The cytoplasm is 5apos; application of-nucleotidase TaNT5C2 in wheat scab resistance

Abstract

The invention relates to the technical field of biological genetic engineering, and discloses application of cytoplasm 5 '-nucleotidase in prevention and treatment of wheat scab. The invention finds that after the TaNT5C2 gene is over-expressed in wheat, the infection degree of the wheat scab can be reduced, and the wheat scab resistance can be obviously improved. The invention provides a gene resource and a technical thought for gibberellic disease-resistant breeding improvement of wheat.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to application of cytoplasmic 5'-nucleotidase TaNT5C2 in wheat resistance to fusarium head blight. Background Art

[0002] Wheat head blight (Fusarium head blight, FHB) is a devastating fungal disease caused by Fusarium graminearum. It is widely prevalent all over the world. The disease not only seriously damages the yield and quality of cereal crops such as wheat, causing serious economic losses, but also produces fungal toxins such as deoxynivalenol (Deoxynivalenol, DON), posing a serious threat to the safety and health of humans and animals (Xu, M., Wang, Q., Wang, G. et al. Combatting Fusarium head blight: advances in molecular interactions between Fusarium graminearum and wheat. Phytopathol Res 4, 37 (2022).). With global warming, the promotion of wheat-corn (rice) rotation system and straw return technology, wheat head blight continues to spread and break out worldwide, not only causing serious production losses, but also leading to serious DON pollution in flour and feed. At present, the production loss and grain pollution caused by wheat head blight have seriously troubled the development of my country's wheat industry.

[0003] Breeding and planting wheat varieties resistant to Fusarium head blight is one of the most economical and effective ways to prevent and control wheat Fusarium head blight. However, there is a lack of fusarium head blight resistance resources available in wheat production. Although hundreds of resistance QTLs have been identified, only a few resistance QTLs such as Fhb1 show stable effects (Su, Z., Bernardo, A., Tian, ​​B. et al. A deletion mutation in TaHRC confers Fhb1 resistance to Fusarium head blight in wheat. Nat Genet 51, 1099–1105 (2019).). Therefore, it is particularly urgent to explore and apply more efficient strategies to control the spread of wheat Fusarium head blight. In the process of resisting pathogen invasion, in order to prevent pathogen invasion, plants have evolved a series of complex defense systems to activate their innate immune response, providing plants with the first line of defense against diseases. Studies have found that microorganisms induce plant immunity by releasing various immune elicitors, such as 2'-deoxyguanosine (2-dG) from endophytic fungi, which has been shown to directly activate plant salicylic acid and ethylene disease resistance signaling pathways. This process involves upregulating the expression of immune-related marker genes activated by plant pathogen-related molecular recognition patterns PAMPs, thereby enhancing plant immune activity (Lu C, Wang Q, Jiang Y, et al. Discovery of a novel nucleoside immunesignaling molecule 2′-deoxyguanosine in microbes and plants. J Adv Res. 2023; 46: 1-15.).

[0004] TaNT5C2 is a highly conserved gene, and the NT5C2 encoded by it is widely distributed in organisms. Cytoplasmic 5′-nucleotidase is a special phosphoester hydrolase that can dephosphorylate 2′-deoxyguanosine-5′-triphosphate (dGTP) to generate 2-dG, thereby inducing plant immunity and improving wheat resistance to Fusarium head blight. However, the current research on TaNT5C2 regulating wheat resistance to Fusarium head blight is relatively insufficient and needs to be explored urgently. Summary of the invention

[0005] To solve the above problems, the present invention provides an application of cytoplasmic 5′-nucleotidase TaNT5C2 in wheat resistance to scab. The present invention screens out the wheat disease resistance-related gene TaNT5C2 through genetic engineering and genetic means, and reveals its disease resistance mechanism in the interaction between wheat and scab by functional analysis of the protein and gene, providing a solution for the cultivation of scab-resistant materials. The present invention provides the following technical solutions:

[0006] The present invention first provides a wheat disease resistance-related TaNT5C2 protein and TaNT5C2 gene, which are derived from multiple wheat varieties such as Fielder, Ningmai 18, and Yangmai 38. The TaNT5C2 protein has an amino acid sequence as shown in SEQ ID No. 2, and the TaNT5C2 gene comprises a nucleotide sequence encoding the TaNT5C2 protein. The use of genes encoding the above-mentioned similar domain proteins in other plants in the preparation of disease-resistant transgenic plants also falls within the scope of protection of the present invention.

[0007] The present invention further provides expression elements, recombinant vectors and host cells containing the gene.

[0008] Also provided is the TaNT5C2 gene and the use of the encoding gene in improving the disease resistance of plants.

[0009] Preferably, the plant is a monocotyledonous plant, preferably the plant is wheat; more preferably, the disease resistance refers to wheat fusarium rust caused by Fusarium.

[0010] The present invention also provides the use of TaNT5C2, or its encoding gene, expression element, recombinant vector, host cell in preparing transgenic plants with improved disease resistance.

[0011] Specifically, the plant is a monocotyledonous plant, preferably the plant is wheat; more preferably, the disease resistance refers to wheat fusarium rust caused by Fusarium.

[0012] The present invention provides a method for preparing a transgenic plant with enhanced disease resistance, which comprises the steps of over-expressing the TaNT5C2 gene encoding the gene in the transgenic plant by a transgenic method, and screening to obtain the transgenic plant with enhanced resistance to wheat fusarium head blight;

[0013] Specifically, the plant is a monocotyledonous plant, preferably the plant is wheat; more preferably, the disease resistance refers to wheat fusarium rust caused by Fusarium.

[0014] The present invention aims to apply the method to the cultivation and improvement of disease-resistant wheat varieties. In addition, the present invention also provides an application method for improving disease-resistant wheat varieties using the wheat disease-resistant protein TaNT5C2. The method is of great significance for breeding wheat varieties with stronger disease resistance, and provides a scientific basis for subsequent screening and identification of highly resistant wheat varieties. For example, the present invention can successfully cultivate wheat plants with overexpression of the TaNT5C2 gene, which lays a solid foundation for further research and application. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0016] Figure 1 Schematic diagram of pUbiGW vector with Ubiquitin promoter;

[0017] Figure 2 is the relative expression level of TaNT5C2 in the overexpression wheat lines;

[0018] Figure 3 Representative images of wild-type and TaNT5C2-OE wheat ears 14 days after infection with Fusarium graminearum;

[0019] Figure 4 This is a quantitative analysis of the number of diseased wheat spikelets on the 9th, 14th, and 19th days after wild-type (Fielder) and TaNT5C2-OE plants were infected with Fusarium graminearum under greenhouse conditions. DETAILED DESCRIPTION

[0020] The present invention provides application of overexpressing TaNT5C2 gene in positively regulating wheat fusarium head blight resistance.

[0021] The present invention is described below through specific embodiments to facilitate a better understanding of the present invention, but does not constitute a limitation of the present invention. The specific examples are as follows:

[0022] Example 1: Discovery and functional analysis of wheat disease resistance-related gene TaNT5C2

[0023] The present invention screens the key target proteins of the interaction between the pathogenic molecules of fusarium head blight and wheat by means of genetic engineering, and combines the genetic identification of multiple wheat varieties to find the pathogenic factor target protein TaNT5C2, the CDS nucleotide sequence of the TaNT5C2 gene is shown in SEQ ID No. 1, and the amino acid sequence of the protein encoded by the TaNT5C2 gene is shown in SEQ ID No. 2. By performing functional analysis on the protein and gene and constructing transgenic materials to verify its resistance to wheat fusarium head blight, its disease resistance mechanism in the interaction between wheat and fusarium head blight is revealed.

[0024] Example 2: Construction of transgenic wheat overexpressing TaNT5C2

[0025] (1) The amplified TaNT5C2CDS full-length fragment was inserted into the pUbiGW vector with Ubiquitin promoter through the BamH I site using In-Fusion cloning technology (Clontech, catalog number 638910);

[0026] (2) The ligated vector obtained in step (1) is transformed into Escherichia coli DH5α, and the plasmid is extracted after sequencing;

[0027] (3) transforming the plasmid obtained in step (2) with Agrobacterium EHA105 to obtain transformed bacteria;

[0028] (4) transforming the transformed bacteria obtained in step (3) into the wheat Fielder strain through genetic manipulation to obtain multiple transformed offspring, and obtaining wheat overexpressing the TaNT5C2 gene after genotyping using quantitative qRT-PCR;

[0029] The wheat transformation was carried out according to the previously described method (Goetz H., Cornelia M., and Jochen K. (2021). Agrobacterium-Mediated Transformation of Wheat Using Immature Embryos. Rom. Agric. Res. 38, 99-107 (2021)).

[0030] The gene identification was further confirmed by qRT-PCR whether the NT5C2 gene was overexpressed in T0 generation wheat. Figure 2 As shown, the expression levels of overexpression strains #1, #2, and #3 were 37.8, 45.2, and 14.6 times that of the wild type, respectively. Therefore, the present invention selected overexpression strains #1, #2, and #3 for subsequent phenotypic identification of scab.

[0031] qRT-PCR primers are:

[0032] qPCR-TaNT5C2-F (SEQ ID NO:3): GCCGTTAGCTCGCGGCTAC

[0033] qPCR-TaNT5C2-R (SEQ ID NO:4): AGGCTATGGCAGAGAGTGAG

[0034] Example 3: Phenotypic identification of resistance to Fusarium head blight in transgenic wheat overexpressing the gene TaNT5C2

[0035] In the present invention, the wheat transgenic material overexpressing TaNT5C2 obtained in Example 1 was subjected to phenotypic identification of resistance to Fusarium head blight. The specific steps are as follows:

[0036] (1) In the middle of the wheat flowering period, the single flower drip method was used to inoculate Fusarium graminearum PH1, that is, 10 μl (about 1×10 5 Each strain should be inoculated with more than 30 ears, and the inoculation date and number should be marked on a sign;

[0037] (2) bagging the wheat ears inoculated in step (1) to keep them moist for 2 days. After removing the plastic bag, spray water on the inoculated wheat ears regularly every day to keep them moist;

[0038] (3) Investigate the number of diseased spikelets in each inoculated wheat ear on the 9th, 14th and 19th day after the wheat ears are inoculated in step (1).

[0039] The phenotype identification was performed using Enviologix QuickStix Kit (Envirologix, catalog number AS013) to evaluate the genotype of the transgenic plants.

[0040] from Figure 3 It can be clearly seen that the symptoms of the ear are typical symptoms of wheat fusarium head blight, with the diseased part withering brown, the spikelets withering yellow, and the spikelets above the affected part withering white. According to the identification, under greenhouse conditions, on the 9th, 14th, and 19th days after inoculation, the average number of diseased ears of TaNT5C2-OE plants was 3, 8.9, and 13.2, respectively, while the average number of diseased ears of wild-type plants was 4.3, 11.8, and 17.4, respectively. Figure 4), the diseased ear rate of the transgenic lines was reduced by 3.8%, 13.1%, and 20.0% compared with the wild type, which was significantly lower than that of the wild type. The above experimental data fully confirmed that the TaNT5C2-OE transgenic wheat variety has a significant effect in improving resistance to ergot disease. Compared with the control variety Fielder, TaNT5C2-OE transgenic wheat showed obvious resistance advantages. Specifically, when the disease occurred, the severity of the disease in the ear of TaNT5C2-OE transgenic wheat was significantly lower than that of the Fielder wild type. These findings not only verify the effectiveness of TaNT5C2-OE transgenic wheat in ergot disease resistance, but also provide valuable genetic resources for future wheat disease resistance breeding.

Claims

1. A cytoplasmic 5'-nucleotidase, characterized in that The amino acid sequence is shown in SEQ ID No. 2, or the cytoplasmic 5'-nucleotidase encoded by its wheat homologous gene.

2. Encoding as claimed in claim 1 TaNT5C2 The gene, preferably, has a nucleotide sequence as shown in SEQ ID No.

1.

3. An expression element, a recombinant vector, and a host cell containing the gene according to claim 2.

4. The method according to claim 1 TaNT5C2 Gene, and the use of its encoding gene in improving plant disease resistance.

5. The use according to claim 4, characterized in that The plant is a monocotyledonous plant, preferably the plant is wheat; more preferably, the disease resistance refers to wheat fusarium rust caused by Fusarium.

6. The method according to claim 1 TaNT5C2 Use of the gene or the protein encoded by it, the expression element, the recombinant vector and the host cell as claimed in claim 3 in preparing transgenic plants with improved disease resistance.

7. The use according to claim 4, characterized in that The plant is a monocotyledonous plant, preferably the plant is wheat; more preferably, the disease resistance refers to wheat fusarium rust caused by Fusarium.

8. A method for preparing a transgenic plant with enhanced disease resistance, characterized in that: comprising overexpressing the gene encoding the gene according to claim 2 in a transgenic plant by a transgenic method TaNT5C2 Gene, and steps for screening transgenic plants with enhanced resistance to wheat fusarium rust.

9. The method according to claim 8, characterized in that The plant is a monocotyledonous plant, preferably the plant is wheat; more preferably, the disease resistance refers to wheat fusarium rust caused by Fusarium.

Images