted RNA products caused by termination signals, and 3' end extension products caused by RNA-dependent RNA polymerase activity.

[0004] Based on this, there is an urgent need to find a T7 RNA polymerase with high thermal stability and the ability to maintain efficient transcription. Summary of the invention

[0005] The present invention aims to solve one of the technical problems existing in the prior art. To this end, the present invention provides a T7 RNA polymerase mutant and a preparation method and application thereof, wherein the T7 RNA polymerase mutant has better transcription activity under high temperature transcription conditions than the wild-type T7 RNA polymerase, that is, more transcription yield can be obtained under the same conditions.

[0006] The invention also provides a biological material related to the T7 RNA polymerase mutant.

[0007] The invention also provides an enzyme preparation.

[0008] The invention also provides a method for preparing a T7 RNA polymerase mutant.

[0009] The invention also provides a method for amplifying RNA molecules in vitro.

[0010] The invention also proposes an application of a T7 RNA polymerase mutant in the preparation of a nucleic acid amplification product.

[0011] The invention also provides an application of a T7 RNA polymerase mutant or the enzyme preparation in nucleic acid amplification.

[0012] The invention also provides a reagent kit for nucleic acid amplification.

[0013] In a first aspect of the present invention, a T7 RNA polymerase mutant is provided, which is a protein as described in A1) or A2) below:

[0014] A1) a protein obtained by amino acid substitution at at least four positions of V185, H205, K206, M226, D388, S430, H523, and I581 of a wild-type T7 RNA polymerase; wherein the amino acid sequence of the wild-type T7 RNA polymerase is as shown in SEQ ID NO: 1;

[0015] A2) A fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of the amino acid sequence described in A1).

[0016] In some embodiments of the present invention, the amino acid substitution site contained in the T7 RNA polymerase mutant is selected from the following site combinations: K206 / D388 / S430 / H523, V185 / H205 / M226 / I581, V185 / H205 / M226 / I581, V185 / D388 / S430 / I581.

[0017] In some embodiments of the present invention, the T7 RNA polymerase mutant comprises an amino acid substitution at position V185, and the substituted amino acid can be selected from K or R.

[0018] In some embodiments of the present invention, the T7 RNA polymerase mutant comprises an amino acid substitution at position H205, and the substituted amino acid can be selected from S or T.

[0019] In some embodiments of the present invention, the T7 RNA polymerase mutant comprises an amino acid substitution at position K206, and the substituted amino acid can be selected from P.

[0020] In some embodiments of the present invention, the T7 RNA polymerase mutant comprises an amino acid substitution at position M226, and the substituted amino acid can be selected from L.

[0021] In some embodiments of the present invention, the T7 RNA polymerase mutant comprises an amino acid substitution at position D388, and the substituted amino acid can be selected from E.

[0022] In some embodiments of the present invention, the T7 RNA polymerase mutant comprises an amino acid substitution at position S430, and the substituted amino acid can be selected from P.

[0023] In some embodiments of the present invention, the T7 RNA polymerase mutant comprises an amino acid substitution at position H523, and the substituted amino acid can be selected from E.

[0024] In some embodiments of the present invention, the T7 RNA polymerase mutant comprises an amino acid substitution at position I581, and the substituted amino acid can be selected from K or R.

[0025] In some embodiments of the present invention, the amino acid substitution site contained in the T7 RNA polymerase mutant is selected from the following mutation combinations:

[0026] K206P / D388E / S430P / H523E, V185K / H205S / M226I / I581K, V185R / H205T / M226L / I581K, V185K / D388E / S430P / I581R.

[0027] The T7 RNA polymerase mutant according to the embodiment of the present invention has at least the following beneficial effects:

[0028] The T7 RNA polymerase mutant of the present invention exhibits a higher transcription yield under high temperature conditions compared to the wild-type T7 RNA polymerase, that is, the band brightness obtained under the same high-temperature transcription conditions is higher, and this advantage is exhibited in multiple template tests. In addition, it has a higher transcription activity than the wild-type T7 RNA polymerase.

[0029] In some embodiments of the present invention, the tag includes at least one of tags that facilitate the solubilization, purification and detection of the T7 RNA polymerase mutant.

[0030] In some embodiments of the invention, the tag is a histidine tag.

[0031] It is understood that the T7 RNA polymerase mutant of the present invention may include one or more tags; multiple tags may include a combination of multiple identical tags, or a combination of multiple different tags. For example: tags that facilitate the dissolution of the T7 RNA polymerase mutant include, but are not limited to, nus tags or maltose binding protein tags; tags that facilitate the purification of the T7 RNA polymerase mutant include, but are not limited to, strep tags, His tags, GST tags, pelB signal tags, or ompA signal tags; tags that facilitate the detection of the T7 RNA polymerase mutant include, but are not limited to, horseradish peroxidase (HRP) tags, β-galactosidase tags, luciferase tags, green fluorescent protein (GFP) tags, HcRed tags, DsRed tags, or cyan fluorescent protein (CFP) tags. The tag may specifically be a His tag.

[0032] The second aspect of the present invention provides a biological material related to the T7 RNA polymerase mutant described in the first aspect, wherein the biological material is any one of B1) to B4):

[0033] B1), a nucleic acid molecule encoding the T7 RNA polymerase mutant described in the first aspect of the embodiment;

[0034] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0035] B3), a recombinant vector containing the nucleic acid molecule described in B1) or the expression cassette described in B2);

[0036] B4) A recombinant biological cell containing the nucleic acid molecule described in B1), the expression cassette described in B2) or the recombinant vector described in B3).

[0037] In some embodiments of the present invention, the nucleic acid molecule has any one of B11) to B16):

[0038] B11), a DNA molecule having a nucleotide sequence as shown in SEQ ID NO: 3;

[0039] B12), a DNA molecule having a nucleotide sequence as shown in SEQ ID NO: 4;

[0040] B13), a DNA molecule having a nucleotide sequence as shown in SEQ ID NO: 5;

[0041] B14), a DNA molecule having a nucleotide sequence as shown in SEQ ID NO: 6;

[0042] B15), a DNA molecule having 80%, 85% or 90% or more homology with the nucleotide sequence shown in any one of B11) to B14), and encoding the T7 RNA polymerase mutant;

[0043] B16), a DNA molecule that hybridizes with the nucleotide sequence defined in any one of B11) to B14) under stringent conditions and encodes the T7 RNA polymerase mutant.

[0044] In some embodiments of the present invention, the expression cassette refers to a DNA capable of expressing the T7 RNA polymerase mutant in a host cell. The DNA may include not only a promoter for initiating transcription of the T7 RNA polymerase mutant gene, but also a terminator for terminating transcription of the T7 RNA polymerase mutant gene. Further, the expression cassette may also include an enhancer sequence.

[0045] In some embodiments of the present invention, the vector may be a plasmid, cosmid, phage or virus vector, for example, a PET-28a vector.

[0046] In some embodiments of the present invention, the recombinant vector may be a recombinant vector obtained by inserting a DNA molecule encoding the T7 RNA polymerase mutant into the multiple cloning site of the vector.

[0047] In some embodiments of the present invention, biological cells include prokaryotic cells and eukaryotic cells. The prokaryotic cells include bacteria or algae. The eukaryotic cells include fungi, mammalian cells or insect cells. Among them, the bacteria can be Escherichia coli, such as E. coli DH5α or E. coli BL21. The recombinant organism does not contain reproductive material.

[0048] In some embodiments of the present invention, the recombinant biological cell is a recombinant biological cell obtained by introducing the nucleic acid molecule B1), the expression cassette B2) or the recombinant vector B3) into a biological cell. Specifically, it can be a recombinant Escherichia coli obtained by introducing the recombinant vector into E. coli DH5α or E. coli BL21.

[0049] The third aspect of the present invention provides an enzyme preparation, comprising the T7 RNA polymerase mutant described in any one of the first aspects.

[0050] In some embodiments of the present invention, the enzyme preparation further comprises a reaction premix solution or an enzyme storage solution.

[0051] In some embodiments of the present invention, the reaction premix includes RNase inhibitor, spermidine, Tris-HCl, DTT, NTPs, Mg 2+ At least one of .

[0052] In some embodiments of the present invention, the enzyme storage solution comprises at least one of KPB, NaCl, DTT, EDTA, and glycerol.

[0053] It is understandable that the reaction premix solution and enzyme storage solution should preferably not affect the activity of the T7 RNA polymerase mutant.

[0054] The fourth aspect of the present invention provides a method for preparing the T7 RNA polymerase mutant according to any one of the first aspects, comprising:

[0055] The coding gene of the T7 RNA polymerase mutant described in the embodiment of the first aspect is introduced into a biological cell to express the coding gene, thereby obtaining the T7 RNA polymerase mutant.

[0056] In some embodiments of the present invention, the biological cells include prokaryotic cells and eukaryotic cells.

[0057] In some embodiments of the present invention, the prokaryotic cell includes bacteria or algae, wherein the bacteria may be Escherichia coli (eg, E. coli BL21).

[0058] In some embodiments of the present invention, the eukaryotic cell comprises a fungus (such as yeast), a mammalian cell (such as HEK293 cell) or an insect cell.

[0059] A fifth aspect of the present invention provides a method for amplifying RNA molecules in vitro, comprising the following steps:

[0060] RNA molecules are amplified using the T7 RNA polymerase mutant described in the first embodiment or the enzyme preparation described in the third embodiment.

[0061] A sixth aspect of the present invention provides use of any one of C1) to C3) in preparing a nucleic acid amplification product;

[0062] C1), the T7 RNA polymerase mutant described in the first aspect embodiment;

[0063] C2), the biological material described in the embodiment of the second aspect;

[0064] C3), the enzyme preparation described in the embodiment of the third aspect.

[0065] The seventh aspect of the present invention provides the use of the T7 RNA polymerase mutant described in the embodiment of the first aspect or the enzyme preparation described in the embodiment of the third aspect in nucleic acid amplification.

[0066] The eighth aspect of the present invention provides a kit for nucleic acid amplification, comprising the T7 RNA polymerase mutant described in the embodiment of the first aspect or the enzyme preparation described in the embodiment of the third aspect.

[0067] Other features and advantages of the present invention will be set forth in the description which follows. BRIEF DESCRIPTION OF THE DRAWINGS

[0068] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0069] Figure 1 The SDS-PAGE electrophoresis results of the wild-type T7 RNA polymerase of the present invention are as follows;

[0070] Figure 2 The SDS-PAGE electrophoresis results of the T7 RNA polymerase mutants m1 to m6 of the present invention; wherein A is T7 RNA polymerase mutant m1, B is T7 RNA polymerase mutant m2, C is T7 RNA polymerase mutant m3, D is T7 RNA polymerase mutant m4, E is T7 RNA polymerase mutant m5, and F is T7 RNA polymerase mutant m6;

[0071] Figure 3 is a statistical diagram of the unfolding temperature of the T7 RNA polymerase of the present invention;

[0072] Figure 4 This is a statistical graph of the transcription performance test results of the T7 RNA polymerase of the present invention at 37°C; wherein ** indicates p<0.01, and *** indicates p<0.001;

[0073] Figure 5 The figure is a statistical diagram of the transcription performance test results of the T7 RNA polymerase of the present invention at 52° C., wherein ns indicates no significant difference, *** indicates p<0.001, and **** indicates p<0.0001. DETAILED DESCRIPTION

[0074] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0075] When a numerical range is disclosed herein, the above range is considered to be continuous and includes the minimum and maximum values ​​of the range, as well as every value between such minimum and maximum values. Further, when a range refers to an integer, every integer between the minimum and maximum values ​​of the range is included. In addition, when multiple ranges are provided to describe features or characteristics, the ranges can be combined. In other words, unless otherwise indicated, all ranges disclosed herein should be understood to include any and all subranges included therein.

[0076] In the description of the present invention, the reference term "and / or" includes all and any combinations of one or more of the associated listed items.

[0077] In the description of the present invention, the term "nucleotide" generally refers to a compound formed by a nucleoside connected to an acidic molecule or group through an ester bond. For example, a phosphate ester of a nucleoside usually has one, two or three phosphate groups covalently linked to the 5th position of the sugar group of the nucleoside. In some cases, the definition of nucleotide also includes homologues or analogs of some typical nucleotides.

[0078] In the description of the present invention, the term "amino acid" refers to the basic unit constituting protein, which gives the protein a specific molecular structure and makes its molecule have biochemical activity. For example, the "amino acid" used in the present invention includes the following 20 natural amino acids: alanine (Ala or A), glycine (Gly or G), isoleucine (Ile or I), asparagine (Asn or N), arginine (Arg or R), lysine (Lys or K), lysine (Lys or K), cysteine ​​(Cys or C), aspartic acid (Asp or D), glutamic acid (Glu or E), glutamine (Gln or Q), histidine (His or H), leucine (Leu or L), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), valine (Val or V) and tyrosine (Tyr or Y). The "*" in the amino acid sequence is a stop codon.

[0079] In the description of the present invention, each amino acid substitution is represented by a triplet: letter-number-letter; wherein the number represents the position of the mutated amino acid, the letter before the number corresponds to the amino acid involved in the mutation, and the letter after the number represents the amino acid used to replace the amino acid before the number.

[0080] If the specific conditions are not specified in the examples, the experiments were carried out under conventional conditions or conditions recommended by the manufacturer. If the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be purchased commercially.

[0081] Invention concept:

[0082] In order to obtain a T7 RNA polymerase with high thermal stability and capable of maintaining efficient transcription, the present invention mutated and screened a large number of wild-type T7 RNA polymerases, and screened a total of 4 T7 RNA polymerase mutants with excellent thermal stability and efficient transcription, which are T7 RNA polymerase mutant m1 (K206P / D388E / S430P / H523E), T7 RNA polymerase mutant m2 (V185K / H205S / M226I / I581K), T7 RNA polymerase mutant m3 (V185R / H205T / M226L / I581K), and T7 RNA polymerase mutant m4 (V185K / D388E / S430P / I581R). The amino acid sequence information of the wild-type T7 RNA polymerase is shown in SEQ ID NO: 1.

[0083] The T7 RNA polymerase mutant m1 is based on the amino acid sequence of the wild-type T7 RNA polymerase, with the aspartic acid at position 388 mutated to glutamic acid (D388E), the serine at position 430 mutated to proline (S430P), the lysine at position 206 mutated to proline (K206P), and the histidine at position 523 mutated to glutamic acid (H523E).

[0084] The T7 RNA polymerase mutant m2 is based on the amino acid sequence of the wild-type T7 RNA polymerase, with the valine at position 185 mutated to lysine (V185K), the histidine at position 205 mutated to serine (H205S), the methionine at position 226 mutated to isoleucine (M226I), and the isoleucine at position 581 mutated to lysine (I581K).

[0085] The T7 RNA polymerase mutant m3 is based on the amino acid sequence of the wild-type T7 RNA polymerase, with the valine at position 185 mutated to arginine (V185R), the methionine at position 226 mutated to leucine (M226L), the histidine at position 205 mutated to threonine (H205T), and the isoleucine at position 581 mutated to lysine (I581K).

[0086] The T7 RNA polymerase mutant m4 is based on the amino acid sequence of the wild-type T7 RNA polymerase, with the 185th valine mutated to lysine (V185K), the 430th serine mutated to proline (S430P), the 388th aspartic acid mutated to glutamic acid (D388E), and the 581st isoleucine mutated to arginine (I581R). Specific embodiments

[0088] The following is a detailed description of the specific examples. In the following examples, if no specific conditions are specified, the conditions are carried out according to conventional conditions (such as those described in documents or books) or the conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used in the examples is not specified, they are all conventional products that can be purchased commercially.

[0089] Example 1: Acquisition of T7 RNA polymerase mutants

[0090] 1. Construction of expression vector:

[0091] Based on the amino acid sequence information of the screened T7 RNA polymerase mutant, the coding nucleotide sequence information was obtained after codon optimization, and a nucleotide sequence containing a coding histidine tag (HHHHHH) and a connecting peptide (GS) was designed at its 3' end, namely ATGCATCATCATCATCATCATCATGGCAGC (SEQ ID NO: 9), and the corresponding DNA molecule was synthesized by gene synthesis, wherein:

[0092] The nucleotide sequence information encoding the wild-type T7 RNA polymerase is shown in SEQ ID NO: 2. The nucleotide sequence information encoding the T7 RNA polymerase mutant m1 is shown in SEQ ID NO: 3. The nucleotide sequence information encoding the T7 RNA polymerase mutant m2 is shown in SEQ ID NO: 4. The nucleotide sequence information encoding the T7 RNA polymerase mutant m3 is shown in SEQ ID NO: 5. The nucleotide sequence information encoding the T7 RNA polymerase mutant m4 is shown in SEQ ID NO: 6.

[0093] The T7 RNA polymerase mutant m5 is based on the amino acid sequence of the wild-type T7 RNA polymerase, with the methionine at position 226 mutated to leucine (M226L), the methionine at position 306 mutated to lysine (M306K), the asparagine at position 419 mutated to threonine (N419T), and the cysteine ​​at position 510 mutated to glutamine (C510Q). The nucleotide sequence information encoding it is shown in SEQ ID NO:7.

[0094] The T7 RNA polymerase mutant m6 is based on the amino acid sequence of the wild-type T7 RNA polymerase, with the aspartic acid at position 338 mutated to tryptophan (D388W), the histidine at position 205 mutated to phenylalanine (H205F), and the lysine at position 206 mutated to tyrosine (K206Y). The nucleotide sequence information encoding it is shown in SEQ ID NO:8.

[0095] Then, the above DNA molecules were connected to the PET-28a vector by overlapping PCR to obtain recombinant expression vectors PET-28a / T7-wt, PET-28a / T7-m1, PET-28a / T7-m2, PET-28a / T7-m3, PET-28a / T7-m4, PET-28a / T7-m5 and PET-28a / T7-m6. The recombinant expression vectors were transformed into DH5α competent cells, and positive monoclonal clones were screened for sequencing verification to obtain single colonies with correct verification results.

[0096] 2. Expression:

[0097] The recombinant expression vector verified in step 1 above was transformed into the host cell E. coli BL21, and a single colony was picked and inoculated into 100 mL LB medium containing 50 μg / mL ampicillin. After shaking and culturing overnight in a 37°C shaker, the seed solution of the overnight culture was taken and inoculated into 2 L LB medium containing 50 μg / mL ampicillin at a volume ratio of 1:100, and shaken and cultured in a 37°C shaker until 0 D 600 0.6~0.8; add 10% IPTG to a final concentration of 0.4mmol / L, and continue to induce at 37℃ for 6h~8h; collect the induced bacteria by centrifugation and weigh them, record the wet weight of the bacteria, and store them at -80℃.

[0098] 3. Purification:

[0099] The expressed proteins in the bacteria containing the above-mentioned recombinant expression vectors PET-28a / T7-wt, PET-28a / T7-m1, PET-28a / T7-m2, PET-28a / T7-m3, PET-28a / T7-m4, PET-28a / T7-m5 and PET-28a / T7-m6 were extracted respectively, and the specific steps were as follows:

[0100] (1) High-pressure disruption of induced expression cells:

[0101] Take the cells frozen at -80℃ after induction of expression, add 5mL lysis buffer (50mM Tris-HCl, pH7.8 at 25℃, 300mM NaCl, 50mM Imidazole, 5% Glycerol) per gram of cells to resuspend the cells according to the wet weight of the cells recorded above, and lyse the cells with a high-pressure crusher, the high-pressure crushing condition is 650bar, and the crushing is repeated three times. The lysed cells are centrifuged at 12000rpm for 30min at 4℃ to separate the supernatant (sample 1) and the precipitate (sample 2), and the supernatant is taken into a 200mL sterile beaker.

[0102] (2) Nickel ion affinity chromatography purification:

[0103] The selected chromatography column is Ni-NTA Purose 6Fast Flow (purchased from Jiaxing Qianchun Biotechnology Co., Ltd.), the binding buffer is buffer A (50mM Tris-HCl, pH7.8 at 25°C, 100mM NaCl, 80mM Imidazole, 5% Glycerol); the elution buffer is buffer B (50mM Tris-HCl, pH7.8 at 25°C, 100mM NaCl, 500mMImidazole), 5% Glycerol. The protein solution dissolved in step 1 is loaded onto the chromatography column that has been equilibrated with buffer A. After loading, the column is first rinsed with equilibration solution A, and then gradient elution is performed with buffer B at 0%-100%. The eluted components are subjected to SDS-PAGE protein electrophoresis detection, and the eluate containing the target protease is collected according to the detection results (sample 3), and the eluate is dialyzed into buffer A, and the dialyzate is collected for standby use (sample 4).

[0104] (3) Secondary nickel ion affinity chromatography purification:

[0105] Repeat step 2, perform SDS-PAGE protein electrophoresis on the eluted fractions, collect the eluate containing the target protease according to the test results (sample 5), and dialyze the eluate into buffer C (50 mM Tris-HCl, 100 mM NaCl, 1 mM DTT, 0.1 mM EDTA, pH 7.8 (25°C)), and collect the dialysate for later use (sample 6).

[0106] (4) Strong anion exchange chromatography purification:

[0107] The selected chromatography column is Q Purose 6Fast Flow (purchased from Jiaxing Qianchun Biotechnology Co., Ltd.), the binding buffer is buffer C; the elution buffer is buffer D (50mM Tris-HCl pH7.8 at 25°C, 800mM NaCl, 1mM DTT, 0.1mM EDTA). The dialysate obtained in step 3 is added to the chromatography column that has been equilibrated with buffer C. After the addition is completed, the column is first rinsed with buffer C, and then a gradient elution of 0%-100% is performed with buffer D. The eluted components are detected by SDS-PAGE protein electrophoresis. The eluate (sample 7) is collected according to the test results, and dialyzed into a storage solution (20mM KPB (pH7.9), 100mM NaCl, 1mM DTT, 0.1mM EDTA, 50% glycerol) for use (sample 8).

[0108] The above samples were subjected to SDS-PAGE electrophoresis, and the results were as follows: Figure 1 and Figure 2As shown (lane M is a protein marker, lane 1 corresponds to sample 1, and so on). The electrophoresis results show that the target protease (i.e., wild-type T7 RNA polymerase and T7 RNA polymerase mutants T7-m1 to T7-m6) was successfully obtained by the method of the present invention. It can be seen from the electrophoresis bands that the T7 RNA polymerase purified by this method has very few mixed bands, and the product purity is relatively high, and its purity can reach 90%.

[0109] Detection Example 1: Unfolding Temperature (Tm Value) Measurement

[0110] In the DSF experiment, a change of 1°C in the melting temperature is considered to be significantly different and the heat resistance is significantly improved.

[0111] This test example respectively tested the unfolding temperatures of the wild-type T7 RNA polymerase (hereinafter referred to as "WT") and the T7 RNA polymerase mutants T7-m1 to T7-m6 (hereinafter referred to as "T7-m1", "T7-m2", "T7-m3", "T7-m4", "T7-m5" to "T7-m6") obtained above, and the specific methods are as follows:

[0112] Wild-type T7 RNA polymerase and T7 RNA polymerase mutants were diluted to 1 mg / mL with preservation solution (containing 20 mM KPB (pH 7.9), 100 mM NaCl, 1 mM DTT, 0.1 mM EDTA and 50% glycerol). Then the reaction system was prepared. Specifically, a buffer solution (final concentration of 2×SYPRO Orange) and the corresponding diluted T7 RNA polymerase (final concentration of 0.1 mg / mL) were added to each reaction system to make a 20 μL reaction system. Finally, the unfolding temperature was measured using ABIQuantStudio, and three parallel experiments were performed in each group, and the average value was taken.

[0113] Test results such as Figure 3As shown. The unfolding temperature of wild-type T7 RNA polymerase is 45.58℃, and the unfolding temperatures of T7-m1 to T7-m5 are significantly higher than those of wild-type T7 RNA polymerase (the Tm values ​​are all increased by >1℃), and the heat resistance is stronger than that of wild-type T7 RNA polymerase. Among them, the Tm value of T7-m1 is 47.28℃, the Tm value of T7-m2 is 47.55℃, the Tm value of T7-m3 is 48.14℃, the Tm value of T7-m4 is 49.65℃, and the Tm value of T7-m5 is 47.47℃. In particular, the Tm values ​​of T7-m3 and T7-m4 are both increased by >2℃ relative to the wild-type WT. The Tm value of T7-m6 is 44.22℃, which is significantly lower than that of the wild-type, and the heat resistance is poor, so it is not subjected to subsequent transcription performance testing. This also shows that different combinations of amino acid mutations will have different effects on the heat resistance of T7 RNA polymerase.

[0114] Test Example 2: Transcription Performance Test at Different Temperatures

[0115] This test example tested the transcription performance of the wild-type T7 RNA polymerase obtained above and T7-m1 to T7-m5 at different reaction temperatures (37°C and 52°C). The specific method is as follows:

[0116] Using pUC18 plasmid as template, a specific primer set was designed for conventional PCR amplification, and a DNA template of about 1.5k bp was obtained by purification. The sequence of the specific primer set is as follows:

[0117] PCR-F: 5'-TAATACGACTCACTATAGGGACTATCGTCTTGAGT-3' (SEQ ID NO: 10);

[0118] PCR-R: 5'-GACGAAAGGGCCTCGTGATA-3' (SEQ ID NO: 11);

[0119] Then, the wild-type T7 RNA polymerase and the T7 RNA polymerase mutants m1 to m5 obtained above were used as transcriptases for in vitro transcription, wherein the transcription reaction system is shown in Table 1.

[0120] Table 1: Transcription system

[0121] Components Final content 10× reaction buffer 1× RNase inhibitors 1U DTT (dithiothreitol) 5mM NTPs Mixture 0.5mM DNA template 200ng T7 RNA polymerase 50U Total volume 20μL

[0122] The 10× reaction buffer contained 400 mM Tris-HCl (pH 8.0), 80 mM MgCl2, and 20 mM permidine. After the reaction system was prepared, it was placed at 52°C / 37°C for transcription reaction for 30 min, then inactivated at 70°C for 10 min, and finally the Qubit RNAHS detection kit (Thermo Fisher) was used for quantitative analysis of the transcription product.

[0123] The results of fluorescence quantitative analysis of the products transcribed at 37°C for 30 min are as follows Figure 4 As shown in Table 2, the details are as follows:

[0124] Table 2: Fluorescence quantitative analysis results at 37°C

[0125] Sample No. sample Mutation site RNA yield (ng) Standard Deviation 1 T7-m1 K206P / D388E / S430P / H523E 615 0.71 2 T7-m2 V185K / H205S / M226I / I581K 590 0.33 3 T7-m3 V185R / H205T / M226I / I581K 712 1.20 4 T7-m4 V185K / D388E / S430P / I581R 881 0.87 5 T7-m5 M226L / M306K / N419T / C510Q 320 0.22 6 T7-wt WT 452 1.98

[0126] The test results showed that under the reaction conditions of 37°C, the transcription performance of T7-m1 to T7-m4 was significantly improved compared with the wild-type T7 RNA polymerase. Among them, the yield of RNA products transcribed by T7-m4 was 1.95 times that of the wild-type T7 RNA polymerase.

[0127] The results of fluorescence quantitative analysis of the products transcribed at 52°C for 30 min are as follows Figure 5 As shown in Table 3, the details are as follows:

[0128] Table 3: Fluorescence quantitative analysis results at 52°C

[0129] Sample No. sample Mutation site RNA yield (ng) Standard Deviation 1 T7-m1 K206P / D388E / S430P / H523E 130 1.07 2 T7-m2 V185K / H205S / M226I / I581K 200 1.21 3 T7-m3 V185R / H205T / M226I / I581K 435 0.88 4 T7-m4 V185K / D388E / S430P / I581R 583 0.75 5 T7-m5 M226L / M306K / N419T / C510Q 50 0.57 6 T7-wt WT 55 1.44

[0130] The test results showed that under the reaction conditions of 52°C, the transcription performance of T7-m1 to T7-m4 was significantly improved compared with the wild-type T7 RNA polymerase. Among them, the RNA yield produced by T7-m4 transcription was 10.6 times that of the wild-type T7 RNA polymerase.

[0131] Although the Tm value of T7-m5 is significantly higher than that of the wild type, its ability to transcribe RNA is significantly reduced after mutation. This also shows that different combinations of amino acid mutations will have different effects on the transcription activity of T7 RNA polymerase.

[0132] In summary, the present invention provides a heat-resistant and high-yield T7 RNA polymerase mutant and its preparation method and application. Compared with the wild-type T7 RNA polymerase, the T7 RNA polymerase mutants T7-m1 to T7-m4 of the present invention (the corresponding mutation points are K206P / D388E / S430P / H523E, V185K / H205S / M226I / I581K, V185R / H205T / M226L / I581K, V185K / D388E / S430P / I581R, respectively) show higher transcription ability and transcription yield under normal transcription conditions of 37°C and high temperature conditions of 52°C; among them, T7-m4 has the strongest heat resistance and the highest RNA yield under the same conditions.

[0133] The above is a detailed description of the embodiments of the present invention, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A T7 RNA polymerase mutant, characterized in that The T7 RNA polymerase mutant is the protein described in A1) or A2) below: A1) a protein obtained by amino acid substitution at at least four positions of V185, H205, K206, M226, D388, S430, H523, and I581 of a wild-type T7 RNA polymerase; wherein the amino acid sequence of the wild-type T7 RNA polymerase is as shown in SEQ ID NO: 1; A2) A fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of the amino acid sequence described in A1).

2. The T7 RNA polymerase mutant according to claim 1, characterized in that The amino acid substitution site contained in the T7 RNA polymerase mutant is selected from the following mutation combinations: K206P / D388E / S430P / H523E, V185K / H205S / M226I / I581K, V185R / H205T / M226L / I581K, V185K / D388E / S430P / I581R.

3. A biological material related to the T7 RNA polymerase mutant according to claim 1 or 2, characterized in that: The biological material is any one of B1) to B4): B1), a nucleic acid molecule encoding the T7 RNA polymerase mutant according to claim 1 or 2; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1) or the expression cassette described in B2); B4) A recombinant biological cell containing the nucleic acid molecule described in B1), the expression cassette described in B2) or the recombinant vector described in B3).

4. The biomaterial according to claim 3, characterized in that The nucleic acid molecule has any one of B11) to B16): B11), a DNA molecule having a nucleotide sequence as shown in SEQ ID NO: 3; B12), a DNA molecule having a nucleotide sequence as shown in SEQ ID NO: 4; B13), a DNA molecule having a nucleotide sequence as shown in SEQ ID NO: 5; B14), a DNA molecule having a nucleotide sequence as shown in SEQ ID NO: 6; B15), a DNA molecule having 80%, 85% or 90% or more homology with the nucleotide sequence shown in any one of B11) to B14), and encoding the T7 RNA polymerase mutant; B16), a DNA molecule that hybridizes with the nucleotide sequence of any one of B11) to B14) under stringent conditions and encodes the T7 RNA polymerase mutant.

5. An enzyme preparation, characterized in that The invention comprises the T7 RNA polymerase mutant according to claim 1 or 2.

6. A method for preparing the T7 RNA polymerase mutant according to claim 1 or 2, characterized in that: include: The T7 RNA polymerase mutant is obtained by introducing the coding gene of the T7 RNA polymerase mutant according to claim 1 or 2 into a biological cell so that the coding gene is expressed.

7. A method for amplifying RNA molecules in vitro, characterized in that: The following steps are involved: RNA molecule amplification is performed using the T7 RNA polymerase mutant described in claim 1 or 2 or the enzyme preparation described in claim 5.

8. Use of any one of C1) to C3) in the preparation of a nucleic acid amplification product; C1), the T7 RNA polymerase mutant according to claim 1 or 2; C2), the biological material according to claim 3 or 4; C3) The enzyme preparation according to any one of claims 5.

9. Use of the T7 RNA polymerase mutant according to claim 1 or 2 or the enzyme preparation according to claim 5 in nucleic acid amplification.

10. A kit for nucleic acid amplification, characterized in that: It comprises the T7 RNA polymerase mutant according to claim 1 or 2 or the enzyme preparation according to claim 5.

Images