Nucleic acid aptamer targeting motts-c and use thereof

Abstract

The application belongs to the technical field of biological medicine, and particularly relates to a nucleic acid aptamer targeting MOTS-c and application thereof. The target sequence of the aptamer is SEQ ID NO:1, and the sequence of the nucleic acid aptamer is SEQ ID NO:2. The aptamer has good affinity with MOTS-c, can significantly inhibit the stemness characteristics of cancer cells by treating the cancer cells, significantly improve the lung metastasis of tumor-bearing mice, has good blocking effect on MOTS-c in vivo and in vitro, and has a certain anti-tumor metastasis treatment effect.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, and in particular relates to a nucleic acid aptamer targeting MOTS-c and its application. Background Technology

[0002] Breast cancer is a common malignant tumor in women. Metastasis is the main cause of treatment failure, recurrence, and death in breast cancer patients, and cancer cell stemness is closely related to tumor metastasis. Reducing cancer cell stemness is of great significance for inhibiting tumor metastasis, improving treatment efficiency, reducing recurrence, and improving patient survival rates.

[0003] In a study, the applicant's research group discovered that mast cells in metastatic lymph nodes increase cancer cell stemness and promote distant metastasis by secreting LCN2. Further research revealed that LCN2 mediates these effects by upregulating a mitochondrial peptide, MOTS-c, in cancer cells. MOTS-c is encoded by the mitochondrial 12S rRNA sORF. MOTS-c has been reported to act as a retrograde signal, regulating nuclear transcription through nuclear translocation, responding to glucose deprivation, and regulating glycolysis, playing a crucial role in diseases such as diabetes, obesity, neuromuscular degenerative diseases, and aging. In lymph node metastases, we found that MOTS-c promotes the stem-like characteristics of tumor cells and distant metastasis. Targeting MOTS-c may be a key approach to effectively inhibit distant organ metastasis, but currently, there is a lack of inhibitors targeting MOTS-c. Nucleic acid aptamers are oligonucleotide sequences synthesized in vitro using Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technology. They can interact with target molecules with high affinity through hydrogen bonds, electrostatic interactions, hydrophobic interactions, and van der Waals forces, thereby achieving specific recognition or blocking of target molecules. In this project, we designed and constructed the MOTS-c nucleic acid aptamer to specifically block the function of MOTS-c, thereby exerting an anti-tumor metastasis effect. Summary of the Invention

[0004] In order to address the above-mentioned problems in existing technologies and to inhibit distant tumor metastasis and improve patient survival rates, this invention provides a nucleic acid aptamer targeting MOTS-c and its application.

[0005] The present invention adopts the following technical solution

[0006] A nucleic acid aptamer targeting MOTS-c, wherein the target sequence of the nucleic acid aptamer is SEQ ID NO: 1: MKWEEMGYIFL.

[0007] Furthermore, the sequence of the nucleic acid aptamer is: TGACACCGTACCTGCTCTGCCAAGCACGCCAAGGGACTAT, SEQ ID NO: 2.

[0008] A pharmaceutical composition comprising the above-described nucleic acid aptamer and a pharmaceutically acceptable carrier.

[0009] The applications of the aforementioned nucleic acid aptamers include any one or more of the following:

[0010] A) Application in anti-tumor metastasis drugs;

[0011] B) Used in the preparation of MOTS-c detection or diagnostic reagents, kits, or sensors;

[0012] C) Used for the preparation of MOTS-c capture, separation, and purification formulations;

[0013] D) Used in the preparation or construction of MOTS-c targeted drug delivery systems;

[0014] E) Used to detect or assess tumor metastasis;

[0015] The tumors include breast cancer.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The inventors discovered in their research on tumor metastasis that MOTS-c is highly expressed in cancer cells that have metastasized to lymph nodes. In in vitro experiments, using cell spheroidization assays and flow cytometry to detect the activity of the stem cell marker ALDH1, they found that MOTS-c promotes stem cell-like characteristics in cancer cells. Tumor stem cells are considered a subpopulation of cells with strong metastatic potential. Therefore, in vivo experiments further verified that MOTS-c can promote distant organ metastasis of tumors. Research suggests that MOTS-c is an important target for inhibiting distant tumor metastasis, but currently, there is a lack of specific inhibitors of MOTS-c. Therefore, the inventors designed and constructed the inhibitory aptamer for MOTS-c of this invention. This aptamer has a good affinity for MOTS-c, and treatment of cancer cells with this aptamer significantly inhibits the stem cell characteristics of cancer cells. Treatment of tumor-bearing mice with the MOTS-c aptamer significantly improved lung metastasis in tumor-bearing mice. Experimental results show that the constructed aptamer has a good blocking effect on MOTS-c both in vivo and in vitro, and that the aptamer has a certain therapeutic effect against tumor metastasis. Attached Figure Description

[0018] Figure 1 The results of LC-MS for cancer cells in situ and metastatic lymph nodes in Example 1;

[0019] Figure 2The expression results of MOTS-c in EO771 treated with LCN2 in Example 1;

[0020] Figure 3 The results of the EO771 mammary globulization experiment after MOTS-c treatment in Example 2;

[0021] Figure 4 The expression results of the EO771 dry marker ALDH1 treated with MOTS-c in Example 2.

[0022] Figure 5 This is a schematic diagram of the MOTS-c aptamer construction process in Example 3;

[0023] Figure 6 The results of the affinity test between MOTS-c aptamer ML11-1 and the target molecule in Example 3;

[0024] Figure 7 The effect of aptamer treatment on cancer cell stemness in Example 4;

[0025] Figure 8 The effect of aptamer therapy on cancer cell invasion of lymph node blood vessels in Example 4;

[0026] Figure 9 The effect of aptamer treatment in Example 4 on lung metastases of breast cancer and oral squamous cell carcinoma in mice. Detailed Implementation

[0027] To facilitate understanding of the present invention, a more complete description will be given below with reference to the accompanying drawings and embodiments. Preferred embodiments of the invention are shown in the embodiments. However, the invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided so that a thorough and complete understanding of the disclosure of the invention will be achieved.

[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the specification of this invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0029] Unless otherwise specified, all reagents used in the following examples are commercially available; and all methods used in the following examples are conventional methods unless otherwise specified.

[0030] Example 1: MOTS-c highly expressed in metastatic cancer cells colonized in lymph nodes

[0031] 1. Detection of MOTS-c expression in cancer cells with lymph node metastasis

[0032] 1.1 Liquid chromatography-mass spectrometry (LC-MS):

[0033] Breast cancer cells were isolated from orthotopic tumors and metastatic lymph nodes of tumor-bearing mice. After washing with PBS, the cells were centrifuged at 1000 rpm for 5 min. The cell pellet was lysed with RIPA lysis buffer (Cat# p0013b, Beyotime) containing a mixed phosphatase protease inhibitor (Cat# 78441, Thermo Fisher Scientific), centrifuged at 12000 rpm for 20 min at 4 °C, and the supernatant was collected. Protein concentration was determined by the BCA method. 200-300 μg of protein was diluted to 100 μL with 50 mM NH4CO3, and 4 volumes of pre-chilled acetone were added. The pellet was incubated overnight at -20 °C. The pellet was centrifuged at 15,000 × g at 4 °C for 30 min, and the supernatant was discarded. The pellet was washed sequentially with 500 μL of cold acetone, 500 μL of cold 70% ethanol, and 500 μL of cold acetone, and centrifuged at 4 °C. The pellet was lyophilized and resuspended in 50 μL of LUA buffer. DTT reduction: Add 2 μL of 50 mM DTT to 50 mM ABC (final DTT concentration 2 mM), and incubate at 30°C for 1.5 h. IAA alkylation: Add 13 μL of 50 mM IAA to 50 mM ABC (final IAA concentration 10 mM), and incubate at room temperature in the dark for 45 min. Dilute with 50 mM ABC to 600 μL (final urea concentration approximately 0.7 M). Add Trypsin in 50 mM ABC at a ratio of 1:40 or 1:50 (w:w, enzyme:protein), and incubate at 37°C for 12-18 h. The reaction was terminated by acidification with 10% TFA to a final concentration of 0.4%. The filtrates were combined, desalted by an SPE column, vacuum-suspended, reconstituted with 0.1% FA, vortexed for 5 min, centrifuged at 15000 rpm and 4℃ for 30 min, and the supernatant was used to determine the concentration. The sample was prepared at 500 ng / μl, and the peptide concentration was determined. The sample was stored at -80℃.

[0034] Data Processing: Peptidomics data were processed using Proteome Discoverer (v2.4) on an internally constructed database based on the uniport mouse+ musculus-17440. Differential screening criteria were: ratio >1.5 or <0.67, p-value <0.05. For further analysis, precursor MS was set to 10 ppm, and EthcD MS / MS tolerance was set to 0.6 Da. Data were calculated using label-free quantification (LFQ) in Proteome Discoverer.

[0035] 1.2 Western blotting detection

[0036] EO771 cells were treated with 1640 medium with or without recombinant LCN2 (2 μg / ml, Cat# HY-P70658A, MedChemExpress) for 48 h. After treatment, the medium was discarded, and the cells were washed twice with pre-chilled PBS. RIPA lysis buffer (Cat# p0013b, Beyotime) containing protease inhibitors and phosphatase inhibitors (Cat# 78441, Thermo Fisher Scientific) was added to lyse the cells. Cells were scraped off with a pre-chilled cell scraper, and the cell suspension was transferred to 1.5 ml EP tubes. The cells were centrifuged at 12000 rpm for 20 min at 4 °C, and the supernatant was transferred to a new EP tube. Protein concentration was detected using a BCA protein assay kit (Cat#23235, Thermo Fisher Scientific). Proteins were denatured by boiling in 1X loading buffer for 5 min. Equal volumes of protein sample and molecular weight markers were loaded into SDS-PAGE gel wells for electrophoresis separation, and the protein was transferred to a PVDF membrane. PVDF membranes were blocked with 5% BSA for 1 hour and incubated overnight with MOTS-c primary antibody (Cat# PAX132Mu01, Cloud-Clone Corp). The membranes were washed three times with TBST, incubated with HRP-conjugated secondary antibody for 1 hour, and the grayscale values ​​were analyzed using ImageJ by chemiluminescence detection (Cat#32106, Thermo Fisher Scientific).

[0037] 1.3 Results

[0038] 1.3.1 LC-MS analysis showed that MOTS-c expression was significantly increased in lymph node metastases compared to cancer cells in the primary tumor. Figure 1 ).

[0039] 1.3.2 Protein imprinting analysis showed that LCN2 stimulation significantly upregulated MOTS-c expression in EO771 cells (P < 0.0001). Figure 2 ).

[0040] The above results indicate that MOTS-c is highly expressed in breast cancer cells with lymph node metastasis.

[0041] Example 2: Study on the role of MOTS-c in promoting stem-like characteristics of cancer cells

[0042] 2.1 Cell spheroid formation experiment

[0043] Stem cell culture medium preparation: DMEM / F12, with 2% B27 containing 20 ng / ml mEGF and 20 ng / ml mFGF.

[0044] EO771 cells were cultured in ultra-low adsorption cell culture plates (Corning) at a concentration of 1000 cells / well in stem cell culture medium with or without 10 μM MOTS-c. After 10 days, dead cells were excluded by staining with 2.5 μM CFSE (Cat# C34554, Invitrogen) and photographed under a laser scanning confocal microscope (LSM880, Zeiss).

[0045] 2.2 Flow cytometry detection of changes in the expression level of ALDH1, a tumor stem cell marker, after exogenous MOTS-c treatment.

[0046] EO771 cells were treated for 48 h in culture media with or without exogenous 10 μM MOTS-c; after digestion with 0.25% trypsin, the cells were resuspended as a single-cell suspension.

[0047] ALDH1 activity assay: ALDH1 activity was detected using the ALDEFLUOR™ Kit (Cat# 01700, Stem cell technologies). Cells were resuspended in 100 μl buffer, and 1 μl of ALDH1 substrate was added to each sample. The negative control group was added with 1 μl of ALDH1 substrate and 2 μl of DEAB. Cells were incubated at 37 °C for 1 h, washed twice with PBS, and then analyzed using a CytoFLEX flow cytometer.

[0048] 2.3 Results

[0049] 2.3.1 Cell spheroid formation assay showed that, compared with the control group, EO771 cells treated with MOTS-c formed cell spheroids more readily. Figure 3 ).

[0050] 2.3.2 Flow cytometry results showed that the ALDH1 activity of EO771 cells treated with MOTS-c was significantly higher than that of the control group.P <0.0001 ( Figure 4 ).

[0051] The above results indicate that MOTS-c can increase stem cell-like characteristics in cancer cells.

[0052] Example 3: Construction of the MOTS-c aptamer

[0053] MOTS-c aptamer construction process (e.g.) Figure 5 Specifically, it includes:

[0054] 3.1 Screening experiment using the magnetic bead-SELEX method

[0055] The target protein (Kamed Biotechnology (Tianjin) Co., Ltd.) and NHS-activated magnetic bead-coupled protein (Yisheng Biotechnology, catalog number 20563ES03) were co-incubated with the oligonucleotide library Random Library Bank 40 (Kamed Biotechnology (Tianjin) Co., Ltd.). After multiple rounds of screening and enrichment, high-affinity nucleic acid aptamers binding to MOTS-c were obtained.

[0056] The specific process is as follows:

[0057] 3.1.1. First round of combination washout

[0058] (1) 10-50 μg oligonucleotide library, 50 μl [10×] SELEX buffer, add nuclease-free water to a final volume of 500 μl.

[0059] (2) Add the oligonucleotide library from step (1) to 1000 μg of protein-coupled magnetic beads.

[0060] (3) Incubate at 37℃ with gentle shaking for 30 min-1 h.

[0061] (4) Clean the magnetic beads with 1 ml of SELEX Buffer.

[0062] Note: For screening aptamers for in vitro use, oligonucleotide libraries are incubated and washed at room temperature (25°C). For screening aptamers for in vivo use, the biological ambient temperature (e.g., 37°C) is used.

[0063] (5) The beads were incubated in 1×TE buffer at 94°C. The supernatant without the magnetic beads was quickly transferred to a new reaction tube. The DNA eluted by heating was used directly for PCR.

[0064] 3.1.2. The first round of ePCR

[0065] At least 0.5 μg of template DNA is synthesized as the starting material for the next round, plus the same amount of backup and quality control, for a total of 1-3 μg of DNA is required.

[0066] The PCR amplification system was prepared according to the ratio of aqueous phase to oil phase = 1:6 (volume ratio). The specific composition of the aqueous phase is shown in Table 1, and the primer sequences used are shown in Table 2.

[0067] Table 1. Aqueous phase composition of PCR

[0068]

[0069] Table 2 Primer Sequences

[0070]

[0071] The PCR program was as follows: 95℃ for 2 min, 95℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, 72℃ for 5 min; 15-20 cycles.

[0072] (1) Add 300 μl of pre-cooled oil phase to 50 μl of pre-cooled PCR aqueous phase, without centrifugation, rotate at maximum speed for 5 min, and dispense the mixture into 3 tubes, 100 μl per tube.

[0073] (2) Take the corresponding 3 replicate ePCR products from each round and add them to a 2 ml reaction tube. Add 1.0 ml of 2-butanol (or butanol). Vortex mix.

[0074] (3) Add 5 volumes (250 μl) of Orange-SFX buffer to the system. Gently shake on a shaker for 2 minutes. Centrifuge at 16000 g (14000 rpm) for 2 minutes to separate the phases.

[0075] (4) Remove most of the yellow organic phase. Add 1.2 volumes of 96-100% [v / v] ethanol to the aqueous phase. Mix thoroughly with a pipette (do not centrifuge).

[0076] 3.1.3. DNA Purification

[0077] (1) Place the purification column in the receiving tube, add 30 μl of Buffer SF to the membrane at the center of the bottom of the purification column, and place it at room temperature.

[0078] (2) Transfer the mixture from 3.1.2(7) to the purification column, with a maximum transfer volume of 600 μl;

[0079] (3) Centrifuge at 11000 x g (12000 rpm) for 1 min;

[0080] (4) Discard the waste liquid and reassemble the purification column onto the receiving tube;

[0081] (5) If the total volume of aqueous phase + intermediate phase + ethanol exceeds 600 μl, repeat steps (1)-(3) using the same column;

[0082] (6) Add 600 μl Wash-SFX buffer, centrifuge at 11000 x g (12000 rpm) for 1 min, discard the waste liquid, and repack the column into a tube;

[0083] (7) Add 350 μl Wash-SFX buffer, centrifuge at 11000 x g (12000 rpm) for 1 min, discard the waste liquid, and reload the purification column into the receiving tube;

[0084] (8) Centrifuge at 11000xg (12000 rpm) for 2 min, discard the waste liquid, and transfer the column to a new receiving tube (1.5-2 ml). Add 50-100 μl of elution buffer-SFX buffer to elute the DNA (heating the buffer to 80°C during elution helps improve DNA recovery).

[0085] Note: The eluent can be reduced to 50 μl, but should not be less than 20 μl.

[0086] (9) Incubate at room temperature for 2 minutes. Centrifuge at 11000 x g (12000 rpm) for 1 min;

[0087] (10) Discard the column and cover the collection pipe;

[0088] (11) Quantitative PCR yield was determined by spectrophotometry, and the size of the amplified product was verified by 3% agarose gel electrophoresis.

[0089] (12) The purified DNA was stored at -20°C for subsequent analysis / operations.

[0090] Note: For long-term storage of DNA, use a buffer solution, such as 1xTE or phosphate buffer, without adding pure water to prevent DNA from hydrolyzing on its own.

[0091] 3.1.4. Combined purification

[0092] (1) Mix 1-3 μg dsDNA with 50-100 μl [10x] SELEX buffer, and add nuclease-free water to a final volume of 500-1000 μl.

[0093] Note 1): After denaturing dsDNA at 94°C for 3 minutes, immediately placing it on an ice bath is beneficial for the formation of ssDNA secondary structure.

[0094] Note 2): Approximately 50 to 130 pmol (1 to 3 μg) of purified dsDNA was used in the second round and all subsequent screening cycles.

[0095] (2) Add 500 μg of protein-coupled magnetic beads and 500 μl of 1x SELEX buffer.

[0096] Note: It can be incubated with magnetic beads without conjugated proteins to remove non-specific binding.

[0097] (3) Incubate at 37℃ with gentle shaking for 30 minutes.

[0098] (4) Wash twice with 500 μl-1 ml SELEX buffer.

[0099] Note: Each additional round of screening requires one additional washing step.

[0100] (5) The beads were incubated in 1×TE buffer at 94°C. The supernatant without the magnetic beads was quickly transferred to a new reaction tube.

[0101] 3.1.5. Subsequent ePCR

[0102] Refer to 3.1.2 and the examples in Table 3 below for filtering.

[0103] Table 3 Aptamer Screening Process

[0104]

[0105] 3.1.6 Subsequent DNA purification

[0106] Refer to 3.1.3

[0107] After 10 rounds of SELEX screening, an ssDNA library with high affinity for MOTS-c was obtained. This library was then prepared as a sequencing sample and subjected to high-throughput paired-end sequencing by Camed Biotechnology (Tianjin) Co., Ltd.

[0108] After sequencing quality control, all non-repetitive sequences that passed quality control were screened using Lenth sequencing. Sequences with a length of 40 bp were selected as target sequences, and the most frequent sequence, ML11-1, was selected for rapid affinity identification. The sequences are shown in Table 4 below.

[0109] Table 4. Selected aptamer sequences

[0110]

[0111] 3.2 The affinity between MOTS-c aptamers and MOTS-c was assessed using biomembrane interference (BLI) technology.

[0112] 3.2.1 Biotin-ML11 (target molecule, sequence SEQ ID NO: 1) was specifically captured by the SA chip. After the signal reached 0.2 nm, it was bound to ML11-1.

[0113] 3.2.2 Dissolve Biotin-ML11 in 0.1 mL of DMSO. Dilute the dissolved peptide solution 20,000 times with 1×SD to a concentration of 0.5 μg / mL. Cure for 120 s to a curing height of 0.2 nm.

[0114] 3.2.3 Reconstitute ML11-1 with PBS buffer to the specified concentration.

[0115] Dissolve in 200 μl of 1×SD to achieve a concentration of approximately 25 μM.

[0116] 3.2.4 Add the sample to the 96-well plate in the following order.

[0117] in:

[0118] Add 1×SD buffer to A3-A5 and B3-B5 for sensor equilibration and dissociation steps;

[0119] Add A6-A10 to ML11 DNA sample at a concentration of 25 μM;

[0120] Add 1×SD buffer to B6-B10 for blank subtraction;

[0121] Add 10mM Glycine (pH 1.8) to A11 and B11 for sensor regeneration;

[0122] Add A12 and B12 to 1×SD buffer to neutralize the acidic environment of the regenerated sensor.

[0123] 3.2.5 Running the program

[0124] 3.2.6 Use Fortebio Data Analysis 12.0 software to align the data.

[0125] 3.2.7 Affinity Test Results

[0126] The interaction fitting data between the screened aptamer ML11-1 and the target molecule ML11 (e.g.) Figure 6 The results showed that the aptamer we constructed had a high affinity for MOTS-c.

[0127] Example 4: Application of MOTS-c aptamer in tumors

[0128] 4.1 MOTS-c aptamer inhibits stem cell-like characteristics of cancer cells

[0129] Mast cells were isolated from metastatic lymph nodes of tumor-bearing mice and cultured in serum-free basal medium (DMEM / F12 (Gibco)) for 48 h. Conditioned medium was then collected. EO771 cells were cultured in conditioned medium supplemented with MOTS-c aptamer ML11-1, and ALDH1 activity was detected by flow cytometry after 48 h (steps as before).

[0130] 4.2 MOTS-c aptamer inhibits distant tumor metastasis

[0131] EO771 cells and MOC2 cells were pre-transfected with lentivirus carrying the luciferase plasmid. EO771 cells (5 × 10⁻⁶) successfully transfected with the luciferase gene were then... 5 Injected into the fat pads of C57BL / 6 female wild-type mice, MOC2 (5 × 10⁻⁶) 5 The tumor cells were injected subcutaneously into another batch of female wild-type C57BL / 6 mice. After tumor formation, each mouse was administered 5 mg / kg of MOTS-c aptamer ML11-1, scramble, or an equivalent volume of saline via intravenous injection weekly for 3 weeks. Mice were euthanized within 5 weeks of tumor cell implantation, and tumor drainage lymph nodes and lungs were collected.

[0132] 4.2.1 Immunofluorescence staining of paraffin sections of tumor-draining lymph nodes

[0133] Lymph node tissue was extracted from tumor-bearing mice, fixed overnight in 4% paraformaldehyde, embedded in paraffin, and cut into serial sections of 4–6 μm. After gradient dewaxing and hydration, antigen retrieval was performed using EDTA buffer (pH 8.0). Sections were blocked in 5% BSA for 30 minutes. Primary antibodies CD31 (1:100, Cat# sc-18916, Santa Cruz Biotechnology) and Cytokeratin (1:100, Cat# c2562, Sigma; Cat# ab9377, Abcam) were diluted with 1% BSA and used to cover the tissue sections, which were then incubated overnight at 4 °C. The next day, the sections were washed three times with PBS. Alexa Fluor-conjugated secondary antibody (1:300 dilution) and DAPI (Cat #422081, BioLegend) were mixed and used to cover the tissue sections, which were then incubated at room temperature for 2 hours. After washing three times with PBS, anti-fluorescence quencher was added, and the sections were mounted with coverslips. Images were obtained using a laser scanning confocal microscope (LSM880, Zeiss).

[0134] 4.2.2 IVIS fluorescence imaging

[0135] Tumor-draining lymph nodes and lungs were removed from tumor-bearing mice and immersed in d-fluorescein (Cat # L2916, ThermoFisher Scientific) for 10 min. The tissues were then imaged using IVIS Lumina imaging (Xenogen IVISLumina System, Caliper Life Sciences) or the Maestro 2 in vivo imaging system (Cri Inc.). Bioluminescence flux analysis was performed using Living Image software 3.0 (Caliper Life Sciences).

[0136] 4.2.3 HE staining of paraffin sections of lung tissue

[0137] Lung tissue was extracted from tumor-bearing mice, fixed overnight in 4% paraformaldehyde, embedded in paraffin, and cut into serial sections of 4-6 μm. After gradient dewaxing and hydration, antigen retrieval was performed using EDTA buffer (pH 8.0). Hematoxylin and eosin staining was performed using hematoxylin and eosin (Cat# C0105S, Beyotime). A suitable amount of hematoxylin was added to cover the tissue sections, and the nuclei were stained for 5 min. Residual staining was rinsed with tap water. The sections were rapidly differentiated with 1% hydrochloric acid-ethanol, rinsed with tap water, and then stained with eosin for 30 s. After rinsing with tap water, the sections were dehydrated and cleared, and then mounted with neutral resin.

[0138] 4.3 Results

[0139] 4.3.1 Flow cytometry results showed that the EO771 ALDH1 activity in the experimental group mice treated with MOTS-c aptamer ML11-1 was significantly lower than that in the control group (P<0.005). Figure 7 The above results indicate that the aptamer of the present invention can inhibit stem cell-like characteristics of cancer cells.

[0140] 4.3.2. Immunofluorescence staining of CD31 and CK in metastatic lymph nodes showed that, compared with the control group, the number of tumor cells invading lymph node blood vessels was significantly reduced in the metastatic lymph nodes of mice treated with MOTS-captamer ML11-1 (P<0.0001). Figure 8 ).

[0141] 4.3.3. Lung IVIS imaging and HE staining of lung tissue showed that, compared with the control group, the MOTS-c aptamer group mice had significantly reduced lung tumor metastasis (P<0.0001). Figure 9 AB shows lung metastasis in mice with breast cancer, and CD shows lung metastasis in mice with oral squamous cell carcinoma.

[0142] These results indicate that the MOTS-c aptamer ML11-1 can significantly inhibit distant tumor metastasis in vivo.

[0143] In summary, the inventors discovered in their research on tumor metastasis that MOTS-c is highly expressed in cancer cells that have metastasized to lymph nodes. In in vitro experiments, using cell spheroidization assays and flow cytometry to detect the activity of the stem cell marker ALDH1, they found that MOTS-c promotes stem cell-like characteristics in cancer cells. Tumor stem cells are considered a subpopulation of cells with strong metastatic potential. Therefore, in vivo experiments further verified that MOTS-c can promote distant organ metastasis of tumors. Research suggests that MOTS-c is an important target for inhibiting distant tumor metastasis, but currently, there is a lack of specific inhibitors of MOTS-c. Therefore, the inventors designed and constructed the inhibitory aptamer for MOTS-c of this invention. Treatment of cancer cells with this aptamer significantly inhibited the stem cell characteristics of cancer cells, and treatment of tumor-bearing mice with the MOTS-c aptamer significantly improved lung metastasis in these mice. Experimental results show that the aptamer constructed in this invention has a good blocking effect on MOTS-c both in vivo and in vitro, and that the aptamer has a certain therapeutic effect against tumor metastasis.

[0144] MOTS-c is a newly discovered mitochondrial peptide that is widely present in various tissues, cells, and plasma. It plays a crucial regulatory role in metabolism, inflammation, oxidative stress, and aging, making it a hot research topic in recent years, particularly in diabetes, obesity, neurodegenerative diseases, muscle degenerative diseases, aging, and cardiovascular diseases. Our research group has also discovered that MOTS-c regulates cancer cell stemness and promotes distant tumor metastasis. Currently, many unknown effects and mechanisms of MOTS-c require further investigation. The MOTS-c aptamer designed and constructed in this invention can serve as an important research tool to assist researchers in conducting theoretical studies and clarifying the role and mechanism of MOTS-c. Furthermore, as an in vitro chemically synthesized product, the aptamer offers advantages over peptide antibodies, including lower cost, less batch effect, greater chemical stability for easier transport and storage, and a smaller, more flexible structure, resulting in better binding to small molecules or hidden targets. Therefore, it has great potential for practical applications in clinical treatment and diagnosis. The MOTS-c aptamer constructed in this invention may also become a low-cost and highly effective drug for treating tumor metastasis and other diseases.

[0145] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0146] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A nucleic acid aptamer targeting MOTS-c, characterized in that, The target sequence of the nucleic acid aptamer is SEQ ID NO: 1: MKWEEMGYIFL; The sequence of the nucleic acid aptamer is TGACACCGTACCTGCTCTGCCAAGCACGCCAAGGGACTAT, SEQ ID NO:

2.

2. A pharmaceutical composition comprising the nucleic acid aptamer of claim 1 and a pharmaceutically acceptable carrier.

3. The application of the nucleic acid aptamer as described in claim 1 includes any one or more of the following: A) Application in the preparation of drugs for treating tumor metastasis; B) Used in the preparation of MOTS-c detection or diagnostic reagents, kits, or sensors; C) Used for the preparation of MOTS-c capture, separation, and purification formulations; D) Used in the preparation or construction of MOTS-c targeted drug delivery systems; The tumor is breast cancer.

Images