Application of dsOdfoCYP301A1 in prevention and control of odontotermes formosanus

Abstract

The invention discloses application of dsRNA (double-stranded ribonucleic acid) capable of silencing an odontotermes formosanus OdfoCYP301A1 gene in a targeted manner in the field of termite prevention and control. The dsOdfoCYP301A1 RNA interference (RNAi) system of odontotermes formosanus, which is successfully constructed and implemented on the basis of a feeding method, shows an efficient inhibition capability on the expression of the OdfoCYP301A1; by applying the system, the odontotermes formosanus dsOdfoCYP301A1 is combined with the insect growth regulator, namely the food-inhibiting hydrazine, so that the control effect of the food-inhibiting hydrazine on the odontotermes formosanus is remarkably improved. The invention not only lays a solid theoretical foundation for developing a green, environment-friendly, accurate and efficient detoxification enzyme inhibitor, but also opens up a brand new strategy path for achieving the goal of green and sustainable development in China, and has extremely important significance and wide application prospects in ecological protection, agricultural production and other aspects.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to application of dsOdfoCYP301A1 in the prevention and treatment of black-winged termites. Background Art

[0002] Termites are a worldwide pest that causes serious damage to buildings, water conservancy facilities, agricultural and forestry crops, etc., resulting in huge economic losses. Termites are a key pest in my country. According to incomplete statistics, the economic losses caused by termites in the world each year are as high as 40 billion US dollars; the direct economic losses caused by termites in my country have reached 1.9 billion yuan, and the indirect losses caused are inestimable (Lin Wei et al., 2019; Huang Weirong et al., 2004). The black-winged soil termite Odontotermes formosanus (Shiraki) is a soil-dwelling termite species that builds nests underground, has a diverse diet and a wide range of damage (Xu Zhide et al., 2007; Zhang Xiaojie et al., 2023; Zhong Dengqing et al., 1997; Xiang Jianping et al., 2012). The hazards are highly hidden and difficult to detect in the early stages. By the time they are discovered, they have already caused serious damage. For example, they can damage trees, corrode tree trunks, make them hollow and die; and they can destroy dams and cause them to burst (Luo Peilie, 1981; Liu Xiangyang, 2011).

[0003] In the field of termite control, chemical control is currently the most commonly used method. It has significant advantages such as being simple, easy to use, highly effective, and quick to take effect. However, it cannot be ignored that the use of chemical drugs will pollute the environment, harm human health, and damage the ecological balance. In comparison, biological agents have the advantages of high efficiency, low toxicity, and environmental friendliness (Wo Yubao et al., 2021). It can be seen that the active research and development of new biological agents is of great significance and value for the effective control of black-winged termites.

[0004] The basic principle of RNA interference (RNAi) is to use double-stranded RNA (dsRNA) or hairpin RNA (hpRNA) to induce the degradation of homologous mRNA in eukaryotic organisms, thereby achieving the biological phenomenon of downregulating gene expression (Mo Qing et al., 2022; Zhang Jianzhen et al., 2021). As an emerging pest control technology, RNAi has shown many advantages in the process of pest control, such as high control effect, good balance between specificity and broad spectrum, and high biosafety (Wang Cong et al., 2018).

[0005] Cytochrome P450 is widely distributed in animals, plants and microorganisms, and contains heme and thiol. When reduced, cytochrome P450 can combine with carbon monoxide to produce a specific absorption peak at a wavelength of 450nm, hence the name cytochrome P450. The enhancement of insecticide detoxification metabolism mediated by insect cytochrome P450 is one of the important reasons for insect resistance to insecticides. This metabolic resistance mechanism is common in insect resistance to various types of insecticides (Qiu Xinghui, 2014). Cytochrome P450-mediated insect resistance is mainly manifested in three aspects: enhanced P450 enzyme activity in resistant strains, overexpression of P450 genes, and changes in P450 protein structure. Studies have shown that insects mainly enhance their ability to metabolize insecticides by regulating the activity of detoxification enzymes in their bodies (Li Peizheng et al., 2014; Wang Qinqin et al., 2017). By silencing the OdfoCYP301A1 gene with double-stranded dsRNA, the pest's ability to detoxify and metabolize the agent can be effectively weakened, thereby enhancing the agent's toxic effects on the pest. In this way, not only can the dosage of the agent be reduced, but its effectiveness in controlling termites can also be significantly improved. Based on this, using RNAi technology, the corresponding dsRNA is designed and synthesized according to the characteristics of the OdfoCYP301A1 gene, which is expected to reduce the amount of agent applied, enhance the effectiveness of the agent in the control of black-winged termites, and open up a new, more efficient and environmentally friendly way for termite control. Summary of the invention

[0006] The purpose of the present invention is to provide the application of black-winged soil termite dsOdfoCYP301A1 in the control of black-winged soil termites. Among them, black-winged soil termite dsOdfoCYP301A1 is synthesized by the applicant for the first time, and its introduction into the body of termites can significantly improve the control effect of the drug hydrazine on black-winged soil termites.

[0007] In order to achieve the above purpose, the specific technical solution adopted by the present invention is:

[0008] The invention discloses an application of dsOdfoCYP301A1 in the control of black-winged termites. The dsOdfoCYP301A1 is a dsRNA of black-winged termites. The nucleotide sequence of OdfoCYP301A1 is shown in SEQ ID NO: 1. The nucleotide sequence targeted by the synthesized dsOdfoCYP301A1 is shown in SEQ ID NO: 2.

[0009] Furthermore, the dsOdfoCYP301A1 was amplified by PCR using the upstream primer dsOdfoCYP301A1F and the downstream primer dsOdfoCYP301A1R, wherein:

[0010] The upstream primer dsOdfoCYP301A1F was: TCCCCCGGGATCATAGACGCAGCGAAGT;

[0011] The downstream primer dsOdfoCYP301A1R is: ATTGCGGCCGCACAGATGGCAGCACTCGTA.

[0012] Furthermore, dsOdfoCYP301A1 and termite insecticide were used together to treat black-winged termites.

[0013] Furthermore, the insecticide is hydrazine.

[0014] The present invention also provides a recombinant expression vector, which expresses the above-mentioned dsOdfoCYP301A1.

[0015] The present invention also provides a host bacterium, which is used to transform the above-mentioned recombinant expression vector.

[0016] The present invention also provides a method for preventing and controlling termites, which comprises treating termites with the above-mentioned dsOdfoCYP301A1 and an insecticide.

[0017] Furthermore, the termites were first fed with dsOdfoCYP301A1 and then fed with the insecticide.

[0018] Furthermore, after feeding the black-winged termites with 600 μL, 500 ng / μL dsOdfoCYP301A1 for 24 hours, the black-winged termites were treated with 2.30 mg / mL hydrazine solution for 96 hours.

[0019] The present invention also provides an application of a black-winged earth termite dsRNA in improving the toxicity of a termite insecticide. The black-winged earth termite dsRNA is dsOdfoCYP301A1.

[0020] Beneficial effects of the present invention:

[0021] The present invention synthesizes dsOdfoCYP301A1 of black-winged termites by using the technology of HT115 (DE3) to expand dsRNA for the first time, designs dsOdfoCYP301A1 based on the OdfoCYP301A1 gene, studies and establishes a dsOdfoCYP301A1 RNA interference system for black-winged termites by using a feeding method, and concludes that feeding has achieved a significant gene interference effect in black-winged termites, providing a theoretical basis and technical support for the application of RNAi technology of dsOdfoCYP301A1. At the same time, by using the HT115 (DE3) strain to construct a dsRNA expression system, the interference cost is reduced. The dsOdfoCYP301A1 synthesized by the present invention using the system successfully interferes with the expression of the OdfoCYP301A1 gene, and finds that after the OdfoCYP301A1 gene is silenced, the toxicity of hydrazine to black-winged termites can be significantly increased. The experiment found that the mortality rate of black-winged termites was significantly increased when dsOdfoCYP301A1 was used together with hydrazine, indicating that it can improve the control effect of insect growth regulators. The present invention provides a theoretical basis for the development of green, environmentally friendly, precise and efficient detoxification enzyme inhibitors, and ultimately provides a new strategy for my country to achieve green and sustainable development. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The mortality rate of black-winged termites after being treated with a combination of hydrazine and cytochrome P450 enzyme inhibitor piperonyl butoxide (PBO);

[0023] Note: “*” indicates significant differences among different treatments

[0024] Figure 2 The relative expression level of OdfoCYP301A1 in black-winged termites after being treated with hydrazine;

[0025] Figure 3 is the relative expression level of OdfoCYP301A1 after 6h, 12h, 24h and 48h of dsRNA feeding;

[0026] Figure 4 The toxicity of dsOdfoCYP301A1 and hydrazine treatment to black-winged termites.

[0027] Note: ABCD are the mortality rates at 24h, 48h, 72h and 96h respectively, and E is the survival curve DETAILED DESCRIPTION

[0028] The experimental methods used in the following examples are conventional methods unless otherwise specified, and the materials and reagents used are commercially available unless otherwise specified.

[0029] Experimental materials and methods involved in the examples:

[0030] (1) Test insects: Black-winged termites were collected from Nanjing, Jiangsu Province. After the ant nests were collected, they were kept in an insect incubator under dark conditions of 25±1°C and relative humidity of 90±5%.

[0031] (2) Preparation of hydrazine solution

[0032] The original drug of food-inhibiting hydrazine was dissolved in acetone solution to prepare drug solutions with concentrations of 2.30 mg / mL and 8.72 mg / mL.

[0033] (3) Determination of the toxicity of hydrazine to black-winged termites

[0034] The toxicity of hydrazine to black-winged termites was determined by referring to Part 8 "Filter Paper Film Method" of the "Guidelines for Indoor Bioassay Tests of Pesticides" and modifying it.

[0035] The present invention is further described in detail below in conjunction with specific embodiments. The embodiments will help to understand the present invention, but the protection scope of the present invention is not limited to the following embodiments.

[0036] Example 1 Toxicity determination of the combined use of hydrazine and cytochrome P450 enzyme inhibitor piperonyl butoxide (PBO) against black-winged termites

[0037] Dissolve the hydrazine in acetone and prepare a concentration of 8.72 mg / mL (LC of hydrazine against black-winged termites at 48 h). 50 ) solution, and add PBO to the hydrazine solution to make the final concentration of PBO 100mg / L. Place filter paper on the bottom of each culture dish with a diameter of 70mm and wet it with water. Add 600μL of the hydrazine solution (LC) without PBO on the filter paper. 50 treatment group) and the PBO hydrazine solution (LC 50 &PBO treatment group), after acetone volatilized, 30 black-winged soil termites were placed in a culture dish, and acetone was used instead of the liquid as a control (CK), and each treatment was repeated 5 times. The treated black-winged soil termites were placed in a dark environment with a temperature of 25±1℃ and a relative humidity of 90±5%, and the death was observed and recorded every 12 hours. The mortality was corrected by the Abbott formula: (TC) / (100-C)×100% (where T represents the mortality of the treatment group and C represents the mortality of the control group).

[0038] like Figure 1 As shown in the figure, PBO can significantly increase the toxicity of hydrazine to black-winged termites. At 24h, LC 50 The adjusted mortality rate of the treatment group was 24.83%, LC 50The adjusted mortality rate of the PBO-treated group was 49.66%; at 36 h, LC 50 The adjusted mortality rate of the treatment group was 39.42%, LC 50 The adjusted mortality rate of the PBO-treated group was 92.70%; at 48h, LC 50 The adjusted mortality rate of the treatment group was 45.74%, LC 50 The corrected mortality rate of the PBO-treated group was 95.35%.

[0039] Example 2 Cloning of the full-length gene of OdfoCYP301A1

[0040] (1) Primer design: Primers were designed using PrimerPremier5 software based on the sequence of OdfoCYP301A1 obtained from transcriptome data:

[0041] c-OdfoCYP301A1F:ATGCCCTGCCTCGTATACTA;

[0042] c-OdfoCYP301A1R:TTACCTTTCTTATTAACTTGAACTTTAG.

[0043] (2) cDNA amplification and TA cloning:

[0044] The total RNA of Coptotermes nigropteroides was extracted by Trizol method, and the total RNA was used as template for reverse transcription according to the instruction of HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper) of Vazyme Company. The reverse transcription system is shown in Table 1.

[0045] Table 1. Reverse transcription system

[0046]

[0047] Using cDNA as a template, primers c-OdfoCYP301A1F and c-OdfoCYP301A1R were used for amplification, and the PCR amplification reaction was performed according to the instructions of 2×Rapid Taq Master Mix of Vazyme. The PCR amplification system is shown in Table 2, and the PCR amplification reaction conditions are: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 55°C annealing for 30 s, 72°C extension for 30 s, a total of 35 cycles; 72°C final extension for 5 min.

[0048] Table 2. PCR reaction system

[0049]

[0050]

[0051] The PCR amplification products were detected by 1% agarose gel electrophoresis and photographed under a gel imaging system. The identified correct PCR products were purified and recovered by a gel recovery kit. TA cloning was performed according to the instructions of Vazyme's Ultra-Universal TOPO Cloning Kit. The TA cloning system is shown in Table 3.

[0052] Table 3. TA cloning ligation system

[0053]

[0054] The ligation product was then transformed into DH5α competent cells. The transformation steps of the ligation product were as follows:

[0055] (1) Gently mix the ligation product with 50 μL of competent cells (DH5α) and immediately place on ice for 30 min;

[0056] (2) Heat shock in a 42°C water bath for 45 seconds, then immediately place in ice water for 2 minutes;

[0057] (3) Add 500 μL of LB liquid medium without resistance and culture at 37°C, 200 rpm / min for 60 min;

[0058] (4) Centrifuge the resuscitated product at 8000 rpm for 2 min;

[0059] (5) After centrifugation, aspirate part of the supernatant, retain 100-120 μL, mix by pipetting, and aspirate 35-50 μL, spread it evenly on LB solid medium containing Amp penicillin (final concentration 50 μg / mL) using sterilized glass beads, and culture inverted in a 37°C incubator overnight;

[0060] (6) Pick a single colony from the cultured colonies and place it in liquid LB medium supplemented with Amp penicillin (final concentration 50 μg / mL) and culture at 200 rpm / min until turbidity;

[0061] (7) The cultured single colony liquid is verified by PCR, and the qualified bacterial liquid is sent to the company for sequencing.

[0062] The sequence is shown in SEQ ID NO. 1. The full-length sequence contains an open reading frame of 1200 bp and encodes a polypeptide of 399 amino acids.

[0063] Example 3 Response of the OdfoCYP301A1 gene of Coptotermes nigropterygii to hydrazine

[0064] (1) Toxic experiment:

[0065] Filter paper was placed on the bottom of each petri dish with a diameter of 70 mm and moistened with water. 600 μL of 2.30 mg / mL (LC value of hydrazine for black-winged termites at 48 h) was added to the filter paper. 20 ) of hydrazine degrading agent, after acetone volatilized, 40 black-winged soil termites were placed in a culture dish, and acetone was used instead of hydrazine degrading agent as a control (CK), and each treatment was repeated 3 times. The treated black-winged soil termites were placed in a dark environment with a temperature of 25±1°C and a relative humidity of 90±5%, and samples were collected at 12h, 24h, 36h and 48h, and stored in a -80°C environment.

[0066] (2) cDNA amplification:

[0067] Extraction of total RNA from Coptotermes nigropteroides using Trizol

[0068] Using total RNA as a template, rapid reverse transcription was performed according to the instructions of Vazyme's HiScript IIQ RT SuperMxi for qPCR (+gDNAwiper) to synthesize cDNA. The rapid reverse transcription system is shown in Table 4:

[0069] Table 4. Rapid reverse transcription system

[0070]

[0071] (3) Real-time quantitative PCR (RT-qPCR):

[0072] LC testing by RT-qPCR 20 After the treatment with hydrazine, the expression levels of OdfoCYP301A1 in the control group and the treatment group at 12h, 24h, 36h and 48h, with RPS18 and GAPDH as internal reference genes, and the primers used for detection are as follows:

[0073] q-OdfoCYP301A1 F:TCAACAGAGCTGCAGAGTTC

[0074] q-OdfoCYP301A1 R:CATCCTAGCACCATGTCCATAC

[0075] q-RPS18 F:ATGGCAAACCCCCGTCAGTA

[0076] q-RPS18 R:CATACCACGATGCGCACGAA

[0077] q-GAPDH F:TCGTATTGGCCGTCTTGTGC

[0078] q-GAPDH R: AGCGACCATGGGTGGAATCAT;

[0079] The expression of genes was detected using Vazyme's ChamQ Blue Universal SYBR qPCR Master Mix. The RT-qPCR reaction system is shown in Table 5:

[0080] Table 5. RT-qPCR system

[0081]

[0082] Reaction procedure:

[0083] Stage 1: 95℃30s

[0084] Stage 2: 95℃10s, 60℃30s, 40cycles

[0085] Stage 3: 95℃15s, 60℃1min, 95℃15s

[0086] After obtaining the CT values ​​of the target gene and the internal reference gene, use 2 -ΔΔt Methods The relative expression levels of target genes were calculated, and the obtained data were analyzed for significant differences through independent sample T test using SPSS26.0 software.

[0087] like Figure 2 As shown in the figure, through the fluorescence quantitative experiment, it was found that OdfoCYP30A1 was significantly upregulated after the black-winged termite was treated with 2.30 mg / mL hydrazine for 12h, 24h and 36h. (*** represents P < 0.001, ** represents P < 0.01, * represents P < 0.05, ns represents no difference).

[0088] Example 4 Synthesis and inducible expression of dsOdfoCYP301A1 of Coptotermes pygmaea

[0089] (1) Primer design for synthesizing dsOdfoCYP301A1 of Coptotermes chinensis.

[0090] The sidirect online software (https: / / sidirect2.rnai.jp / ) predicted that the OdfoCYP301A1 gene had 10 potential RNAi target sites in the 346-731 bp region. Based on the cloned OdfoCYP301A1 sequence, Primer Premier 5 software was used to design primers, and restriction sites Sma I and Not I were introduced upstream and downstream (bold letters are restriction sites, and italic letters are protected bases):

[0091]

[0092] At the same time, the primers for GFP were designed, and restriction sites Sac I and HindⅢ were introduced upstream and downstream:

[0093]

[0094] All primers were synthesized by Tianjin Qingke Biotechnology Co., Ltd.

[0095] (2) cDNA amplification

[0096] The total RNA of Coptotermes nigropteroides was extracted by Trizol method.

[0097] Total RNA was used as a template and reverse transcription was performed according to the instructions of HiScipt II Strand cDNA Synthesis Kit of Vazyme to synthesize cDNA. The reverse transcription system is shown in Table 6:

[0098] Table 6. Reverse transcription system

[0099]

[0100] (3) Synthesis of dsOdfoCYP301A1 in Coptotermes pygmaea

[0101] The obtained cDNA was used as a template, and PCR amplification was performed using upstream and downstream primers designed for synthesizing dsRNA; the reaction conditions for PCR amplification were: 95℃ pre-denaturation for 3min; 95℃ denaturation for 15s, 55℃ annealing for 30s, 72℃ extension for 30s, a total of 35 cycles; 72℃ final extension for 10min. The PCR amplification products were detected by 1% agarose gel electrophoresis, and the correctly identified PCR products were purified and recovered by a gel recovery kit. The recovered target fragment and the L4440 vector were digested and linked, and the L4440-dsOdfoCYP301A1 recombinant plasmid was successfully constructed, and the L4440-dsGFP recombinant plasmid was constructed in the same way.

[0102] Taking L4440-dsOdfoCYP301A1 as an example, the synthesis process is briefly introduced. The PCR product is double-digested with Sma I and Not I; the expression vector L4440 is double-digested with these two enzymes at the same time. The double-digestion system is shown in Table 7. The double-digestion products are detected by 1% agarose gel electrophoresis, and the correctly identified products are purified and recovered by a gel recovery kit. The target fragment and the target vector are connected using T4 DNA ligase according to the system in Table 8. And the connection product is transformed into HT115 (DE3) according to the two-step method. In short, the connection product is transformed into DH 5α competent cells, cultured in LB solid medium containing ampicillin for 12h, and a single colony is picked. After verifying its correctness by PCR, it is sent to a sequencing company for sequencing. The sequencing results are compared with the sequence of the target fragment, and the plasmid of the bacterial solution that matches the target fragment is extracted. The extracted plasmid was then transformed into HT115 (DE3), cultured in LB solid medium containing ampicillin and tetracycline for 12 hours, and a single colony was picked and sent to a sequencing company for sequencing after verification of its correctness by PCR. The bacterial solution of the synthesized dsRNA with the correct sequencing results was stored and propagated.

[0103] Table 7. Double enzyme digestion system for target fragments

[0104]

[0105] 37℃ overnight (the specific enzyme cutting time should be adjusted according to the actual situation)

[0106] Table 8. Connection system

[0107]

[0108] 16℃ overnight (the specific enzyme cutting time should be adjusted according to the actual situation)

[0109] (4) Induced expression and extraction of dsRNA.

[0110] The HT115 (DE3) strain containing L4440-dsOdfoCYP301A1 and L4440-dsGFP recombinant plasmids were induced to express dsRNA, and the target fragment sizes were 386 bp and 500 bp. Then, the total RNA after induced expression was digested with DNaseⅠ and RNase A.

[0111] Taking L4440-dsOdfoCYP301A1 as an example, the correctly sequenced L4440-dsOdfoCYP301A1 recombinant plasmid was transformed into HT115 (DE3) competent bacteria, spread on LB solid medium containing ampicillin (75μg / mL) and tetracycline (12.5μg / mL) double antibodies, and inverted cultured at 37°C overnight. Pick a single clone and inoculate it in LB liquid medium containing ampicillin (75μg / mL) and tetracycline (12.5μg / mL) double antibodies, and shake and culture at 37°C, 180rpm / min until the bacterial liquid OD 600 When the concentration was about 0.5-0.6, IPTG (final concentration 0.8 mM) was added and the culture was continued at 37°C and 180 rpm / min for 4 h. Then, dsRNA was extracted using the Trizol method. dsRNA was digested using RNAse A and DNAse I. dsRNA concentration was determined using an Eppendorf BioSpectrometerbasic and stored at -80°C for later use.

[0112] Example 5 Determination of OdfoCYP301A1 expression after dsOdfoCYP301A1 interference

[0113] dsOdfoCYP301A1 (500 ng / μL) was mixed with Nile blue sulfate solution (0.1% w / w) in a volume ratio of 1:1, and then 600 μL was dripped on the filter paper at the bottom of a 70 mm diameter culture dish; dsGFP was used to replace dsOdfoCYP301A1 as a negative control, and ddH2O and Nile blue sulfate solution (0.1% w / w) were used as blank controls. 30 termites were added to each culture dish, and each group was repeated 3 times. The samples were placed in a dark environment with a temperature of 25±1°C and a relative humidity of 90±5% for observation and collection, and termites whose intestines turned blue were collected at 6h, 12h, 24h and 48h and stored at -80°C. The expression of OdfoCYP301A1 at different times and under different treatments was tested by RT-qPCR experiments, with RPS18 and GAPDH as internal reference genes. The primers used for detection are as follows:

[0114] q-OdfoCYP301A1 F:TCAACAGAGCTGCAGAGTTC

[0115] q-OdfoCYP301A1 R:CATCCTAGCACCATGTCCATAC

[0116] q-RPS18 F:ATGGCAAACCCCCGTCAGTA

[0117] q-RPS18 R:CATACCACGATGCGCACGAA

[0118] q-GAPDH F:TCGTATTGGCCGTCTTGTGC

[0119] q-GAPDH R: AGCGACCATGGGTGGAATCAT;

[0120] The RT-qPCR reaction system is shown in Table 9:

[0121] Table 9. RT-qPCR system

[0122]

[0123]

[0124] Reaction procedure:

[0125] Stage 1: 95℃30s

[0126] Stage 2: 95℃10s, 60℃30s, 40cycles

[0127] Stage 3: 95℃15s, 60℃1min, 95℃15s

[0128] After obtaining the CT values ​​of the target gene and the internal reference gene, use 2 -ΔΔt Methods The relative expression of target genes was calculated, and the obtained data were analyzed by one-way analysis of variance using SPSS26.0 software.

[0129] In order to detect the changes in the expression of the target gene at different time periods after dsRNA feeding, RT-qPCR detection was performed on the cDNA samples of black-winged termites in the control group (CK) and the dsRNA treatment group. The results showed that at 6 hours, the inhibition rate of dsOdfoCYP301A1 on the OdfoCYP301A1 gene of black-winged termites was 38.65%; at 12 hours, the inhibition rate of dsOdfoCYP301A1 on the OdfoCYP301A1 gene of black-winged termites was 61.49%; at 24 hours, the inhibition rate of dsOdfoCYP301A1 on the OdfoCYP301A1 gene of black-winged termites was 72.15%; at 48 hours, the inhibition rate of dsOdfoCYP301A1 on the OdfoCYP301A1 gene of black-winged termites was 68.22% (as shown in Table 1). Figure 3 Different lowercase letters indicate significant differences among treatments).

[0130] It can be seen that dsOdfoCYP301A1 reached the maximum interference efficiency at 24h, and 24h was the optimal interference time for the above dsRNA.

[0131] Example 6 Effect of dsOdfoCYP301A1 treatment on the toxicity of hydrazine to inhibit feeding

[0132] dsOdfoCYP301A1 (500ng / μL) was mixed with Nile Blue Sulfate Solution (0.1% w / w) in a volume ratio of 1:1, and then 600μL was dripped onto the filter paper at the bottom of a 70mm diameter culture dish; dsGFP was used as a negative control to replace dsOdfoCYP301A1, and ddH2O and Nile Blue Sulfate Solution (0.1% w / w) were used as blank controls. 30 termites were added to each culture dish. They were placed in a dark environment at a temperature of 25±1℃ and a relative humidity of 90±5% for 24h. Afterwards, the treated termites were divided into a hydrazine treatment group (2.30mg / mL hydrazine solution) and an acetone treatment group (control group) for bioassay. The treated termites were placed in a dark environment at a temperature of 25±1℃ and a relative humidity of 90±5%, and the mortality rate was observed and calculated at 24h intervals.

[0133] Through bioassay experiments, it was found that after being treated with dsOdfoCYP301A1, the resistance of black-winged termites to hydrazine was significantly reduced. At 24h, the mortality rate of the dsOdfoCYP301A1 combined with hydrazine treatment group was the highest, reaching 22.00%, followed by the dsOdfoCYP301A1 treatment group with a mortality rate of 18.67%; at 48h, the dsOdfoCYP301A1 combined with hydrazine treatment group showed the highest mortality rate of 52.00%, while the mortality rate of the dsOdfoCYP301A1 treatment group was 43.33%; at 72h, the mortality rate of the dsOdfoCYP301A1 combined with hydrazine treatment group was the highest, at 68.67%, followed by the dsOdfoCYP301A1 treatment group with a mortality rate of 53.33%; at 96h, the mortality rate of the dsOdfoCYP301A1 combined with hydrazine treatment group was 86.00%, while the mortality rate of the dsOdfoCYP301A1 treatment group was 68.00%. The survival curve showed that the survival rate of the dsOdfoCYP301A1 and hydrazine combined treatment group was significantly lower than that of the dsGFP and hydrazine combined treatment group and the dsOdfoCYP301A1 treatment group ( Figure 4 ). *** represents P < 0.001, ** represents P < 0.01, * represents P < 0.05, and ns represents no difference.

[0134] The above is only a preferred embodiment of the present invention. It should be noted that, for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered as the protection scope of the present invention. All components not specified in this embodiment can be implemented by existing technologies.

Claims

1. ds OdfoCYP301A1 The application in the control of black-winged termites is characterized in that: The ds OdfoCYP301A1 dsRNA of Coptotermes nigropteroides ， The OdfoCYP301A1 The nucleotide sequence is shown in SEQ ID NO: 1; the synthetic ds OdfoCYP301A1 The targeted nucleotide sequence is shown in SEQ ID NO:

2.

2. The use according to claim 1, characterized in that The ds OdfoCYP301A1 Upstream primer ds OdfoCYP301A1 F and downstream primer ds OdfoCYP301A1 R is amplified by PCR, where Upstream primer ds OdfoCYP301A1 F is: TCC CCCGGGATCATAGACGCAGCGAAGT; Downstream primer ds OdfoCYP301A1 R is: ATTT GCGGCCGCACAGATGGCAGCACTCGTA.

3. The use according to claim 1, characterized in that ds OdfoCYP301A1 Use with termite insecticide to treat black-winged termites.

4. The use according to claim 3, characterized in that The insecticide is hydrazine.

5. A recombinant expression vector, characterized in that: It expresses the ds described in claim 1 OdfoCYP301A1 .

6. A host bacterium, characterized in that The recombinant expression vector according to claim 5 is transformed therein.

7. A method for preventing and controlling termites, characterized in that: Using the ds described in any one of claims 1 to 4 OdfoCYP301A1 Use with insecticide to treat termites.

8. The method according to claim 7, characterized in that Use ds first OdfoCYP301A1 After feeding the termites, feed them insecticide.

9. The method according to claim 7, characterized in that: First, use 600 μL, 500 ng / μL ds OdfoCYP301A1 After feeding on black-winged termites for 24 hours, the black-winged termites were treated with 2.30 mg / mL hydrazine solution for 96 hours.

10. A use of dsRNA of black-winged termites for improving the toxicity of termite insecticides, characterized in that: The black-winged termite dsRNA is ds OdfoCYP301A1 .

Images