Aegilops tauschii gene for promoting mesosulfuron-methyl degradation and application thereof

Abstract

The invention discloses an aegilops tauschii gene capable of promoting mesosulfuron-methyl degradation and application of the aegilops tauschii gene, and belongs to the technical field of herbicide resistance gene mining, the aegilops tauschii gene capable of promoting mesosulfuron-methyl degradation is LOC109735453, and the CDS sequence of the LOC109735453 is shown as SEQ ID NO.1. The invention further discloses an application of the aegilops tauschii gene capable of promoting mesosulfuron-methyl degradation. The invention provides an aegilops tauschii LOC109735453 gene which has a remarkable promoting effect on mesosulfuron-methyl degradation and belongs to a P450 gene family, and experimental results show that the expression of the LOC109735453 gene can obviously promote the mesosulfuron-methyl degradation; the provided aegilops tauschii LOC109735453 gene can be used for cultivation of mesosulfuron-resistant wheat varieties, can be used for research of an aegilops tauschii mesosulfuron-resistant mechanism, and provides a reference for resistance detection of aegilops tauschii and determination of a drug use period and a drug use amount. And a candidate gene is provided for an anti-ALS inhibitor herbicide.

Description

Technical Field

[0001] The invention relates to the technical field of herbicide resistance gene mining, in particular to an Aegilops tauschii gene promoting the degradation of mesosulfuron-methyl and application thereof. Background Art

[0002] As the main food crop in my country, wheat plays an important role in agricultural economic development and people's daily life. Aegilops tauschii Coss. is an annual or biennial herbaceous plant belonging to the genus Aegilops of the tribe Triticum in the Poaceae family. It is also known as rough goat grass. It has strong environmental adaptability and tillering ability. It is a common grass weed in wheat fields and a weed that has an extremely bad impact on global agricultural crop production: Aegilops tauschii Coss. is very similar to wheat in external morphology, and it is even more difficult to distinguish from wheat in the seedling stage. In addition, Aegilops tauschii Coss. is the D chromosome donor of common wheat, and its genetic background is very similar to that of wheat, making most wheat field herbicides ineffective in effectively controlling Aegilops tauschii. Effective chemical control technology has been lacking for a long time.

[0003] Reasons like these have led to the rampant reproduction of Aegilops tauschii in wheat fields, causing an outbreak and increasingly serious damage: Aegilops tauschii grows throughout the entire growth period of wheat, competing with wheat for the sunlight, water, fertilizer, and living space needed for growth. When the density of Aegilops tauschii is high, it will cover the wheat, seriously affecting the growth and yield of wheat; secondly, Aegilops tauschii can provide shelter and habitats for a variety of harmful pests and diseases, such as wheat ergot, stripe rust, and yellow dwarf disease, and is a host of Macrosiphum aphids and Schizaphis wheat, leading to the spread and infection of wheat diseases and pests; in addition, each Aegilops tauschii plant can produce 100-800 seeds per year, and the seed husks are hard and survive for a long time after falling off, allowing its seeds to accumulate in large quantities in the soil, and then grow again in the next year with human and animal activities. Its seeds will also be mixed into wheat after harvest, reducing the quality of wheat.

[0004] The morphology of A. tauschii and wheat is very similar in the seedling stage, and it is difficult to distinguish them when pulling them out. Pulling them out too late will have a serious impact on the growth of wheat. Chemical weed control has the advantages of saving time, labor and efficiency. However, due to the high affinity between A. tauschii and wheat, only methyl disulfone on the market has a good control effect on A. tauschii and is relatively safe for wheat. However, methyl disulfone is an ALS inhibitor herbicide, which has a high risk of resistance and weeds evolve resistance to it quickly. Studies have reported that continuous use of ALS inhibitor herbicides for more than 3-5 years will cause weeds to develop resistance. In addition, methyl disulfone also has the characteristics of high cost of use, relatively strict requirements on the growth period and physiological state of A. tauschii and wheat at the appropriate time of application, and easy occurrence of pesticide damage under environmental conditions such as low temperature. Therefore, it is of great practical significance to develop new, effective and sustainable control methods, reduce dependence on chemical herbicides, achieve effective control of A. tauschii, and help sustainable agricultural development and global food security. Summary of the invention

[0005] The purpose of the present invention is to provide a gene of Aegilops tauschii that promotes the degradation of mesosulfuron-methyl and its application, so as to provide a linked gene for the study of the resistance mechanism of Aegilops tauschii to mesosulfuron-methyl and the breeding of herbicide-resistant wheat varieties, thereby facilitating the effective prevention and control of Aegilops tauschii, the sustainable development of agriculture and food security.

[0006] To achieve the above object, the present invention provides an Aegilops tauschii gene that promotes the degradation of mesosulfuron-methyl. The Aegilops tauschii gene is LOC109735453. The CDS sequence of LOC109735453 is shown in SEQ ID NO.1.

[0007] Preferably, expression of the gene promotes the degradation of mesosulfuron-methyl.

[0008] The above-mentioned gene is used for detecting the resistance of Aegilops tauschii to mesosulfuron-methyl.

[0009] The application of the above-mentioned gene in the selection and dosage investigation of Agropyron tauschii herbicides is to detect whether Agropyron tauschii is suitable for control by mesosulfuron-methyl and the effective dosage of mesosulfuron-methyl for control.

[0010] The application of the above gene in the breeding of wheat herbicide-resistant varieties, wherein the herbicide is an ALS inhibitor herbicide.

[0011] Preferably, the herbicide is mesosulfuron-methyl.

[0012] Therefore, the Aegilops tauschii gene and its application for promoting the degradation of mesosulfuron-methyl provided by the present invention have the following beneficial effects:

[0013] (1) The present invention provides a gene that has a significant promoting effect on the degradation of mesosulfuron-methyl, namely, the Aegilops tauschii LOC109735453 gene, which belongs to the P450 gene family. Experimental results show that the expression of the LOC109735453 gene can significantly promote the degradation of mesosulfuron-methyl;

[0014] (2) The LOC109735453 gene provided by the present invention can be used for breeding wheat varieties resistant to mesosulfuron, can be used for studying the mechanism of resistance of A. tauschii to mesosulfuron, and provide a reference for the resistance detection of A. tauschii and the determination of the application period and dosage; and provides a candidate gene for resistance to ALS inhibitor herbicides. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0016] Figure 1 is an electrophoresis diagram of the PCR product in Example 1 of the present invention;

[0017] Figure 2 is the NCBI online BLAST comparison analysis result of the amplified sequence in Example 2 of the present invention;

[0018] Figure 3 is the result of comparing the LOC109735453 gene sequences in Examples 2 and 3 of the present invention; wherein NCBI_LOC109735453 is the NCBI registered sequence, Clone_LOC109735453 and Expression_LOC109735453 are the constructed cloning vector sequence and expression vector sequence, respectively;

[0019] Figure 4 is the comparison result of the protein sequence encoded by the LOC109735453 gene in Examples 2 and 3 of the present invention; wherein NCBI_LOC109735453 is the NCBI registered sequence, Clone_LOC109735453 and Expression_LOC109735453 are the constructed cloning vector sequence and expression vector sequence respectively;

[0020] Figure 5 The growth state of the yeasts carrying the empty vector and the yeasts carrying the LOC109735453 gene in Example 4 of the present invention in the YPDA medium containing different concentrations of mesosulfuron;

[0021] Figure 6The OD of the yeast solution containing the empty vector and the LOC109735453 gene in Example 4 of the present invention is 600 Dynamic curve chart over time;

[0022] Figure 7 These are the results of investigating the metabolism of methyldisulfuron by yeasts carrying an empty vector and yeasts carrying the LOC109735453 gene in Example 4 of the present invention. DETAILED DESCRIPTION

[0023] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0024] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0025] The instruments, equipment, reagents and materials used in the examples were all obtained through commercial channels.

[0026] Embodiment 1

[0027] The specific steps for cloning the Aegilops tauschii LOC109735453 gene are as follows:

[0028] (1) The complete CDS coding region sequence of the Aegilops tauschii LOC109735453 gene was downloaded from the NCBI website. The sequence is shown in SEQ ID NO.1. SnapGene was used to design specific primers for the CDS region of the Aegilops tauschii LOC109735453 gene, and the vector homology arm sequence (uppercase bases) for seamless cloning was added. The upstream primer sequence of the LOC109735453 gene is shown in SEQ ID NO.2, and the downstream primer sequence is shown in SEQ ID NO.3.

[0029] SEQ ID NO.1:

[0030] ATGGACACAATCATCAACAAATCAACCATTTCCCAAGAGCTGAGCTGCACCGATCGATCGTCGCACGCCATGGTGGCTATGGCGCCCGCTGCAGGGCTGGTCCTGGCTTCGCTCGCCGTGGTGCTGGCAACCACGCTGTGGAAGGCGGCGGTGCACCTGGTGTGGCGCCCCTACGCCGTCGCGAGGGCCTTCCAGCGGCAGGGGATCCGCGGGCCGGCGTACCGGTTCTTCGTCGGCAACAACGAGGAGGTCATGGCGATGCGCGCGGCGACGGCCGACGACGTGCTCGACCTCGGTTCCCACGACATCATCGCGCGCGTGATGCCGCAGTACAAGGCGTGGGTCGCGTCGTACGGTAAGATTTTCCTCTCGTGGTCGGGGTACACGCCGTCGCTCTGCGTCGGCGACCACGACATGGTGAAGCAGATCTTGTCCAATAAGACCGGGCTGTACGCCAAGCCCAACCCAGGGCCCAACTTCCTGGCCCTGCTGGGCAAGGGCCTCGTCTTCTCCGACGGCGAAGACTGGGCGCGCCACCGCCGCATCGTGCACCCGGCGTTCACCATGGACAAGCTCAAGATGATGACCAGGACGATGGCGGAGTGCGCGGGGGACATGGTCCGGCCGTGGGAGGCGCTCGCCGCGGCGAGCGACGGCGGCGTGGCGAGGGTGGACGACGTCGGGCAGCAGTTCGTGGAGCTGACCGCCGACGTGATCTCGCACACGGCGTTCGGGAGCAGCTACAGGGA GGGGAAGGAGGTGTTCATGGCGCAGCGGGAGCTCCAGTACATCGCCTTCTCCACCATGAACAACGTCCGCGTCCCGGGCCTCGAGTACCTCCCCACCAAGACCAACCTGCGGCGGCGGCAGCTCACGGGC-AAGGTGCGCGGCACGCTCATGGCGATCATCCGCGAGCGGCAGGCCGCCGCCAAGGAGGCCAAAGGCTACGGCAACGACTTGCTTGGCCTGATGCTCGAGGCCAACGCGTCGGCCGGCGCCGGCGGGCAGAAGGCGGCCGCCATTAGCATGGACGAGATCATCGACGAGTGCAAGACCTTTTTCTTCGCCGGGCACGACACCACCTCCCATCTCCTTACCTGGGCCATCTTCCTCCTCGGCACGCACCCGGAATGGCAGCAGAAGCTCAGGGAAGAGGTCCTCCGAGAGTGCGGCGGCACGGGGACGCCGCTGCACGGCGACGCGCTCAACAAGCTCAAGCTGGTAAGCCCCTGCCTATCCCATCATTCTGACCCACTTAATGCACACTCCACAACGACGAGTGACACGCACTTCACCTGTGATCGATGATGGCAGACGACGATGGTGCTTTACGAGACGCTGAGGCTCTACGGCGCTGTGATCATGATCGCGAGGGAGACGACCGCGGACACGGAGCTCGGCGGCGTGAAGATCCCCAAGGGCACGACCACCATGATACCGATGGCGATCATGCACCGGGACGAGGAGGTGTGGGGCGCGGACGCCGGCGAGTTCAAGCCGGACCGGTTTCAGAACGGCGTGGGCAGAGCGGCGAAGCACCCGAGCGCGATGCTGGCCTTCTCCGCCGGCCCGCGGTCGTGCATCGGGCAGGACTTCGCGATGCTGGAGGCCAAGGCGACGCTCGCCGTGATCCTGCGCCGGTTCGAGTTCGAGGTGGCGCCGGAGTACGTGCACGCGCCGGCCGAGTTCCTGACGCTGCAGCCCAAGTGCGGGCTCCCCGTGCTGCTCAAGCTCCTGGGTCAGTAG

[0031] SEQ ID NO.2:CCTCGAGTAAGCTTGGTACCatggacacaatcatcaacaaatcaacca

[0032] SEQ ID NO.3:TCTTAGCTAGCCCGGTACCctactgacccaggagcttgagc

[0033] (2) Soil with no history of herbicide application in the farm of the teaching experimental base of Shandong Agricultural University was selected, and the air-dried and sieved soil was filled into a plastic pot with a diameter of 12 cm to 4 / 5 of the pot height. The soil was moistened by bottom irrigation. Shelled and full-grained resistant population JJMHN2018-05 Aegilops tauschii seeds were selected and cultured in a biological incubator at a constant temperature of 20°C until germination. Aegilops tauschii seeds with basically the same germination status were selected and planted in pots, with 10 plants per pot, covered with 0.5-1.0 cm of soil, and cultured in an artificial intelligence solar greenhouse. The temperature in the greenhouse ranged from 25 to 30°C during the day and 15 to 20°C at night. The relative humidity was controlled at 61% to 75%, and 6 seedlings were planted in each pot.

[0034] TransZol Up was used to extract total RNA from leaves of the resistant population JJMHN2018-05 Aegilops tauschii. 100 mg of leaf tissue was fully ground under liquid nitrogen conditions, transferred to a 1.5 mL sterile RNase-free centrifuge tube, 1 mL of lysis buffer was added, vortexed and mixed, and allowed to stand at room temperature for 5 min. 0.2 mL of chloroform was added to each 1 mL of lysis buffer, the mixture was shaken for 15 s, allowed to stand at room temperature for 3 min, and centrifuged at 12000 rpm at 4°C for 15 min. After centrifugation, the sample was divided into three layers. 400 μL of the top aqueous phase was transferred to a new centrifuge tube, an equal volume of isopropanol was added, inverted and mixed, and allowed to stand at room temperature for 30 min. Centrifuged at 12000 rpm at 4°C for 10 min, discarded the supernatant, and 1 mL of 75% ethanol was added to wash the precipitate. Centrifuged at 12000 rpm at 4°C for 5 min, discarded the supernatant, allowed to stand at room temperature for 5 min to remove residual ethanol, 30-50 μL of Nuclease-free Water was added to dissolve the RNA, and then stored at -80°C. RNA purity using Spectrophotometer detection, RNA concentration using RNAAssay Kit and 2.0 Fluorometer detection, Agilent 2100 Bioanalyzer analysis of RNA integrity. High-quality RNA was selected for subsequent experiments.

[0035] (3) Use One-Step gDNA Removal and cDNA Synthesis SuperMix was used to reverse transcribe the selected high-quality RNA, and the obtained cDNA was used as a template, and the sequences shown in SEQ ID NO.2 and SEQ ID NO.3 were used as primers. FastPfu DNA Polymerase was used to amplify the full length CDS of the LOC109735453 gene. The reaction system is shown in Table 1, and the amplification program is 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 60°C annealing for 40 s, 72°C extension for 90 s, 34 cycles; 72°C final extension for 10 min; 4°C storage.

[0036] Table 1

[0037]

[0038] (4) The PCR product was subjected to agarose gel electrophoresis, and the results showed that the fragment size was close to the expected 1653 bp (see electrophoresis diagram Figure 1 ). Then use Quick Gel Extraction Kit was used to recover the target band.

[0039] Embodiment 2

[0040] The recombinant cloning vector containing the LOC109735453 gene was constructed. The specific steps are as follows:

[0041] (1) Use -Blunt Simple Cloning Kit combines the target fragment with -BluntSimple Cloning Vector cloning vector. 4μL PCR recovery product and 1μL -BluntSimple Cloning Vector was mixed and incubated in a PCR instrument at 25°C for 15 min. The ligation product was then added to the freshly thawed DH5α cells, placed on ice for 30 min, heat-shocked at 42°C for 30 s, placed on ice for 2 min, and 250 μL of room temperature antibiotic-free LB liquid culture medium was added. The cells were shaken and incubated at 37°C for 1 h at 200 rpm.

[0042] (2) Take 8 μL of 500 mmol / L IPTG and 40 μL of 20 mg / mL X-gal, mix them, and evenly spread them on a LB solid medium (containing a final concentration of 100 mg / L ampicillin) plate. Incubate them upside down at 37°C for 30 min until the liquid is completely absorbed by the medium. Centrifuge the bacterial solution that has been incubated for 1 h at 4000 rpm for 1 min, retain 100 μL of the liquid, pipette and mix the bacteria, evenly spread them on the LB plate, and incubate them upside down at 37°C overnight.

[0043] (3) After 24 h, a single white colony was obtained and PCR detection was performed using 2× Flash Hot Start MasterMix (Dye) according to the operating instructions. Positive clones were screened and transferred to LB liquid culture medium containing 100 mg / L ampicillin and cultured at 37°C with shaking at 200 rpm until OD 600 About 0.8. 500 μL of bacterial solution was sent to Shanghai Biotech Co., Ltd. for sequencing. The sequencing primer is shown in SEQ ID NO.2. The sequencing results were compared and analyzed using NCBI online BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome). The results are shown in Figure 2 As shown in the figure, compared with the sequence published by NCBI, the similarity is 94.49%, indicating that the recombinant cloning vector containing the LOC109735453 gene was successfully constructed. Using UGENE 50.0 for comparison analysis, it was found that the cloned sequence had 4 single-base mutations, one of which was a sense mutation, resulting in the mutation of aspartic acid at position 174 to glutamic acid, but the cloned sequence had a 93bp fragment insertion ( Figure 3 , Figure 4 ).

[0044] Embodiment 3

[0045] The recombinant expression vector of LOC109735453 gene was constructed. The specific steps are as follows:

[0046] (1) The pSEC-TRP plasmid was digested with endonuclease KpnI. The digestion system is shown in Table 2. The digestion reaction conditions are: incubation at 37°C for 5 min and inactivation at 80°C for 5 min to obtain a linearized vector.

[0047] Table 2

[0048]

[0049]

[0050] (2) The positive bacterial solution containing the recombinant cloning vector in Example 2 was used to extract the plasmid using a plasmid extraction kit to obtain the recombinant cloning vector. The extracted plasmid was used as a template and the sequences shown in SEQ ID NO.2 and SEQ ID NO.3 were used as primers. FastPfu DNA Polymerase was used to amplify the full length CDS of the LOC109735453 gene, wherein the reaction system and cycle conditions, PCR product electrophoresis, and target fragment recovery and purification were the same as in Example 1. The reaction system was prepared according to Table 3, wherein the insert fragment was the recovered and purified product.

[0051] Table 3

[0052] Linearized vector 1μL Insert 3μL 5×CEIIBuffer 4μL ExnaseII 2μL <![CDATA[ddH2O]]> 10μL

[0053] Use pSEC-TRP vector and homologous recombination kit ClonExpressIIOn Step CloningKit to connect the target fragment to the expression vector pSEC-TRP according to the attached instructions. The expression vector pSEC-TRP was transformed into WAT11 yeast using a yeast transformation kit (WAT11 Chemically Competent Cell): prepare an expression vector premix (PEG Solution 240 μL, LiAc Solution 36 μL, Carrier DNA 10 μL, positive plasmid 1 μg), add the premix to the yeast competent medium, pipette and mix to fully suspend the yeast cells; incubate in a 30°C water bath for 30 min (mix every 10 min); heat shock in a 42°C water bath for 30 min (mix every 10 min); centrifuge at 12000 rpm for 1 min, and discard the supernatant; resuspend the precipitate in 100 μL sterile deionized water, spread on YPD solid culture medium (containing ampicillin at a final concentration of 100 mg / L), and culture inverted at 30°C for 3 to 4 days until a single colony grows.

[0054] Single colonies were selected for PCR detection. The PCR primers and conditions were the same as those in Example 1 (3). Positive single clones were selected and shaken to an OD of 600 =0.6, a plasmid extraction kit was used to extract the plasmid, and the plasmid was sent to Shanghai Biotech Co., Ltd. for sequencing. The sequencing primer sequences are shown in SEQ ID NO.2 and SEQ ID NO.3. The sequencing results were compared and analyzed using UGENE50.0. The results showed that the recombinant sequence of the expression vector pSEC-TRP was consistent with the recombinant fragment sequence carried by the cloning vector sequence constructed in Example 2 ( Figure 3 , Figure 4 ). The yeast WAT11 strain transformed with LOC109773608 gene was obtained.

[0055] Embodiment 4

[0056] The sensitivity and metabolic capacity of yeast WAT11 transgenic with LOC109735453 gene to mesosulfuron were determined as follows:

[0057] (1) Spread the positive WAT11 bacterial solution on the surface of YPDA solid culture medium, pick a single colony and inoculate it into 1 mL of YPDA liquid culture medium, and culture the bacterial solution at 200 rpm at 28°C until the OD 600 =0.6, add 20% galactose to 0.5mM, culture at 25°C for 12h, and dilute the bacterial solution to OD 600 =10 0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 0.5 μL of bacterial solution was evenly dripped onto the surface of the samples containing different concentrations of methyl disulfone (0, 10 1 , 10 2 μM) on solid YPDA medium, invert and culture at 28°C for 2-3 days, and observe the growth status of the colonies. Yeast WAT11 transfected with the expression vector PESC-TRP (empty) was used as a control.

[0058] Colony growth status Figure 5 As shown in the figure, in the control treatment group (without methyl disulfone treatment), the growth state of WAT11 transfected with LOC109735453 gene was stronger than that of WAT11 transfected with empty vector. 600 =10 -5 When LOC109735453 gene WAT11 was transfected, colonies could still be formed, while the empty vector WAT11 was transfected at a bacterial concentration of OD 600 =10 -3 In the group treated with metsulfuron, the degree of inhibition of the growth of empty vector and transgenic WAT11 colonies increased with the increase of the concentration of the agent. 1 , 10 2 On the YPDA solid medium with 1 μM, the transgenic WAT11 can still grow, but the empty vector WAT11 can no longer grow. This indicates that the LOC109735453 gene can significantly reduce the sensitivity of WAT11 yeast to mesosulfuron.

[0059] (2) Spread the positive WAT11 bacterial solution on the surface of YPDA solid culture medium, pick a single colony and inoculate it into 3 mL of YPDA liquid culture medium, and culture the bacterial solution at 200 rpm at 28°C until the OD 600=0.6, 20% galactose was added to 0.5 mM, cultured at 25°C for 12 h, methyl disulfone solution was added to 3 mL of bacterial solution to a concentration of 50 μM, cultured at 37°C with shaking at 200 rpm, and the changes in the absorbance of the bacterial solution at 1, 3, 4, 5, 6, 12, 24, and 36 h after the addition of the solution were recorded. The culture solution of yeast WAT11 inoculated with the expression vector PESC-TRP (empty) in Example 3 was used as a control.

[0060] The results are as follows Figure 6 As shown in the figure, when the concentration of methyldisulfone was 50 μM, the OD values ​​of the recombinant expression WAT11 bacterial solution with the empty vector and the LOC109735453 gene showed a trend of decreasing and then slightly rising during the measurement period, but the OD value of the recombinant expression WAT11 bacterial solution with the LOC109735453 gene was 600 It was always significantly higher than the empty vector WAT11 bacterial solution, indicating that the LOC109735453 gene can significantly reduce the sensitivity of WAT11 yeast to mesosulfuron.

[0061] (3) Determine the metabolic capacity of transgenic yeast WAT11 to mesosulfuron, the specific steps are as follows:

[0062] Take the positive yeast liquid and streak it on the YPD solid medium, pick a single colony and inoculate it in 5mL YPD liquid medium, and invert and culture it at 30℃ for 24h. Add 500μL 20% galactose, culture it at 30℃ overnight, centrifuge it at 5000rpm for 2min, discard the supernatant, and resuspend the precipitate with 1mL WCAB (cell buffer, 7mM magnesium acetate and 10mM glucose are fixed to 100mL with pH=7.4 phosphate solution). Take 500μL of the resuspended cells into a 1mL centrifuge tube, add methyl disulfone solution to a concentration of 100μM, and culture it at 30℃ for 24h with shaking.

[0063] After 24 hours, 500 μL of mobile phase was added, and the mixture was centrifuged at 15,000 rpm for 5 minutes. The supernatant was filtered through a 0.22 μm filter membrane, and the residual amount of methyl disulfone was detected by LC-MS / MS. A total of 3 replicates were set.

[0064] Mobile phase: 0.1% formic acid / water (A), methanol (B); flow rate: 0.2 mL / min; column temperature: 30°C; injection volume: 2 μL.

[0065] The elution program is shown in Table 5.

[0066] Table 5

[0067] Time (minutes) Mobile phase A percentage (%) Mobile phase B percentage (%) 0-0.2 90 10 0.2-2 90-10 10-90 2-3 10 90 3-3.1 10-90 90-10 3.1-5 90 10

[0068] MS conditions: capillary voltage: 2.6 kV; cone voltage: 35 V; desolvation temperature: 450°C; source temperature: 150°C; ionization mode: ESI(—); ion scanning mode: multiple reaction detection mode MRM.

[0069] The mass spectrometry parameters of mesosulfuron are shown in Table 6.

[0070] Table 6

[0071]

[0072] The calculation methods for the residue, metabolic amount and metabolic rate of mesosulfuron are as follows:

[0073] The residual amount is the residual drug amount in the sample determined by HPLC-MS / MS; the metabolic amount = the added drug amount - the residual drug amount; the metabolic rate = the metabolic amount / the added drug amount.

[0074] The results are as follows Figure 7 As shown, the metabolic amounts of methyldisulfuron in the treatments of empty vector and LOC109735453 gene were 7.30 μg and 31.13 μg, respectively. The metabolic amount of methyldisulfuron in the treatments of LOC109735453 gene was significantly higher than that in the control group of yeast transfected with empty vector, indicating that the expression product of gene LOC109735453 significantly promoted the degradation of methyldisulfuron.

[0075] Therefore, the present invention provides a gene that has a significant promoting effect on the degradation of mesosulfuron-methyl - the Aegilops tauschii LOC109735453 gene, which belongs to the P450 gene family. Experimental results show that the expression of the LOC109735453 gene can significantly promote the degradation of mesosulfuron-methyl; the provided Aegilops tauschii LOC109735453 gene can be used for the breeding of wheat varieties resistant to mesosulfuron-methyl, can be used for the study of the mechanism of Aegilops tauschii's resistance to mesosulfuron-methyl, and provide a reference for the resistance detection of Aegilops tauschii, the determination of the application period and the dosage; and provides a candidate gene for resistance to ALS inhibitor herbicides.

[0076] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. A gene for promoting the degradation of mesosulfuron-methyl, characterized in that: The Aegilops tauschii gene is LOC109735453, and the CDS sequence of LOC109735453 is shown in SEQ ID NO.

1.

2. A gene for promoting the degradation of mesosulfuron-methyl according to claim 1, characterized in that: Expression of the gene promotes the degradation of mesosulfuron-methyl.

3. Use of the gene as claimed in claim 1 in detecting resistance of Aegilops tauschii to mesosulfuron-methyl.

4. The use of the gene as claimed in claim 1 in the selection and dosage investigation of Aegilops tauschii herbicides, characterized in that: The application is to detect whether Aegilops tauschii is suitable for control by mesosulfuron-methyl and the effective dosage of mesosulfuron-methyl for control.

5. The use of the gene as claimed in claim 1 in the breeding of wheat herbicide-tolerant varieties, characterized in that: The herbicide is an ALS inhibitor herbicide.

6. Use of the gene according to claim 5 in breeding wheat herbicide-tolerant varieties, characterized in that: The herbicide is mesosulfuron-methyl.

Images