SiRNA for targeted inhibition of chicken ULK2 expression and application thereof

Abstract

The invention belongs to the technical field of poultry breeding, and discloses siRNA for targeted inhibition of chicken ULK2 expression and application thereof. The siRNA comprises ULK2-1170 (ULK2-1170 The siRNA can inhibit the expression of the chicken ULK2 gene in a targeted manner, the expression of the chicken ULK2 gene can be effectively reduced after the siRNA is transferred into chicken primary myoblasts, the inhibition efficiency reaches 50% or above, and the knock-down efficiency is very high; the siRNA identifies the gene function by specifically knocking down the expression of the chicken ULK2 gene in vitro, can be used as a molecular marker to be applied to genetic breeding of high-quality broiler leg muscle development, and has great economic value and scientific research value.

Description

Technical Field

[0001] The invention belongs to the technical field of poultry breeding, and particularly relates to a siRNA for targeted inhibition of chicken ULK2 expression and an application thereof. Background Art

[0002] Poultry skeletal muscle (mainly breast muscle and leg muscle) is not only the main locomotion organ, but also an important animal protein, accounting for about 40% of chicken production. The leg muscle weight / meat yield of local high-quality chickens in my country is much lower than that of large domestic and foreign broilers. It is of great theoretical and practical significance to explore genes / molecular markers closely related to the development of leg muscles in high-quality broilers. UNC-51-like autophagy-activated kinase 2 (ULK2) is a member of the serine / threonine kinase family and plays an important role in the initiation of autophagy in mammalian cells. It is also involved in many other biological processes, including cell fate determination, metabolism, transcriptional control and tumorigenesis. In poultry, there are few reports on the study of ULK2 gene, and there is no related report on knocking down the expression of chicken ULK2 gene using siRNA in the prior art. Therefore, knocking down the expression of chicken ULK2 gene using siRNA confirms the role of ULK2 gene in the development of chicken leg muscle, which can be used as a molecular marker for molecular genetic breeding of high-quality broiler leg muscle development, shortening the generation interval and increasing breeding progress. Summary of the invention

[0003] In view of the technical problems existing in the above-mentioned prior art, the present invention provides a siRNA capable of targetedly inhibiting the expression of chicken ULK2 gene. After being transferred into chicken primary myoblasts, the expression of chicken ULK2 gene can be effectively reduced, and the inhibition efficiency is more than 50%, and the knockdown efficiency is very high.

[0004] The objective of the present invention is achieved through the following technical solutions:

[0005] In a first aspect, the present invention provides a siRNA for targeted inhibition of chicken ULK2 gene expression, wherein the siRNA is ULK2-1170, ULK2-1332 or ULK2-1336;

[0006] The sequence of the sense strand of ULK2-1170 is shown in SEQ ID NO: 1, and the sequence of the antisense strand is shown in SEQ ID NO: 2, and each siRNA sequence is suffixed with a TT base overhang;

[0007] The sequence of the sense strand of ULK2-1332 is shown in SEQ ID NO: 3, and the sequence of the antisense strand is shown in SEQ ID NO: 4, and each siRNA sequence is suffixed with a TT base overhang;

[0008] The sequence of the sense strand of ULK2-1336 is shown in SEQ ID NO: 5, and the sequence of the antisense strand is shown in SEQ ID NO: 6. Each siRNA sequence is suffixed with a TT base overhang.

[0009] In a second aspect, the present invention provides the use of the siRNA targeting and inhibiting the expression of chicken ULK2 in the genetic breeding of high-quality broiler leg muscle development.

[0010] The application is specifically: designing siRNA for chicken ULK2 gene expression, transfecting the siRNA into chicken primary myoblasts, and using the siRNA to knock down chicken ULK2 gene expression.

[0011] Furthermore, 125ul of DEPC water was added to dilute every 1OD of synthesized siRNA to a final concentration of 20uM / ul and stored at -20°C until use.

[0012] Furthermore, the specific steps of transfecting chicken primary myoblasts with siRNA are as follows:

[0013] The primary chicken myoblasts isolated and extracted from the leg muscle tissue of 13-embryonic-age chickens were used as transfected cells. The isolated primary chicken myoblasts were inoculated into a 12-well culture plate. When the cell density grew to 60%, the original culture medium in the culture dish was aspirated and replaced with fresh serum-free culture medium. The siRNA was transfected into the primary chicken myoblasts with the help of the transfection reagent Lipofectamine3000.

[0014] The specific transfection system is as follows: 162uL opti-MEM culture medium, 5ul siRNA with a final concentration of 20uM, 8ul Hiperfect transfection, incubate for 9 minutes to form a transfection complex, and transfect into the culture medium.

[0015] The present invention has the following beneficial effects: provides a siRNA capable of targeted inhibition of chicken ULK2 gene expression, which can effectively reduce the expression of chicken ULK2 gene after being transferred into chicken primary myoblasts, with an inhibition efficiency of more than 50%, and a high knockdown efficiency. The siRNA of the present invention identifies the gene function by specifically knocking down the expression of chicken ULK2 gene in vitro, can be used as a molecular marker in the genetic selection and breeding of high-quality broiler leg muscle development, accelerates genetic progress, shortens the generation interval, and has great economic value and scientific research value. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 is the expression of ULK2 in the muscle tissue of chicken legs of the two breeds (different letters represent significant differences (P < 0.05), the same letters represent insignificant differences (P > 0.05); ** represents significant differences (P < 0.01));

[0017] Figure 2 is the expression of ULK2 in chicken primary myoblasts (different letters indicate significant differences (P<0.05));

[0018] Figure 3 The expression changes of ULK2 gene after exogenous transfection of ULK2 siRNA (different letters represent significant differences (P < 0.05), and the same letters represent no significant differences (P > 0.05));

[0019] Figure 4 The proliferation changes of primary chicken myoblasts after exogenous transfection of ULK2 siRNA (* indicates significant difference (P < 0.05));

[0020] Figure 5 The expression changes of myoblast differentiation marker genes (Myod and MyoMarker) after exogenous transfection of ULK2 siRNA. DETAILED DESCRIPTION

[0021] The present invention is further described and defined by the following examples but is not limited thereto. The experimental methods in the following examples are conventional methods unless otherwise specified. The present invention is further described below in conjunction with the accompanying drawings.

[0022] Example 1 Detection of ULK2 gene expression in chicken leg muscle tissue by fluorescence quantitative PCR

[0023] 1.1 Expression of ULK2 in leg muscle tissue

[0024] QPCR technology was used to detect the expression of ULK2 gene in leg muscle tissue of two breeds of chickens at different developmental stages. Figure 1 As shown, there are significant breed and developmental differences in the expression level of ULK2 gene in leg muscle tissue at different developmental stages in different breeds, indicating that ULK2 gene is involved in the regulation of chicken leg muscle development.

[0025] 1.2 Expression of ULK2 in leg muscle myoblasts

[0026] QPCR technology was used to detect the expression of ULK2 gene in the proliferation and differentiation stages of chicken primary myoblasts. Figure 2 As shown in the figure, the expression level of ULK2 gene in the proliferation stage of chicken primary myoblasts was significantly higher than that in the differentiation stage (P<0.01). This preliminarily indicates that ULK2 gene may have the effect of inhibiting the development of chicken leg muscle.

[0027] Example 2 Screening of siRNA sequences targeting chicken ULK2 gene

[0028] 2.1 ULK2 gene siRNA design

[0029] According to the NCBI online database, the mRNA sequence information of the chicken ULK2 gene was obtained (accession number: XM_040687342.2), and the siRNA targeting the CDS region of the chicken ULK2 gene was designed using the si Catch TM siRNA design software. The siRNA sequence was suffixed with a TT base overhang. The designed siRNA was synthesized by Suzhou Jima Biotechnology Co., Ltd. After synthesis, 125ul of DEPC water was added to each 1OD of siRNA to dilute it, and the final concentration was 20uM / ul, and it was stored at -20°C for use. The sequence of the designed siRNA is shown in Table 1.

[0030] Table 1 siRNA sequences

[0031]

[0032] 2.2siRNA transfection of primary chicken myoblasts

[0033] Chicken primary myoblasts isolated and extracted from 13-embryonic chicken leg muscle tissue were used as transfected cells. The isolated and extracted chicken primary myoblasts were inoculated into a 12-well culture plate. When the cell density grew to 60%, the original culture medium in the culture dish was aspirated and replaced with fresh serum-free culture medium. The siRNA targeting the chicken ULK2 gene and the negative control siRNA (NC) were transfected into the chicken primary myoblasts respectively with the help of the transfection reagent Lipofectamine3000, and 3 replicate wells were set for each group.

[0034] The specific transfection system is as follows: experimental group: 162uL opti-MEM culture medium + 5ul final concentration of 20uM siRNA + 8ul Hiperfect transfection; control group: 162uL opti-MEM culture medium + 5ul final concentration of 20uM Negative + 8ul Hiperfect transfection, incubate for 9 minutes to form a transfection complex, and transfect into the culture medium.

[0035] 2.3 RNA extraction and cDNA preparation

[0036] After 24 hours of transfection, each well was washed 3 times with PBS, and 0.6 ml of TROZL was added to the culture dish to collect the cells. The RNA isolater Total RNA Extraction Reagent of Nanjing Novozyme Biotechnology Co., Ltd. was used to extract the total RNA of the cells in the ULK2 siRNA transfected group and the control group. The RNA concentration was determined by a nucleic acid quantifier. cDNA synthesis was performed according to the instructions of the reverse transcription kit of Dalian Bao Bioengineering Co., Ltd.

[0037] 2.4 Real-time fluorescence quantitative PCR detection of siRNA interference efficiency

[0038] Hi ScriptⅢRT Super Mix for qPCR (+g DNA wiper) reagent from Nanjing Novozyme Biotechnology Co., Ltd. was selected, and the SYBR Green Ι method was used for real-time fluorescence quantitative PCR to detect the efficiency of siRNA specific interference with chicken ULK2 gene expression, and 3 replicates were set for each sample. Q-PCR reaction program: 95℃15min; 40 cycles (94℃15s, 55℃30s, 70℃30s).

[0039] The nucleic acid sequences of the ULK2 gene fluorescence quantitative PCR primers are as follows:

[0040] Upstream primer (SEQ ID NO: 7): 5'-CAGATCAGCCAACTAAGCAA-3'

[0041] Downstream primer (SEQ ID NO: 8): 5'-TTCAGTTTCCCCAATTTGACC-3'

[0042] The nucleic acid sequences of the internal reference GAPDH gene fluorescence quantitative PCR primer pair are as follows:

[0043] Upstream primer (SEQ ID NO: 9): 5'-AGAAGGCTGGGGCTCATCT-3'

[0044] Downstream primer (SEQ ID NO: 10): 5'-CAATGCCAAAGTTGTCATG-3'

[0045] The efficiency of siRNA specific knockdown of chicken ULK2 gene expression is as follows Figure 3 As shown. Figure 3 It can be seen that compared with the control group, ULK2-1170 siRNA can significantly inhibit the expression of ULK2 gene in cells (P<0.05), and the interference efficiency is more than 50%. Subsequent experiments will continue to use ULK2-1170 to study the function of ULK2 gene in chicken leg muscle development. The sense strand of ULK2-1170 is GCGUGAUUCAGAUUGUUCUTT, and the antisense strand is AGAACAAUCUGAAUCACGCTT.

[0046] 2.5 Effects of ULK2 gene knockdown on cell proliferation and myoblast differentiation marker gene expression

[0047] After 24h and 72h of ULK2-1170 siRNA transfection, the CCK8 kit was used to detect the changes in cell proliferation. Figure 4As shown in the figure, after transfection with ULK2-1170 siRNA, the proliferation of chicken primary myoblasts increased significantly (P<0.05). After 4 days of transfection, QPCR was used to detect the expression changes of myoblast differentiation marker genes Myod and Myomarker. Compared with the control group, the expression of Myod and MyoMarker genes in the siRNA transfection group was extremely significantly reduced (P<0.01). Figure 5 The experiment proved that the ULK2 gene has the effect of promoting the proliferation of chicken primary myoblasts and inhibiting the development of chicken leg muscles.

[0048] Myod gene fluorescence quantitative PCR primer pair

[0049] Upstream primer (SEQ ID NO: 11): GCTACTACACGGAATCACCAAAT

[0050] Downstream primer (SEQ ID NO: 12): CTGGGCTCCACTGTCACTCA

[0051] MyoMarker gene fluorescence quantitative PCR primer pair

[0052] Upstream primer (SEQ ID NO: 13): TGGGTGTCCCTGATGGC

[0053] Downstream primer (SEQ ID NO: 14): CCCGATGGGTCCTGAGTAG

[0054] The above description is only a preferred embodiment of the present invention, but is not intended to limit the present invention. Those skilled in the art may make possible changes and modifications to the present invention using the technical contents disclosed above without departing from the scope of the technical solution of the present invention, or modify it into an equivalent embodiment of equivalent changes. Any simple modification, equivalent change and modification made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention shall fall within the protection scope of the technical solution of the present invention.

Claims

1. A siRNA targeting and inhibiting the expression of chicken ULK2 gene, characterized in that: The siRNA is ULK2-1170, ULK2-1332 or ULK2-1336; The sequence of the sense strand of ULK2-1170 is shown in SEQ ID NO: 1, and the sequence of the antisense strand is shown in SEQ ID NO: 2, and each siRNA sequence is suffixed with a TT base overhang; The sequence of the sense strand of ULK2-1332 is shown in SEQ ID NO: 3, and the sequence of the antisense strand is shown in SEQ ID NO: 4, and each siRNA sequence is suffixed with a TT base overhang; The sequence of the sense strand of ULK2-1336 is shown in SEQ ID NO: 5, and the sequence of the antisense strand is shown in SEQ ID NO:

6. Each siRNA sequence is suffixed with a TT base overhang.

2. Use of the siRNA targeting and inhibiting the expression of chicken ULK2 according to claim 1 in the genetic breeding of high-quality broiler leg muscle development.

3. The use according to claim 2, characterized in that: The application is specifically: designing siRNA for chicken ULK2 gene expression, transfecting the siRNA into chicken primary myoblasts, and using the siRNA to knock down chicken ULK2 gene expression.

4. The use according to claim 3, characterized in that: After synthesis, 125ul of DEPC water was added to dilute every 1OD of siRNA to a final concentration of 20uM / ul and stored at -20℃ until use.

5. The use according to claim 2, characterized in that: The specific steps of siRNA transfection of chicken primary myoblasts are as follows: The primary chicken myoblasts isolated from the leg muscle tissue of 13-year-old embryonic chickens were used as transfected cells. The isolated primary chicken myoblasts were inoculated into a 12-well culture plate. When the cell density grew to 60%, the original culture medium in the culture dish was aspirated and replaced with fresh serum-free culture medium. The transfection reagent Lipofectamine 3000 siRNA was transfected into chicken primary myoblasts; The specific transfection system is as follows: 162uL opti-MEM culture medium, 5ul siRNA with a final concentration of 20uM, 8ul Hiperfect transfection, incubate for 9 minutes to form a transfection complex, and transfect into the culture medium.

Images