Application of soybean GmBBX13b gene in delaying senescence of leaves and plants

Abstract

The invention discloses an application of a soybean GmBBX13b gene in delaying senescence of leaves and plants, and the nucleotide sequence of the soybean GmBBX13b gene is as shown in SEQ ID NO. 1; the amino acid sequence of the soybean GmBBX13b protein is as shown in SEQ ID NO. 2. An overexpression transgenic soybean strain is created for the GmBBX13b gene, and compared with a wild type, the GmBBX13b transgenic soybean has the advantages that the flowering time, the leaf aging time and the plant aging time are obviously delayed, the number of branches is obviously increased, and the plant height and the number of main stem nodes are also obviously increased. Therefore, overexpression of the GmBBX13b gene in soybeans is one of effective modes for changing soybean plant types and delaying soybean flowering time and leaf and plant senescence, and has important production and theoretical significance in breeding of soybean dominant varieties and development of germplasm resources.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to the application of GmBBX13b gene in delaying soybean leaf and plant senescence. Background Art

[0002] Soybean is an important grain and oil crop. Leaf senescence is regulated by endogenous factors such as leaf age and plant hormones and exogenous conditions such as light, temperature, and pressure. Adverse environments such as shading, drought, pests and diseases may lead to premature leaf senescence, seriously affecting crop photosynthetic efficiency and nutrient redistribution, thereby reducing yield. Therefore, in-depth exploration of the regulatory mechanism of leaf senescence is of great significance for optimizing crop production performance.

[0003] The B-box (BBX) protein family is a class of zinc finger transcription factors. They play an important role in light-regulated developmental processes, such as seed germination, seedling photomorphogenesis, shade avoidance, flowering, and biotic and abiotic stress responses. The GmBBX13b protein contains two B-box domains. So far, there has been no report on the soybean GmBBX13b gene. Therefore, it is of great significance to clone and study the function of the GmBBX13b gene. Summary of the invention

[0004] The purpose of the present invention is to provide application of soybean GmBBX13b gene in delaying leaf and plant senescence.

[0005] In order to achieve the purpose of the present invention, the following technical solutions can be used.

[0006] In the first aspect, the present invention protects the use of any of the following substances in regulating soybean leaf and plant senescence:

[0007] (1) Soybean GmBBX13b gene;

[0008] (2) soybean GmBBX13b protein;

[0009] (3) a recombinant expression vector, expression cassette, transgenic cell line or recombinant bacteria containing the soybean GmBBX13b gene;

[0010] The amino acid sequence of the GmBBX13b protein is as follows (A1) or (A2) or (A3):

[0011] (A1) a protein consisting of the amino acid sequence described in SEQ ID NO.2 in the sequence listing;

[0012] (A2) A protein derived from (1) having the same function as the amino acid sequence of SEQ ID NO. 2 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added.

[0013] (A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of (A1) or (A2).

[0014] In a second aspect, the present invention protects the use of any of the following substances in increasing soybean plant height, main stem node number and branch number:

[0015] (1) Soybean GmBBX13b gene;

[0016] (2) soybean GmBBX13b protein;

[0017] (3) a recombinant expression vector, expression cassette, transgenic cell line or recombinant bacteria containing the soybean GmBBX13b gene;

[0018] The amino acid sequence of the GmBBX13b protein is as follows (A1) or (A2) or (A3):

[0019] (A1) a protein consisting of the amino acid sequence described in SEQ ID NO.2 in the sequence listing;

[0020] (A2) a protein derived from (1) having the same function as the amino acid sequence described in SEQ ID NO. 2 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added;

[0021] (A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of (A1) or (A2).

[0022] In a third aspect, the present invention protects the use of any of the following substances in regulating the flowering time of soybeans:

[0023] (1) Soybean GmBBX13b gene;

[0024] (2) soybean GmBBX13b protein;

[0025] (3) a recombinant expression vector, expression cassette, transgenic cell line or recombinant bacteria containing the soybean GmBBX13b gene;

[0026] The amino acid sequence of the GmBBX13b protein is as follows (A1) or (A2) or (A3):

[0027] (A1) a protein consisting of the amino acid sequence described in SEQ ID NO.2 in the sequence listing;

[0028] (A2) a protein derived from (1) having the same function as the amino acid sequence described in SEQ ID NO. 2 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added;

[0029] (A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of (A1) or (A2).

[0030] In a fourth aspect, the present invention protects the use of any of the following substances in plant breeding:

[0031] (1) Soybean GmBBX13b gene;

[0032] (2) soybean GmBBX13b protein;

[0033] (3) Recombinant expression vector, expression cassette, transgenic cell line or recombinant bacteria containing the GmBBX13b gene;

[0034] The amino acid sequence of the GmBBX13b protein is as follows (A1) or (A2) or (A3):

[0035] (A1) a protein consisting of the amino acid sequence described in SEQ ID NO.2 in the sequence listing;

[0036] (A2) a protein derived from (1) having the same function as the amino acid sequence described in SEQ ID NO. 2 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added;

[0037] (A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of (A1) or (A2).

[0038] In a specific embodiment, in the above protein, the tag refers to a polypeptide or protein fused and expressed with the target protein using in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag can be a Flag tag, a His tag, a GST tag, etc.

[0039] In a specific embodiment, the recombinant bacterium is Agrobacterium, specifically Agrobacterium EHA105.

[0040] In a fifth aspect, the present invention protects a method for delaying soybean leaf and plant senescence, the method comprising increasing the content and / or activity of the GmBBX13b protein described above;

[0041] The increase in the content and / or activity of the GmBBX13b protein mentioned above is achieved by increasing the expression level of the GmBBX13b gene.

[0042] In a specific embodiment, increasing the expression level of the GmBBX13b gene is achieved by introducing a recombinant plant expression vector that overexpresses GmBBX13b into the plant.

[0043] In a sixth aspect, the present invention provides a method for increasing soybean plant height, main stem node number and branch number, the method comprising increasing the content and / or activity of the GmBBX13b protein described above.

[0044] Preferably, increasing the content and / or activity of the GmBBX13b protein mentioned above is achieved by increasing the expression level of the GmBBX13b gene.

[0045] More preferably, increasing the expression level of the GmBBX13b gene is achieved by introducing a recombinant plant expression vector that overexpresses GmBBX13b into the plant.

[0046] More preferably, the recombinant plant expression vector is constructed by the following method: constructing the GmBBX13b gene fragment into the JRH0641 vector by homologous recombination to obtain the recombinant plant expression vector.

[0047] In a seventh aspect, the present invention protects a method for delaying the flowering time of soybeans, the method comprising increasing the content and / or activity of the GmBBX13b protein described above.

[0048] Preferably, increasing the content and / or activity of the GmBBX13b protein mentioned above is achieved by increasing the expression level of the GmBBX13b gene.

[0049] More preferably, increasing the expression level of the GmBBX13b gene is achieved by introducing a recombinant plant expression vector that overexpresses GmBBX13b into the plant.

[0050] More preferably, the recombinant plant expression vector is constructed by the following method: constructing the GmBBX13b gene fragment into the JRH0641 vector by homologous recombination to obtain the recombinant plant expression vector.

[0051] The recombinant plant expression vector overexpressing GmBBX13b was transferred into the soybean cultivar Williams82 (hereinafter referred to as Wm82) through transgenic technology to increase the expression of GmBBX13b in soybean. It was found that after overexpression of GmBBX13b, the height of soybean plants, the number of main stem nodes and branches increased significantly, and the flowering time, leaf and plant senescence time of soybeans were significantly delayed.

[0052] The recombinant plant expression vector is specifically constructed by the following method: the GmBBX13b gene fragment is constructed into the JRH0641 vector by homologous recombination to obtain the recombinant plant expression vector.

[0053] The significant advantages of the present invention are:

[0054] The present invention provides for the first time the application of the protein encoded by the GmBBX13b gene to regulate soybean leaf and plant senescence, etc., and creates a transgenic soybean strain with overexpression of the GmBBX13b gene. It is found that the flowering time, leaf and plant senescence time of the GmBBX13b transgenic soybean are significantly delayed compared with the wild type, the number of branches is significantly increased, and the plant height and the number of main stem nodes are also significantly increased. Therefore, the present invention can obtain a late-maturing soybean strain, which has important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1 It is a schematic diagram of the detection of transcription level and protein level expression of the soybean GmBBX13b transgenic strain of the present invention.

[0056] Figure 2 This is a statistical result diagram of flowering time of soybean plants in the field after overexpression of GmBBX13b of the present invention.

[0057] Figure 3 This is a statistical result diagram of plant height, main stem node number, branch number, leaves and plant senescence time in the field after overexpression of soybean GmBBX13b of the present invention. DETAILED DESCRIPTION

[0058] In order to make the contents of the present invention easier to understand, the technical solution of the present invention is further described below in conjunction with specific implementation methods, but the present invention is not limited thereto.

[0059] The experimental materials used in the following examples, unless otherwise specified, were purchased from conventional biochemical reagent stores. The determination of vector sequencing in the following examples was determined by sequencing by conventional sequencing companies.

[0060] Soybean (Glycine max) variety Wm 82 was provided by the National Center for Soybean Improvement, Nanjing Agricultural University.

[0061] The overexpression vector used in the present invention is JRH0641, which is provided by the National Center for Soybean Improvement of Nanjing Agricultural University.

[0062] Example 1 Construction of soybean GmBBX13b overexpression vector

[0063] Total RNA was extracted from tender leaves of soybean Wm 82 seedlings and cDNA was synthesized using a reverse transcription kit.

[0064] The present invention provides primers for constructing an overexpression vector, which include primers for amplifying a target fragment.

[0065] JRH0641-GmBBX13b-XhoI-F: GTCCGGACTCAGATCTCGAGATGCGAACGCTTTGTGATGC;

[0066] JRH0641-GmBBX13b-SpeI-R: GGAGGACCGGATCCACTAGTTGGCTGATTATTTGATGCTT.

[0067] 1. Obtaining the CDS fragment of GmBBX13b

[0068] (1) Prepare reaction system 1. Reaction system 1 is 50 μL and consists of 1 μL KOD Plus, 5 μL 10× PCR Buffer, 5 μL dNTP, 25 mM MgSO4, 1.5 μL primer JRH0641-GmBBX13b-XhoI-F aqueous solution (concentration: 10 μM), 1.5 μL primer JRH0641-GmBBX13b-SpeI-R aqueous solution (concentration: 10 μM), 1 μL soybean cDNA, and 34 μL ddH2O.

[0069] (2) After completing step (1), the reaction system 1 was taken for PCR amplification, and the GmBBX13b fragment was recovered using an agarose gel recovery kit (Zhuangmeng International Biogene Technology Co., Ltd.). The reaction procedure was: 94°C for 2 min; 94°C for 15 s, 57°C for 30 s, 68°C for 30 s, 35 cycles; and stored at 12°C.

[0070] 2. Double-digest the vector JRH0641 with restriction endonucleases XhoI and SpeI, and recover the linearized vector.

[0071] Vector JRH0641 is described in the following literature: Lyu, X., Cheng, Q., Qin, C., Li, Y., Xu, X., Ji, R., Mu, R., Li, H., Zhao, T., Liu, J., Zhou, Y., Li, H., Yang, G., Chen, Q., and Liu, B. (2020). GmCRY1s Modulate Gibberellin Metabolism to Regulate Soybean Shade Avoidance in Response to Reduced Blue Light. Mol. Plant.

[0072] 3. Obtaining the ligation product

[0073] (1) Mix 1 μL of the GmBBX13b fragment, 1.5 μL of the vector backbone (50 ng) recovered in step 2, and 2.5 μL of 2×Uniclone Seamless Cloning Mix (Genesand, SC612) to obtain a ligation system.

[0074] (2) Take the ligation system, react at 50° C. for 30 min, and obtain a ligation product.

[0075] 4. The ligation product was transformed into E. coli DH5α competent cells (Tolo Harbor) to obtain several single clones.

[0076] Each single clone was used as a template for PCR amplification of the bacterial solution. The clone containing the target fragment of GmBBX13b with a size of 555 bp was sent for bacterial solution sequencing to obtain a positive clone.

[0077] 5. Inoculate the positive single clone into LB liquid culture medium and culture it to obtain bacterial liquid; then extract the plasmid from the bacterial liquid, namely the recombinant plasmid GmBBX13b.

[0078] According to the sequencing results, the structure of the recombinant plasmid GmBBX13b is described as follows: a small DNA fragment between the recognition sequences of restriction endonucleases XhoI and SpeI of the vector JRH0641 is replaced with a DNA fragment encoding the amino acid sequence shown in SEQ ID No. 2 to obtain a recombinant plasmid.

[0079] Example 2 Obtaining transgenic soybean plants

[0080] 1. After the constructed recombinant plasmid is transformed into Agrobacterium EHA105, soybean transformation is performed.

[0081] 2. The recombinant plasmid was transformed into soybean variety Wm 82 (hereinafter referred to as soybean), and after screening, differentiation and rooting, T0 generation pseudo-transgenic soybean plants were obtained. The specific steps are as follows:

[0082] (1) Sterilize soybeans with chlorine produced by the reaction of 15 mL of concentrated hydrochloric acid and 100 mL of sodium hypochlorite for 2.5 h to 3 h. Take out and blow dry the chlorine in a clean bench.

[0083] (2) Seed germination: Sow soybeans evenly in the germination medium, about 20-30 seeds per dish.

[0084] (3) Agrobacterium infection: Cut the soybean in half, remove part of the embryo tip, and make a cut in the meristem to obtain the infected soybean explant. Place the soybean explant in a recombinant Agrobacterium solution with an OD600 nm of about 0.6 and shake it at room temperature for 30 min. Take out the explant, blow it under sterile conditions for 10 min, and then spread it on the co-cultivation medium and culture it in the dark for 5 days.

[0085] (4) Wash with sterile water and liquid induction medium with hormones for 4-5 times to ensure that the Agrobacterium is washed clean. Cut off the elongated embryos, leaving only 3-4 mm, and insert them diagonally into solid bud induction medium with the embryo facing downward. Place them in a culture room with 16 h light / 8 h dark and 25°C for 2 weeks.

[0086] (5) After 15 days, some explants begin to sprout. Those with sprouts are cut off from the stump and transferred to new solid sprout induction medium. Those without sprouts are discarded and continue to be cultured in the greenhouse under light.

[0087] (6) After 15 days, the bean curds that have sprouted are subcultured to a new solid sprout induction medium, and the bean curds that have not sprouted are discarded and cultured in the greenhouse for 15 days. The explants are co-cultured in the solid sprout induction medium for 30 days.

[0088] (7) Separate the grown callus from the bean curd, discard the explant, scrape off the black surface of the callus, and transfer it to a solid bud elongation medium. Replace the solid elongation medium every 15 days, generally subculture 4-5 times, for a total of 60-80 days. The callus is screened while being elongated, and shoots will grow out during the screening process.

[0089] (8) When the seedlings grow to about 4-5 cm, they are cut from the callus and transferred to rooting medium.

[0090] (9) After culturing in the rooting medium for about 20-30 days, the seedlings that have grown strong and have developed root systems can be moved into a pure vermiculite environment in a disposable cup and placed in a low-light environment for seedling hardening. Use another disposable plastic cup to cover the seedlings to achieve the purpose of moisturizing. Generally, the seedlings are hardened for 5 days.

[0091] (10) After a few days of acclimatization, when obvious root growth is observed, remove the disposable cup used for moisture retention and move it into a large pot containing nutrient soil and continue to cultivate.

[0092] Example 3 Obtaining transgenic soybean positive plants

[0093] In order to identify transgenic positive plants, fresh leaves of the T0 generation were taken for DNA extraction and PCR detection.

[0094] For transgenic lines overexpressing GmBBX13b, we detected the basta resistance gene and designed specific primers based on the recombinant vector to detect the insertion of T-DNA in T0 generation plants. After two generations of self-pollination, the positive plants were identified as homozygous, and the transcription and protein expression of GmBBX13b were detected at the same time.

[0095] In order to identify GmBBX13b overexpression positive plants, the leaves of individual plants of the T0 generation transgenic lines were tested for basta. If the leaves turned yellow and withered, they were false positive transgenic plants. Proteins were extracted from plants resistant to basta and tested at the transcription level and protein immunoblotting. The results showed that compared with the wild type, GmBBX13b had higher transcriptional and protein expression levels in GmBBX13b-FLAG#7 and GmBBX13b-FLAG#9 overexpression plants. The test results are as follows Figure 1 shown.

[0096] Example 4. Phenotypic identification of GmBBX13b transgenic soybean plants.

[0097] The GmBBX13b gene homozygous GmBBX13b-FLAG#7 and GmBBX13b-FLAG#9 transgenic overexpression lines obtained in Example 3 and the wild-type soybean variety Wm82 seeds were planted at the Nanjing Liuhe transgenic material planting base, and the flowering time of the plants was counted 30 days after emergence, and the plant height, main stem node number and branch number of Wm82 were counted after maturity. The plant height, main stem node number and branch number of soybean overexpression plants GmBBX13b-FLAG#7 and GmBBX13b-FLAG#9 were significantly higher than those of Wm82 (P<0.05), and the flowering time and leaf senescence time were significantly later than those of Wm82 (P<0.05). The results are shown in Table 1. Figure 2 and Figure 3 .

[0098] The present invention is described in detail above. The protection content of the present invention is not limited to the above embodiments. Without departing from the spirit and scope of the inventive concept, changes and advantages that can be thought of by those skilled in the art are included in the present invention and are protected by the attached claims.

Claims

1. Use of any of the following substances in delaying the senescence of plant leaves and plants: (1) Soybean GmBBX13b gene; (2) soybean GmBBX13b protein; (3) a recombinant expression vector, expression cassette, transgenic cell line or recombinant bacteria containing the soybean GmBBX13b gene; The amino acid sequence of the soybean GmBBX13b protein is as follows (A1) or (A2) or (A3): (A1) a protein consisting of the amino acid sequence described in SEQ ID NO.2 in the sequence listing; (A2) a protein derived from (1) having the same function as the amino acid sequence described in SEQ ID NO. 2 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added; (A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of (A1) or (A2).

2. The use of any of the following substances to increase plant height, number of main stem nodes and number of branches: (1) Soybean GmBBX13b gene; (2) soybean GmBBX13b protein; (3) a recombinant expression vector, expression cassette, transgenic cell line or recombinant bacteria containing the soybean GmBBX13b gene; The amino acid sequence of the soybean GmBBX13b protein is as follows (A1) or (A2) or (A3): (A1) a protein consisting of the amino acid sequence described in SEQ ID NO.2 in the sequence listing; (A2) a protein derived from (1) having the same function as the amino acid sequence described in SEQ ID NO. 2 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added; (A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of (A1) or (A2).

3. Use of any of the following substances in delaying the flowering time of plants: (1) Soybean GmBBX13b gene; (2) soybean GmBBX13b protein; (3) a recombinant expression vector, expression cassette, transgenic cell line or recombinant bacteria containing the soybean GmBBX13b gene; The amino acid sequence of the soybean GmBBX13b protein is as follows (A1) or (A2) or (A3): (A1) a protein consisting of the amino acid sequence described in SEQ ID NO.2 in the sequence listing; (A2) a protein derived from (1) having the same function as the amino acid sequence described in SEQ ID NO. 2 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added; (A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of (A1) or (A2).

4. Use of any of the following substances in plant breeding: (1) Soybean GmBBX13b gene; (2) soybean GmBBX13b protein; (3) a recombinant expression vector, expression cassette, transgenic cell line or recombinant bacteria containing the soybean GmBBX13b gene; The amino acid sequence of the soybean GmBBX13b protein is as follows (A1) or (A2) or (A3): (A1) a protein consisting of the amino acid sequence described in SEQ ID NO.2 in the sequence listing; (A2) a protein derived from (1) having the same function as the amino acid sequence described in SEQ ID NO. 2 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added; (A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of (A1) or (A2).

5. The use according to any one of claims 1 to 4, characterized in that: The soybean GmBBX13b gene has the nucleotide sequence described in SEQ ID NO.1 in the sequence list.

6. The use according to any one of claims 1 to 4, characterized in that: The plant is a monocotyledon or a dicotyledon; preferably, the dicotyledon is a leguminous plant, more preferably soybean.

7. A method for delaying soybean leaf and plant senescence, the method comprising increasing the content and / or activity of the GmBBX13b protein of claim 1; Preferably, increasing the content and / or activity of the GmBBX13b protein is achieved by increasing the expression level of the GmBBX13b gene.

8. The method for delaying soybean leaf and plant senescence according to claim 7, characterized in that: Increasing the expression level of the GmBBX13b gene is achieved by transferring a recombinant plant expression vector that overexpresses GmBBX13b into the plant; the recombinant plant expression vector is specifically constructed by the following method: the GmBBX13b gene fragment is constructed into the JRH0641 vector by homologous recombination to obtain a recombinant plant expression vector.

9. A method for increasing soybean plant height, main stem node number and branch number, characterized in that: The method comprises increasing the content and / or activity of the GmBBX13b protein of claim 1; Preferably, increasing the content and / or activity of the GmBBX13b protein of claim 1 is achieved by increasing the expression level of the GmBBX13b gene; More preferably, increasing the expression level of the GmBBX13b gene is achieved by introducing a recombinant plant expression vector that overexpresses GmBBX13b into the plant; More preferably, the recombinant plant expression vector is constructed by the following method: constructing the GmBBX13b gene fragment into the JRH0641 vector by homologous recombination to obtain the recombinant plant expression vector.

10. A method for delaying flowering time of soybean, characterized in that: The method comprises increasing the content and / or activity of the GmBBX13b protein of claim 1; Preferably, increasing the content and / or activity of the GmBBX13b protein of claim 1 is achieved by increasing the expression level of the GmBBX13b gene; More preferably, increasing the expression level of the GmBBX13b gene is achieved by introducing a recombinant plant expression vector that overexpresses GmBBX13b into the plant; More preferably, the recombinant plant expression vector is constructed by the following method: constructing the GmBBX13b gene fragment into the JRH0641 vector by homologous recombination to obtain the recombinant plant expression vector.

Images