Rice CRK4 protein and application of coding gene thereof

Abstract

The invention belongs to the field of rice molecular breeding, and particularly relates to rice CRK4 protein and application of a coding gene thereof. The rice CRK4 gene is subjected to overexpression or knockout mutation in rice by adopting overexpression and CRISPR (clustered regularly interspaced short palindromic repeats) knockout technologies respectively, and according to phenotypic changes of transgenic rice plants, it is found that overexpression of the CRK4 gene in the rice can remarkably improve the high-temperature and low-temperature resistance of the rice, especially adjust the pore opening of plant leaves under the temperature stress condition, and improve the yield of the rice. The water loss rate of the plant under the temperature stress condition is adjusted, meanwhile, the high-temperature-resistant and low-temperature-resistant dual abiotic stress capacity of the plant is improved, and the plant variety with the high-temperature-resistant and low-temperature-resistant dual abiotic stress capacity is cultivated. The method has a good application prospect in the aspects of enhancing the stress resistance of the rice, accelerating the stress-resistant molecular breeding process and the like.

Description

Technical Field

[0001] The invention belongs to the field of rice molecular breeding, and in particular relates to the application of rice CRK4 protein and its encoding gene. Background Art

[0002] Plants live in constantly changing environments that are often unfavorable for their growth and development. Temperature stress is a major environmental factor that affects the geographic distribution of plants in nature, limits agricultural plant productivity, and threatens food security. The adverse effects of these abiotic stresses are exacerbated by climate change, which is predicted to lead to an increase in the frequency of extreme weather. How plants sense stress signals and adapt to adverse environments are fundamental biological questions. Rice is an important source of food crops in my country, and understanding stress signals and responses will improve our ability to enhance its resistance, thereby achieving agricultural sustainability and food security for a growing population.

[0003] The core stress signaling pathway involves the important second messenger Ca 2+ As well as Ca 2+ Calcium-dependent protein kinases (CDPKs) are involved in the regulation of ion and water transport and in the reprogramming of metabolism and gene expression, thereby achieving ion and water homeostasis and cellular stability under stress conditions. 2+ -dependent protein kinase, including some CDPK-related kinases (CRKs), are important Ca-dependent kinases that have been identified in plants. 2+ One of the signal sensors. Although Ca 2+ The involvement of CRK4 and its channels in regulating temperature stress responses has been widely studied, but the molecular mechanism by which CRK4 co-regulates high and low temperature stress responses and whether this function is related to stomatal movement under temperature stress have not been clearly studied. Summary of the invention

[0004] The main purpose of the present invention is to provide a rice CRK4 protein or its encoding gene for use in improving plant resistance to high and low temperatures. At the same time, overexpression of the rice gene CRK4 can also simultaneously improve the heat and cold resistance of rice seedlings, which is beneficial to the genetic improvement of rice resistance to temperature stress.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions.

[0006] In a first aspect, the present invention provides a nucleic acid encoding a rice CRK4 protein. The nucleic acid encodes a rice CRK4 protein. The rice CRK4 protein comprises an amino acid sequence as shown in SEQ ID NO:3.

[0007] Furthermore, the nucleic acid comprises the nucleotide sequence shown in SEQ ID NO: 1 or a degenerate sequence thereof.

[0008] Furthermore, the nucleic acid comprises the nucleotide sequence shown in SEQ ID NO: 2 or a degenerate sequence thereof.

[0009] In a second aspect, the present invention provides an application of rice CRK4 protein or a gene encoding rice CRK4 protein, wherein the application is one or more of the following:

[0010] A) Regulate the stomatal aperture of plant leaves under temperature stress conditions;

[0011] B) Regulate the water loss rate of plants under temperature stress conditions;

[0012] C) Simultaneously improve the plant's ability to tolerate both high and low temperature abiotic stresses;

[0013] D) Cultivate plant varieties that have dual abiotic stress tolerance of high temperature and low temperature.

[0014] Further, the A) is specifically,

[0015] Overexpression of the rice CRK4 gene in plants induces closure of leaf stomata under temperature stress conditions.

[0016] Reducing the expression of the rice CRK4 gene in plants reduces the closing speed of leaf stomata of plants under temperature stress conditions.

[0017] Further, the B) is specifically,

[0018] Overexpression of the rice CRK4 gene in plants reduces the water loss rate of plants under temperature stress conditions,

[0019] Reducing the expression of the rice CRK4 gene in plants increases the water loss rate of the plants under temperature stress conditions.

[0020] Furthermore, the temperature stress is high temperature or low temperature; the high temperature is 48°C, and the low temperature is 6°C.

[0021] Further, the C) is specifically,

[0022] Overexpression of the rice CRK4 gene in plants improves the plants' resistance to high temperatures and low temperatures.

[0023] Reducing the expression of the rice CRK4 gene in plants reduces the plants' resistance to high and low temperatures.

[0024] Furthermore, the nucleotide sequence of the gene encoding the rice CRK4 protein is shown in SEQ ID NO.1, and the CDS sequence of the gene encoding the rice CRK4 protein is shown in SEQ ID NO.2.

[0025] Furthermore, the amino acid sequence of the rice CRK4 protein is shown in SEQ ID NO.3.

[0026] Furthermore, the overexpression of the rice CRK4 gene comprises the following steps:

[0027] (1) constructing a recombinant overexpression vector containing the CDS of the rice CRK4 gene;

[0028] (2) Transforming the recombinant overexpression vector into plant tissues or plant cells.

[0029] Furthermore, the reducing the expression of the rice CRK4 gene comprises the following steps:

[0030] (1) constructing a recombinant expression vector containing the mutant of the rice CRK4 gene;

[0031] (2) Transforming the recombinant expression vector into plant tissues or plant cells.

[0032] Furthermore, the mutant is obtained through CRISPR gene editing technology.

[0033] Furthermore, the types of the mutants include gene knockout, base mutation, base insertion or base deletion.

[0034] Furthermore, in the mutant, 1 bp is inserted into target 1 and target 2 at positions 383 bp and 538 bp away from the start codon, respectively, resulting in a premature termination codon at position 180aa in the protein sequence.

[0035] Furthermore, the mutant is that target 1 lacks 7bp at the position 371bp to 376bp from the start codon, and target 2 has 1bp inserted at the position 538bp from the start codon, resulting in the deletion of two amino acids in the protein sequence at the 125-127aa position.

[0036] Compared with the prior art, the present invention has the following technical effects:

[0037] The present invention proves for the first time that overexpression of rice CRK4 gene can significantly induce stomatal closure of rice under high temperature and low temperature stress, and can also significantly reduce water loss rate under high temperature and low temperature stress. Therefore, rice CRK4 protein and its encoding gene and recombinant vector can be used to enhance the ability of crops to withstand high temperature and low temperature dual stress, providing a new resource for rice stress resistance breeding.

[0038] Definitions of terms used in this invention

[0039] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0040] The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides or ribonucleotides and polymers thereof in single-stranded or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides, which have binding properties similar to reference nucleic acids and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically limited, the term also means oligonucleotide analogs, which include PNA (peptide nucleic acid), DNA analogs used in antisense technology (phosphorothioate, phosphoramidate, etc.). Unless otherwise specified, a specific nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (including but not limited to degenerate codon substitutions) and complementary sequences as well as explicitly specified sequences. In particular, degenerate codon substitutions can be achieved by generating a sequence in which the 3rd position of one or more selected (or all) codons is substituted with mixed bases and / or deoxyinosine residues.

[0041] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to polymers of amino acid residues. That is, descriptions directed to polypeptides are equally applicable to describing peptides and describing proteins, and vice versa. The terms apply to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally encoded amino acids. As used herein, the terms encompass amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are linked via covalent peptide bonds.

[0042] The term "recombinant host cell strain" or "host cell" means a cell comprising a polynucleotide of the present invention, regardless of the method used for insertion to produce a recombinant host cell, such as direct uptake, transduction, mating, or other methods known in the art. The exogenous polynucleotide may be maintained as a non-integrating vector such as a plasmid or may be integrated into the host genome. The host cell may be a prokaryotic cell or a eukaryotic cell, and the host cell may also be a monocotyledonous or dicotyledonous plant cell.

[0043] The term "transformation" as used herein refers to genetically transforming a polynucleotide or polypeptide into a plant by introducing a coding gene into a plant cell. Methods for introducing the polynucleotide or polypeptide into a plant are well known in the art, including but not limited to stable transformation methods, transient transformation methods, and virus-mediated methods.

[0044] The term "pore opening" as used herein refers to the ratio of pore width to pore length.

[0045] The term "water loss rate" in the present invention refers to the ratio of plant weight loss before and after heat / cold treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 Shows the knockout status of various rice CRK4 gene lines.

[0047] Figure 2 The transgenic plants were positively identified by PCR for overexpression material.

[0048] Figure 3 The expression levels of various strains of rice CRK4 gene overexpression materials.

[0049] Figure 4 The stomatal opening of CRK4-overexpressing, CRISPR-knockout transgenic plants and wild-type plants under 48℃ and 6℃ treatments is monitored. A is the statistical results of stomatal opening of crk4-1 mutants after treatment at 48℃ (0h, 1h, 6h and 12h). B is the statistical results of stomatal opening of crk4-1 mutants after treatment at 6℃ (0h, 1h, 3h, 9h and 12h). C is the statistical results of stomatal opening after CRK4 overexpression at 48℃ (0h, 0.5h, 1h and 6h). D is the statistical results of stomatal opening after CRK4 overexpression at 6℃ (0h, 0.5h, 1h and 6h).

[0050] Figure 5 The water loss rate of overexpressed CRK4, CRISPR knockout transgenic plants and wild-type plants under 48℃ and 6℃ treatment was monitored. A is the statistical results of water loss rate of crk4-1 mutant after treatment at 48℃ (0h, 1h, 3h, 6h, 12h, 24h, 48h, 60h and 72h). B is the statistical results of water loss rate of crk4-1 mutant after treatment at 6℃ (0h, 1h, 3h, 6h, 12h, 24h, 48h, 60h and 72h). C is the statistical results of water loss rate after overexpression of CRK4 at 48℃ (0h, 1h, 3h, 6h, 12h, 24h, 48h, 72h and 96h). D is the statistical results of water loss rate after overexpression of CRK4 at 6℃ (0h, 1h, 3h, 6h, 12h, 24h, 48h, 72h and 96h).

[0051] Figure 6The heat tolerance phenotypes of overexpressed CRK4, CRISPR knockout transgenic plants and wild-type plants at the seedling stage under 48℃ treatment. A is the phenotypic picture of crk4-1 and crk4-2 mutants treated at 48℃ for 43h and 7d of recovery. B is the statistical results of the survival rate of crk4-1 and crk4-2 mutants after 48℃ treatment. C is the phenotypic picture of overexpressed CRK4 treated at 48℃ for 60h and 7d of recovery. D is the statistical results of the survival rate of overexpressed CRK4 after 48℃ treatment.

[0052] Figure 7 The cold tolerance phenotypes of overexpressed CRK4, CRISPR knockout transgenic plants and wild-type plants at the seedling stage under 6℃ treatment. A is the phenotypic picture of crk4-1 and crk4-2 mutants treated at 6℃ for 48h and recovered for 7d. B is the statistical results of the survival rate of crk4-1 and crk4-2 mutants after 6℃ treatment. C is the phenotypic picture of overexpressed CRK4 treated at 6℃ for 84h and recovered for 7d. D is the statistical results of the survival rate of overexpressed CRK4 after 6℃ treatment. DETAILED DESCRIPTION

[0053] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0054] Example 1 Genetic transformation experiment of CRK4 gene in rice

[0055] 1. Construction of CRK4 gene overexpression vector

[0056] Firstly, the Gateway method was used to construct the intermediate pDONR221 and the final pHpt-PSAT-N through BP and LR reactions, and then linearized and recovered.

[0057] Primers were designed based on the full-length sequence of Nipponbare, and the full-length gene coding region of CRK4 protein was amplified using Nipponbare cDNA as a template. The sequence is shown in SEQ ID NO.1. The linearized linker of pDONR221 vector was added to the 5′ and 3′ ends. The amplification primers are:

[0058] Table 1 CRK4 gene primers

[0059]

[0060] PCR amplification and recovery of the target DNA fragment (1785bp). The target fragment was connected to the overexpression vector pHpt-PSAT-N by BP and LR reactions using the Gateway method. The positive clone plasmid was verified by PCR and sequencing. The sequencing results showed that the CRK4 gene fragment shown in SEQ ID NO.1 was inserted into the vector pHpt-PSAT-N, and the recombinant vector was named pHpt-PSAT-CRK4.

[0061] 1. Construction of CRISPR knockout vector for CRK4 gene

[0062] The target site for knockout was designed based on the cDNA sequence of the CRK4 gene. The website used was: http: / / www.genome.arizona.edu / crispr / CRISPRsearch.html. The information of the designed target site is as follows: Figure 1 shown.

[0063] Mutation type 1 (crk4-1) targets 1 and 2 had 1 bp inserted at 383 bp and 538 bp away from the start codon, respectively, resulting in a premature stop codon at the 180aa position in its protein sequence.

[0064] In mutation type 2 (crk4-2), target 1 is missing 7 bp at the position 371bp to 376bp from the start codon, and target 2 is inserted 1 bp at the position 538bp from the start codon, resulting in the deletion of two amino acids in the protein sequence at the position 125 to 127aa.

[0065] Target site 1 sequence: 5'-GACCGAGGTCGGCCTCGACA-3' (SEQ ID NO.6)

[0066] Target site 2 sequence: 5'-AGTTCTATGATGCTTTCG-3' (SEQ ID NO. 7).

[0067] Primers CRK4 T1-BsF, CRK4 T1-F0, CRK4T1-R0 and CRK4 T1-BsR, CRK4 T2-BsF, CRK4 T2-F0, CRK4 T2-R0 and CRK4 T2-BsR were designed according to the target sites, and four-primer PCR amplification was performed using the 100-fold diluted pCBC-MT1T2 plasmid as a template. The PCR products were purified and recovered, and the final vector was constructed using the enzyme digestion-ligation system, and the vector was named CRISPR-CRK4.

[0068] Table 2 CRK4 gene target primers

[0069]

[0070] After screening, mutants crk4-1 and crk4-2 were obtained.

[0071] 3. Agrobacterium Transformation

[0072] The expression vector pHpt-PSAT-CRK4 and the knockout vector CRISPR-CRK4 were transferred into Agrobacterium EHA105 competent cells (the competent cells were purchased from Shanghai Bioengineering Company) by freeze-thaw method. The specific experimental methods refer to the molecular cloning experimental guide.

[0073] The following overexpression and mutant strain primers are used for subsequent material identification to determine whether they are homozygous. The identification primers used are as follows. The identification results are as follows: Figure 2 As shown, the primers for hygromycin were used, and the primers were Hyg + -F and Hyg + -R, wherein lanes 1-12 are for identification of overexpressed materials, lane 13 is for negative control, and lane 14 is for negative control of added double distilled water.

[0074] Table 3 Primers for identification of CRK4 overexpressing plants

[0075] Primer name Primer sequence 5'-3' Hyg-F CTGCCCGCTGTTCTACAACCGG(SEQ ID NO.16) Hyg-R GGAGCATATACGCCCGGAGTC(SEQ ID NO.17)

[0076] Table 4 Primers for identification of CRK4 mutant plants

[0077] Primer name Primer sequence 5'-3' CRK4-T1-F CGAAGCAGCCGAAGTTCC(SEQ ID NO.18) CRK4-T1-R ATGGCATTCGGATTCTCCA(SEQ ID NO.19) CRK4-T2-F GATGACGACTGCTATTGC(SEQ ID NO.20) CRK4-T2-R GCTCTAACTGACATAAGAC(SEQ ID NO.21)

[0078] 4. qRT-PCR expression identification

[0079] After the NIP wild-type and CRK4 overexpressing transgenic rice seedlings were grown, qRT-PCR was performed to identify each strain. A small amount of transgenic rice leaves were taken and total RNA was extracted according to the Trizol method of Invitrogen Company and converted into cDNA.

[0080] Design of CRK4 gene qRT-PCR specific primers:

[0081] Table 5 qRT-PCR primers for CRK4 overexpression plants

[0082] Primer name Primer sequence 5'-3' CRK4-RT-F GTCATGGCAAGCCGAG(SEQ ID NO.22) CRK4-RT-R ACATCCGCGCGCTCCT(SEQ ID NO.23)

[0083] Using the expression of rice actin rRNA as an internal reference, qRT-PCR verification was performed on transgenic lines CRK4-OE#1, CRK4-OE#3, CRK4-OE#4, CRK4-OE#6, and CRK4-OE#8 according to the operating instructions of Roche Fast Start Universal SYBRGreen Master (ROX). The verification results are shown in Figure 3As shown, the expression levels of CRK4 in the four CRK4 overexpression lines OE#1, OE#4 and OE#6 were all increased compared with the NIP wild type.

[0084] Example 2 Identification of stress resistance of CRK4 overexpressing plants and CRISPR knockout mutant plants

[0085] 1. Growth conditions

[0086] (1) Select T3 generation CRK4 overexpressing transgenic wild-type Nipponbare seeds.

[0087] (2) Rice soil culture: After the newly harvested seeds break dormancy, soak them in a 28℃ incubator for 3 days until they germinate and then sow them. Select seeds with consistent germination and sow them evenly in a mixed soil prepared with a ratio of nutrient soil to vermiculite of 3:1. Cover the surface with a layer of vermiculite and grow them normally in a 28℃ incubator. Water them once every 2-3 days.

[0088] (3) Rice hydroponics: Seeds with uniform germination were selected and sown on a 96-well PCR plate with the bottom removed. The plate was placed in a 28°C incubator for growth. The water was changed every 2-3 days. When the third leaf was just emerging, an appropriate amount of nutrient solution was added. After the third leaf was fully expanded, the solution was replaced with clean water.

[0089] (4) The sterilized rice seeds were germinated at room temperature and then sown. Each experimental group was set up with at least 3 replicates. After culturing at 28°C for 2 weeks under the above conditions, they were heat treated at 48°C for 2-3 days and cold treated at 6°C for 2-4 days (depending on the actual situation), and then transferred to 28°C to resume growth for 7 days.

[0090] 2. For the measurement of stomatal aperture, the mutant and wild-type plants were treated with high and low temperatures; the second leaves of the plants were selected (3-4 leaves were taken each time), nail polish was applied to the surface of the leaves to fix the stomatal shape, and the colloid was air-dried and condensed into a thin film, and then the film was torn off with clean tweezers; a glass slide was made for subsequent microscopic observation, and photographed and preserved; finally, the width and length of the stomatal guard cells were measured using the software ImageJ, and the width / length value was calculated to calculate the stomatal aperture. The experimental results are as follows: Figure 4 As shown, according to Figure 4 C and 4D show that overexpression of the rice CRK4 gene in rice can significantly induce stomatal closure in rice under high and low temperature stress.

[0091] 3. For the measurement of water loss rate, set at least three biological replicates for each temperature treatment time point, and select at least three rice seedlings grown to the three-leaf stage, put them in a 50mL EP tube, add an equal amount of water and wait for subsequent treatment; before the plants are treated, wipe off the excess water on the plants with a test paper, weigh their weight, and record it as m1; treat the plants with high or low temperature, take out the plants at each set time point, wipe off the excess water on the plants with a test paper, weigh their weight, and record it as m2; use the formula: (m1-m2) / m1 to calculate the plant's living water loss rate, and use a line graph to record the changes. The test results are as follows: Figure 5 As shown, according to Figure 5 C and 5D show that overexpression of the rice CRK4 gene in rice can significantly reduce the water loss rate under high and low temperature stress.

[0092] 4. For the survival rate of heat stress resistance in the seedling stage, the judgment standard of this study is whether new leaves grow. If there are new leaves, the plant is considered alive, otherwise, it is judged to be dead. Figure 6 As shown, according to Figure 6 D shows that overexpressing the rice CRK4 gene in rice can significantly improve the rice's ability to resist high temperature stress.

[0093] 5. For the survival rate of seedlings resistant to cold stress, the criterion of this study is whether new leaves grow. If there are new leaves, the plant is considered alive, otherwise, it is considered dead. Figure 7 As shown, according to Figure 7 D shows that overexpressing the rice CRK4 gene in rice can significantly improve the rice's ability to resist low temperature stress.

[0094] Therefore, rice CRK4 protein, its encoding gene and recombinant vector can be used to enhance the dual stress resistance of crops.

[0095] Unless otherwise specifically stated, the numerical value set forth in these embodiments does not limit the scope of the present invention. In all examples shown and described here, unless otherwise specified, any specific value should be interpreted as merely exemplary, rather than as restriction, and therefore, other examples of exemplary embodiments may have different values.

Claims

1. A nucleic acid encoding a rice CRK4 protein, characterized in that: The nucleic acid encodes a rice CRK4 protein, and the rice CRK4 protein comprises an amino acid sequence as shown in SEQ ID NO:

3.

2. The nucleic acid according to claim 1, characterized in that The nucleic acid comprises the nucleotide sequence shown in SEQ ID NO: 1 or a degenerate sequence thereof.

3. The nucleic acid according to claim 1, characterized in that The nucleic acid comprises the nucleotide sequence shown in SEQ ID NO: 2 or a degenerate sequence thereof.

4. Use of rice CRK4 protein or its encoding nucleic acid, characterized in that: The application is one or more of the following, A) Regulate the stomatal aperture of plant leaves under temperature stress conditions; B) Regulate the water loss rate of plants under temperature stress conditions; C) Simultaneously improve the plant's ability to tolerate both high and low temperature abiotic stresses; D) Cultivate plant varieties that have dual abiotic stress tolerance of high temperature and low temperature.

5. The use according to claim 4, characterized in that: The A) is specifically: Overexpression of the rice CRK4 gene in plants induces closure of leaf stomata under temperature stress conditions. Reducing the expression of the rice CRK4 gene in plants reduces the closing speed of leaf stomata of plants under temperature stress conditions.

6. The use according to claim 4, characterized in that: Specifically, B) is: Overexpression of the rice CRK4 gene in plants reduces the water loss rate of plants under temperature stress conditions, Reducing the expression of the rice CRK4 gene in plants increases the water loss rate of the plants under temperature stress conditions.

7. The use according to claim 4, characterized in that: Specifically, C) is: Overexpression of the rice CRK4 gene in plants improves the high temperature and low temperature resistance of the plants. Reducing the expression of the rice CRK4 gene in plants reduces the high temperature and low temperature tolerance of the plants.

8. The use according to any one of claims 1 to 7, characterized in that: The overexpression of rice CRK4 gene comprises the following steps: (1) constructing a recombinant overexpression vector containing the CDS of the rice CRK4 gene; (2) Transforming the recombinant overexpression vector into plant tissues or plant cells.

9. The use according to any one of claims 1 to 7, characterized in that: The method of reducing the expression of the rice CRK4 gene comprises the following steps: (1) constructing a recombinant expression vector containing a mutant of the rice CRK4 gene, wherein the mutant comprises gene knockout, base mutation, base insertion or base deletion; (2) Transforming the recombinant expression vector into plant tissues or plant cells.

10. The use according to claim 9, characterized in that: The nucleotide sequence of the gene encoding the rice CRK4 protein is shown in SEQ ID NO.1, the CDS sequence of the gene encoding the rice CRK4 protein is shown in SEQ ID NO.2, and the amino acid sequence of the rice CRK4 protein is shown in SEQ ID NO.3.

Images