Application of watermelon ClWRKY61 gene in salt stress resistance

Abstract

The invention discloses application of a watermelon ClWRKY61 gene in salt stress resistance, and belongs to the technical field of molecular biology. According to the application of the watermelon ClWRKY61 gene disclosed by the invention in salt stress resistance, the nucleotide sequence of the watermelon ClWRKY61 gene is as shown in SEQ ID NO. 1. The ClWRKY61 transcription factor is a positive regulation factor for watermelon to respond to salt stress, the gene can provide gene resources for creation of salt-resistant new germplasm and breeding of special high-resistance new varieties, and meanwhile, the gene has very important scientific and production application significance for promoting resistance breeding, improving economic benefits of watermelons and the like.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology, and more particularly to application of watermelon ClWRKY61 gene in salt stress resistance. Background Art

[0002] Salinization of cultivated land is a global problem that threatens agricultural development and food security in many countries. According to statistics from the Food and Agriculture Organization of the United Nations (FAO), the global area of ​​saline-alkali land exceeded 833 million hectares in 2021, accounting for 8.7% of the world's total area. In China, the area of ​​saline-alkali land is about 100 million hectares. High concentrations of salt in the soil can cause plants to suffer stress, which mainly includes three pathways: osmotic stress, ionic stress, and secondary stress. Under salt stress, the osmotic pressure outside the plant cells is higher than the internal pressure, which hinders water absorption and leads to physiological drought. Moreover, high concentrations of salt ions enter the cells directly through channels and carrier proteins, causing ion toxicity. For example, large amounts of Na + It will inhibit k + The absorption of k + It is an essential element for maintaining cell activity. In addition, salt stress can also cause a decrease in plant photosynthesis, accumulation of reactive oxygen species and membrane damage.

[0003] The WRKY transcription factor (TF) family is one of the largest families in higher plants and plays a key regulatory role in plant adaptation to abiotic stress. The family is characterized by a highly conserved WRKYGQK motif and a C2H2 or C2HC zinc finger structure. This conserved structure enables it to bind to the W-box, the sequence of which is (C / T)TGAC(T / C). According to the number of WRKY domains and zinc finger structures, WRKY transcription factors are divided into subfamilies I, II, and III, and subfamily II is further divided into IIa, IIb, IIc, IId, and IIe. Many members of the WRKY family, such as AhWRKY75 in peanut, GhWRKY17 in cotton, TaWRKY75-A in wheat, and SlWRKY8 in tomato, were found to be induced by salt stress. This suggests that WRKY transcription factors may play an important role in plant resistance to salt stress.

[0004] Watermelon (Citrullus lanatus) is an annual vine herb belonging to the Cucurbitaceae family. It is an important horticultural crop and is widely cultivated all over the world. Its fruit is mainly used as fresh food, and secondly can be used as wine, feed, etc. In 2022, the national watermelon planting area in my country was about 22.2723 million mu, accounting for 7% of the global vegetable production area, and the output was about 63.0231 million tons. In recent years, with the frequent occurrence of extreme climate and natural disasters, global agricultural production has faced huge threats. Among them, salinization of cultivated land is one of the main abiotic stress factors restricting the development of global agriculture. Watermelons with strong resistance to stress can better adapt to changes in various environments without causing a decline in yield and quality, which is an important direction for watermelon breeding.

[0005] Therefore, providing an application of the watermelon ClWRKY61 gene in salt stress resistance is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0006] In view of this, the present invention provides an application of the watermelon ClWRKY61 gene in salt stress resistance.

[0007] In order to achieve the above object, the present invention adopts the following technical solution:

[0008] The watermelon ClWRKY61 gene, whose nucleotide sequence is shown in SEQ ID NO.1.

[0009] Furthermore, the watermelon ClWRKY61 gene is used in positive regulation of salt stress.

[0010] Further, the use of a biological material overexpressing the watermelon ClWRKY61 gene in salt stress resistance, wherein the biological material is any one of the following:

[0011] A: an expression cassette capable of overexpressing the ClWRKY61 gene with a nucleotide sequence as shown in SEQ ID NO.1;

[0012] B: a recombinant vector containing the expression cassette described in A;

[0013] C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.

[0014] Furthermore, the watermelon ClWRKY61 gene is used in watermelon breeding.

[0015] Furthermore, the watermelon ClWRKY61 gene is used in breeding salt-resistant watermelon germplasm.

[0016] Through the above technical scheme, it can be known that compared with the prior art, the present invention discloses the application of watermelon ClWRKY61 gene in salt stress resistance. The present invention discovers a watermelon WRKY transcription factor ClWRKY61; at the same time, it is found that compared with the wild type (WT), the tolerance of ClWRKY61 knockout plants is reduced after salt treatment, the relative conductivity (REC) and malondialdehyde (MDA) content are significantly increased, and the superoxide dismutase (SOD) activity is significantly reduced; after salt treatment, the tolerance of OEWRKY61 plants is increased, the REC and MDA content are decreased, and the SOD activity is increased. This shows that the ClWRKY61 transcription factor is a positive regulatory factor in watermelon response to salt stress. The gene can provide gene resources for the creation of new salt-resistant germplasm and the breeding of characteristic high-resistant new varieties. At the same time, it has very important scientific and production application significance for promoting resistance breeding and improving the economic benefits of watermelon. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0018] Figure 1 The accompanying drawings are schematic diagrams of the ClWRKY61 gene structure, target structure and edited strain sequence information of the present invention;

[0019] Figure 2 The accompanying figure shows the expression level of the gene ClWRKY61 in the overexpression strain OEWRKY61 of the present invention;

[0020] Figure 3 The accompanying drawings show the phenotypes of knockout, overexpression and wild-type strains of ClWRKY61 under salt stress of the present invention;

[0021] Figure 4 The accompanying drawings show the relative conductivity (REC) analysis of knockout, overexpression and wild-type strains of ClWRKY61 under salt stress of the present invention;

[0022] Figure 5 The accompanying drawings show the malondialdehyde content (MDA) analysis of knockout, overexpression and wild-type strains of ClWRKY61 under salt stress of the present invention;

[0023] Figure 6 The accompanying drawings show the superoxide dismutase activity (SOD) analysis of knockout, overexpression and wild-type strains of ClWRKY61 under salt stress of the present invention. DETAILED DESCRIPTION

[0024] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0025] CDS sequence of ClWRKY61:

[0026] ATGGATTGTTCCTGGCCTGACACCACGCCCTCCGATCGAAGAAAAGCAGCCGACGAACTGCTTCGTGGCCGTGAACTTGCACAACAACTACGAGCCTATCTACA GAGAACTTCCAATTCCGGT GGGACGGCTCCCAAGATCTGCTCTCCAGAATCCTAACCTCTTTCTCAAAACACTTTCCATCTTGAATCGCTGCGACTCCGATGACATAAATGGCTCTATTGTGGATTCACCCGAGGATCG TGCTAGTAGAAAATCCCAGGAATCTGGGGACAGTTGCAAGAGCTCCGATCGCAGGGGTTGCTATAAGAGAAGAAAGAGTTGCCAGAGTTGGGCGAGAGAGCTGCAGCCTGGTGGACGATGG GCAC GCGTGGAGGAAGTACGGGCAGAAGACCATTCTAAATGCGAAATACCCAAGAAACTATTACAGATGCACCCACAAATTCGACCAGGCCTGCCAAGCCACAAAGCAAGTCCAGCGACTGCAAGACCATCCCAAAATTCCGTACTACTTATTATGGCCATCACACCTGCTCCAATTTCCTCAAAGCTTCCGACATCGTGCTCGGCTCCTCCAATTTCGACGATTCCTGCGGAGTGCTCCT CAGTTTTGACACCCCCGCCGCACCCAACTTTTTACTCCAACAGGATGCTATGTTGGTCAAGAAGGAAGTTGCAATCGCCGAAAGCAGGGATGATGAGGCCGTATGTTCCCCCTCCGACTACATTAGTACGGCCGAGCCCTCGCCCGACGACCATCTCTCCGAGGTTTTCATGGGTTCCGTCGTCGACTTTGAGGATGATGTTTTACAATTCCAGTTTTGA; SEQ. ID NO.1.

[0027] Example 1 Construction of CRISPR / Cas9 editing vector PBSE402-ClWRKY61

[0028] 1) Editing site selection of gene ClWRKY61

[0029] According to the CDS sequence of ClWRKY61 (as shown in SEQ ID NO.1) and the target site online design website CRISPR-P (http: / / crispr.hzau.edu.cn / CRISPR2 / news.php, V2), the target site for gene editing was designed, and two editing sites (Target1 and Target2) were designed. Among them, the targets Target1 and Target2 are located on the first and second exons of the gene ClWRKY61, respectively.

[0030] Target1 sequence: GAGAACTTCCAATTCCGGT; SEQ ID NO.2;

[0031] Target2 sequence: GTACTTCCTCCACGCGTGC; SEQ ID NO.3.

[0032] 2) Construction of CRISPR / Cas9 editing vector

[0033] (1) PCR amplification:

[0034] According to the above two sets of target sequences, the adapter primers Target1F / Target2R were synthesized, and the intermediate vector pCBC-DT1T2 diluted 100 times was used as a template. The high-fidelity enzyme PrimeStarMax Premix (TaKaRa) was used for PCR amplification. The amplification system was: PrimeStarMax Premix (2×) 25μL, template 2.5μL, upstream and downstream primers 2.5μL each, ddH2O 17.5μL. The PCR reaction program was: 98℃10s, 58℃5s, 72℃15s, 38 cycles; 72℃5min.

[0035] The target sequence adapter primer (underlined is the target sequence) is as follows:

[0036] Target1 sequence primer: Target1F

[0037] ATATATGGTCTCGATTG GAGAACTTCCAATTCCGGT GTTTTAGAGC TAGAAATAGC;SEQ IDNO.4;

[0038] Target2 sequence primer: Target2R

[0039] ATTATTGGTCTCGAAAC GTACTTCCTCCACGCGTGC CAATCTCTTA GTCGACTCTAC; SEQ ID NO.5.

[0040] (2) Vector digestion:

[0041] The CRISPR / Cas9 vector PBSE402 was digested with restriction endonuclease BsaI (NEWENGLAND BioLabs). The digestion system was: PBSE402 2 μg, CutSmart buffer 5 μL, BsaI 1 μL, ddH2O to 50 μL. Digestion was performed at 37°C for 2 h, and gel recovery was performed after electrophoresis detection.

[0042] PCR product and vector connection: The PCR amplified product was connected to the vector PBSE402 after restriction digestion by homologous recombination. The connection system is: the molar ratio of vector to insert fragment is about 1:2; 5× reaction buffer 4μL; NovoRec Plus recombinase 1μL; ddH2O is made up to 20μL. 50℃, connection for 10min.

[0043] (3) Recombinant plasmid transformation:

[0044] Take 5 μl of the ligation product and heat-shock transform it into E. coli competent DH5a, apply it to LB solid culture plate containing 50 mg / L kanamycin, and culture it overnight at 37° C. Use primers U626-IDF / U629-IDR to detect the positive colony.

[0045] The specific primer sequences are as follows:

[0046] U626-IDF: TGTCCCAGGATTAGAATGATTAGGC; SEQ ID NO.6;

[0047] U629-IDR: AGCCCTCTTTCTTTCGATCCATCAAC; SEQ ID NO.7.

[0048] After sequencing was correct, the recombinant plasmid was extracted and transformed into Agrobacterium competent cells EHA105. After PCR verification, it was used for watermelon genetic transformation. The steps of Agrobacterium transformation are as follows:

[0049] Take 1 μl of recombinant plasmid and add it to Agrobacterium EHA105 competent cells, insert it into an ice box for 5 minutes, then put it into liquid nitrogen for quick freezing for 5 minutes, put it into a 37℃ water bath for 5 minutes, add 400 μl of antibiotic-free medium to each tube for recovery, and transfer it to a shaker at 200 rpm and 28℃ for shaking. Take 100 μl of the recovered bacterial solution and spread it on LB solid medium containing antibiotics, dry it at room temperature, and after the bacterial solution is fully absorbed, turn the culture dish upside down and culture it in a 28℃ incubator for 2-3 days.

[0050] Example 2 Construction of overexpression vector pCAMBIA1305-ClWRKY61

[0051] (1) PCR amplification:

[0052] Specific primers OE-ClWRKY61-F / R were designed according to the reference sequence of ClWRKY61, and PCR amplification was performed using the cDNA of watermelon germplasm 'YL' as a template and the high-fidelity enzyme PrimeStarMax Premix (TaKaRa).

[0053] The specific primer sequences are as follows:

[0054] OE-ClWRKY61-F:

[0055] ACGGGGGACTCTAGAGGATCC ATGGATTGTTCCTGGCCT ; SEQ ID NO.8;

[0056] OE-ClWRKY61-R:

[0057] CACCAATTCACACGTGTTAGTGGTGGTGGTGGTGGTG AAACTGGA ATTGTAAAACATCA ; SEQ ID NO.9.

[0058] The amplification system was: PrimeStarMax Premix (2×) 25μL, template 2.5μL, upstream and downstream primers 2.5μL each, ddH2O 17.5μL. The PCR reaction program was: 98℃10s, 58℃5s, 72℃15s, 38 cycles; 72℃5min. After the PCR was completed, 5μL 10× loading buffer was added to the reaction mixture, and then agarose gel was prepared and electrophoresis was performed. The correct band was then detected and the PCR product was recovered using a DNA purification recovery kit (Tiangen).

[0059] (2) Vector digestion:

[0060] The overexpression vector pCAMBIA1305 was digested with restriction endonucleases BamHI and PmlI (NEWENGLAND BioLabs). The digestion system was: pCAMBIA1305 4 μg, CutSmart buffer 5 μL, BamHI 1 μL, PmlI 1 μL, ddH2O to 50 μL. Digestion was performed at 37°C for 2 h, and gel recovery was performed after electrophoresis detection.

[0061] PCR product and vector connection: The PCR amplified product was connected to the vector pCAMBIA1305 after restriction digestion by homologous recombination. The connection system is: the molar ratio of vector to insert fragment is about 1:2; 4μL of 5× reaction buffer; 1μL of NovoRec Plus recombinase; ddH2O is added to 20μL. 50℃, connection for 10min.

[0062] (3) Recombinant plasmid transformation:

[0063] Take 5 μl of the ligation product and heat-shock transform it into Escherichia coli competent DH5a, apply it to LB solid culture plates containing 50 mg / L kanamycin, and culture it at 37°C overnight. Use gene-specific primers OE-ClWRKY61-F / R to detect the colony positively. After sequencing is correct, extract the recombinant plasmid and transform it into Agrobacterium competent cells EHA105. After PCR verification, it is used for watermelon genetic transformation. The steps of Agrobacterium transformation are as follows:

[0064] Take 1 μl of recombinant plasmid and add it to Agrobacterium EHA105 competent cells, insert it into an ice box for 5 minutes, then put it into liquid nitrogen for quick freezing for 5 minutes, put it into a 37℃ water bath for 5 minutes, add 400 μl of antibiotic-free medium to each tube for recovery, and transfer it to a shaker at 200 rpm and 28℃ for shaking. Take 100 μl of the recovered bacterial solution and spread it on LB solid medium containing antibiotics, dry it at room temperature, and after the bacterial solution is fully absorbed, turn the culture dish upside down and culture it in a 28℃ incubator for 2-3 days.

[0065] Example 3

[0066] 1) Genetic transformation of watermelon:

[0067] Take the plump seeds of watermelon germplasm 'YL', soak them in 50-55℃ distilled water for about 30 minutes, peel off the seed shell, wash the peeled kernels with 75% alcohol for about 30 seconds in a clean bench, wash them twice with sterile water, and then soak them in 3% sodium hypochlorite for 15 minutes, wash them with sterile water 5-7 times, dry them, sow them in MS solid culture medium, and culture them in the dark at 25℃ for 3 days.

[0068] After the seeds germinate, they are taken out, the two ends of the cotyledons are cut off, and the remaining cotyledons are divided into 8 pieces for easy infection. During this period, the single colony of EHA105 containing the CRISPR / Cas9 vector PBSE402-ClWRKY61 and the overexpression vector pCAMBIA1305-ClWRKY61 are picked into LB liquid medium containing 50 mg / L kanamycin and 20 mg / L rifampicin, and the bacterial solution is shaken to an OD of 600 =0.8, resuspend the bacterial solution in MS culture medium (MS5194.43g / L, sucrose 30g / L, 6-BA 1.5mg / L) to a final concentration of OD 600 = 0.2 to obtain a bacterial suspension. The cut cotyledons were soaked in the bacterial suspension for 15 min, taken out and dried, and then co-cultured in a co-culture medium (CM: MS519 4.43 g / L, sucrose 30 g / L, G3251 (PhytoTech Labs) 3 g / L, 6-BA 1.5 mg / L) padded with filter paper and cultured at 25°C in the dark for 3 days.

[0069] After 3 days of co-cultivation, the cotyledon blocks were removed and washed with sterile water to remove excess Agrobacterium liquid on the surface (washed about 5-7 times) until the sterile water was clear. After being taken out and dried, they were placed on recovery medium (RM: MS5194.43g / L, sucrose 30g / L, G32513g / L, 6-BA 1.5mg / L, Timentin 200mg / L) for recovery culture at 28°C for 7 days.

[0070] After 7 days, the cotyledons of the recovery culture were transferred to MS medium (selective medium SM) containing 1.5 mg / L 6-BA, 200 mg / L Timentin and 1.4 mg / L Basta for selection culture, and subcultured at 28°C for 3-4 weeks, with subculture every 7 days. After that, the explants with obvious buds were transferred to the bud elongation medium (containing 4.43 g / L MS524, 30 g / L sucrose, 3 g / LG3251, 1 g / L inositol, 500 μL / L SH organic solution, 0.01 mg / L NAA, 0.1 mg / L 6-BA, 200 mg / L Timentin and 1.4 mg / L Basta), and the culture conditions were 28°C, 8 h / d in the dark, 16 h / d in the light, and the light intensity was 8000 Lx. The selected buds were cut off (note that the incision should not contain callus), and transferred to MS medium containing 0.5 mg / L IBA and 200 mg / L Timentin for rooting culture at 28°C until rooting.

[0071] SH organic solution contains 10g / L nicotinic acid, 10g / L VB1, and 1g / L VB6.

[0072] When the regenerated seedlings have roots and grow to 4-5 true leaves, take them out of the culture bottle, slowly rinse off the culture medium at the roots with clean water, transplant them to the substrate that has been sterilized at high temperature and high pressure in advance, water them thoroughly and keep them warm and moist. After 3-4 days, you will see water droplets on the cover of the hole tray, and gradually open the cover to harden the seedlings.

[0073] 2) Detection of gene-edited plants:

[0074] The PBSE402 vector carries a GFP fluorescent tag, and the CTAB method is used to extract the DNA of the watermelon regenerated seedlings with GFP fluorescence. The steps are as follows: take a small part of the young leaves, quickly grind them into powder in liquid nitrogen, and put them in a 1.5 ml centrifuge tube; add preheated 800 μl CTAB extraction buffer, and water bath at 65°C for 30 minutes; add an equal volume of chloroform and isoamyl alcohol, wherein the volume ratio of chloroform to isoamyl alcohol is 24:1, and centrifuge at 8000r / min for 10 minutes after mixing; transfer the supernatant to a new centrifuge tube, add 2 / 3 volume of isopropanol, and gently mix by turning upside down; centrifuge at 10000r / min for 10 minutes; pour out the supernatant, rinse the precipitate twice with 75% volume ethanol, and then drain the remaining liquid after pouring it out. After drying for 3 minutes, dissolve it with 100μl ddH2O (containing 0.1% RNase), and store it at 4°C for later use.

[0075] Using the extracted DNA as template, the edited lines used target 1 primer CRJC-W61F / R to perform PCR amplification on the sequences of the two target sites, respectively. The positive control was the recombinant plasmid, and the negative control was the non-transgenic plant DNA.

[0076] The specific primer sequences are as follows:

[0077] CRJC-W61F: ATGGATTGTTCCTGGCCTGA; SEQ ID NO.10;

[0078] CRJC-W61R: TCAAAACTGGAATTGTAAAACATCA; SEQ ID NO.11.

[0079] The amplification system was: 2×Taq PCR StarMix with loading Dye 10μL, template 1μL, upstream and downstream primers 1μL each, ddH2O 7μL. The PCR reaction program was: 94℃3min; 94℃30s, 58℃30s, 72℃1min, 30 cycles; 72℃5min. The PCR products were recovered according to the band size and TA cloned. After the bacterial solution PCR was positive, the clones were selected for testing to confirm the editing event. The results are shown in Figure 1 A total of two gene-edited plants, crwrky61-1 and crwrky61-2, were obtained, with 264bp and 265bp missing between Target1 and Target2, respectively.

[0080] 3) Detection of overexpression plants:

[0081] Using the cDNA reverse transcribed from the extracted RNA as a template, the overexpression strain was tested for expression using primers qRTPCR-ClWRKY61-F / R.

[0082] The specific primer sequences are as follows:

[0083] qRTPCR-ClWRKY61-F:TCGTGCTCGGCTCCTCCAAT; SEQ ID NO.12;

[0084] qRTPCR-ClWRKY61-R: TCATCCCTGCTTCGGCGATTG; SEQ ID NO. 13.

[0085] Results Figure 2 , a total of one overexpression strain OEWRKY61 was obtained. qRT-PCR analysis showed that the expression level of gene ClWRKY61 in the overexpression strain OEWRKY61 was significantly higher than that in the wild-type plant (about 27 times).

[0086] The expression levels of ClWRKY61 gene in overexpression and wild-type strains were analyzed statistically using Student's t test (**, P < 0.01).

[0087] 4) Phenotypic observation of transgenic watermelon plants:

[0088] The seeds of wild type (WT), overexpression strain OEWRKY61, edited plants crwrky61-1 and crwrky61-2 were soaked for 6 hours and then germinated in a dark environment at 28℃ for about 30 hours. After the seeds turned white, they were sown in nutrient pots (8×7×7cm) and grown at 28℃ / 18℃ (day / night) and 18h / 6h (light / darkness). Watering was done regularly and quantitatively every day. When the seedlings grew to three leaves and one heart, 50 seedlings with consistent growth were selected from each strain for salt stress treatment. The wild type, knockout and overexpression seedlings were irrigated with 300mM NaCl solution, and the irrigation volume for each seedling was 100mL. On the 0th and 3rd day of salt treatment, photos were taken and samples were taken. The sample was the second fully expanded true leaf below the seedling growth point, with a total of three biological replicates.

[0089] Results Figure 3 The results showed that under normal growth conditions, there was no significant difference in the phenotypes between knockout, overexpression and wild-type plants. However, after 300 mM NaCl treatment for 3 days, the tolerance of crwrky61-1 and crwrky61-2 knockout plants to salt stress was reduced compared with wild-type plants, while the tolerance of OEWRKY61 overexpression plants to salt stress was increased.

[0090] 5) Determination of physiological indicators of transgenic watermelon plants:

[0091] (1) Relative electrical conductivity (REC) determination: Use a hole punch to punch watermelon leaves to avoid the veins and make leaf discs. Immerse the leaf discs in 20 mL of distilled water for 15 minutes, then use a conductivity meter to measure and record the conductivity. Then place the leaf discs in a boiling water bath for 15 minutes, cool to room temperature, and measure and record the conductivity again. The ratio of the conductivity before boiling to the conductivity after boiling is the relative conductivity. Each treatment was repeated three times, and variance analysis was performed using IBM SPSS Statistics 21 software, and DunCan was used for multiple tests (P<0.05). The results are shown in Figure 4 .

[0092] (2) Determination of malondialdehyde (MDA) content: 0.2 g of fresh watermelon leaves were ground into a homogenate in 5 mL of phosphate buffer (50 mM, pH 7.8) in an ice bath. The homogenate was then transferred to a test tube and 5 mL of 0.5% thiobarbituric acid was added and boiled for 15 minutes. After the solution was cooled to room temperature, it was centrifuged at 5000 g for 15 minutes. The absorbance of the supernatant at 532 nm and 600 nm was measured and recorded as A532 and A600, ΔA = A532-A600. MDA content (nmol / g Fw) = 25.8 × ΔA ÷ Fw, where: Fw is fresh weight. Each treatment was repeated three times, and variance analysis was performed using IBM SPSS Statistics 21 software, and DunCan was used for multiple tests (P < 0.05). The results are shown in Figure 5 .

[0093] (3) Superoxide dismutase (SOD) assay: 0.2 g of fresh watermelon leaves were ground into a homogenate in 5 mL of phosphate buffer (50 mM, pH 7.8) in an ice bath. The homogenate was then centrifuged at 12,000 rpm for 15 minutes at 4°C. The supernatant was the enzyme extract. Subsequently, 0.1 mL of the enzyme extract, 0.3 mL of phosphate buffer, 0.3 mL of 750 mM methionine, 0.3 mL of 7.5 μM nitro blue tetrazolium (NBT), 0.3 mL of 100 μM EDTA-Na2, 0.3 mL of 20 μM riboflavin, and 0.5 mL of distilled water were oscillated and mixed. The test tube containing the above mixture was reacted under 4000 lx light for 20 minutes. The mixture without the enzyme extract was recorded as the maximum absorbance value Ao under light. The mixture without the enzyme extract under dark conditions was used as a blank for zeroing. The absorbance As was read at 560 nm. The SOD activity unit is defined as the unit that inhibits 50% of the photochemical reduction of NBT. -1 ·h -1 )=

[0094] [(Ao-As)×V×60] / (Ao×0.5×Fw×a×t), where: Fw is fresh weight, a is the volume of enzyme extract added, V is the total volume of extract, and t is the reaction time. Each treatment was repeated three times, and variance analysis was performed using IBM SPSSStatistics 21 software, and DunCan was used for multiple tests (P<0.05). The results are shown in Figure 6 .

[0095] By measuring the physiological indicators of ClWRKY61 knockout, overexpression and wild-type plants, the results showed that ( Figure 4-6), under normal growth conditions, there were no significant differences in relative electrical conductivity (REC), malondialdehyde (MDA) content, and superoxide dismutase (SOD) activity between knockout, overexpression, and wild-type plants. After NaCl treatment, REC and MDA in the two knockout lines increased significantly, while SOD activity decreased, compared with the wild-type. In contrast, REC and MDA decreased, while SOD activity increased, in overexpression plants under salt stress compared with the wild-type. These results suggest that knockout of ClWRKY61 reduces the tolerance of watermelon to salt stress, while overexpression increases it.

[0096] In summary, the present invention provides a watermelon WRKY transcription factor ClWRKY61 and clarifies its function in watermelon salt stress resistance, providing gene resources for improving the salt tolerance of excellent watermelon germplasm and laying a foundation for the breeding of new varieties suitable for saline-alkali land cultivation.

[0097] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Watermelon ClWRKY61 gene, characterized in that Its nucleotide sequence is shown in SEQ ID NO.

1.

2. Use of the watermelon ClWRKY61 gene according to claim 1 in positive regulation of salt stress.

3. Use of a biological material overexpressing the watermelon ClWRKY61 gene according to claim 1 in salt stress resistance, characterized in that: The biological material is any one of the following: A: an expression cassette capable of overexpressing the ClWRKY61 gene with a nucleotide sequence as shown in SEQ ID NO.1; B: a recombinant vector containing the expression cassette described in A; C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.

4. Use of the watermelon ClWRKY61 gene according to claim 1 in watermelon breeding.

5. Use of the watermelon ClWRKY61 gene according to claim 1 in breeding salt-resistant watermelon germplasm.

Images