Corynebacterium glutamicum gene editing tool based on corynebacterium endogenous recombinase and application of corynebacterium glutamicum gene editing tool

Abstract

The invention discloses a corynebacterium glutamicum gene editing tool based on corynebacterium endogenous recombinase and application of the corynebacterium glutamicum gene editing tool, and belongs to the technical field of gene editing. In order to solve the problem of low gene editing efficiency of non-model strains, an efficient gene editing tool based on cpf1 is constructed by taking C.glutamicum S9114 as an example, specifically, due to the fact that at present, corynebacterium glutamicum does not have a gene editing recombinase with good compatibility and lacks an editing system with good efficiency, screening is carried out through a blast iteration method, and the gene editing efficiency of the corynebacterium glutamicum is greatly improved. A novel tool enzyme CauR from C. aurimucosum ATCC 700975 is provided for gene editing of the strain, and the efficiency of the novel tool enzyme CauR in a non-model strain corynebacterium glutamicum S9114 is higher than that of existing efficient recombinase recET and red systems. On the basis, the Cpf1 nuclease and the CauR recombinase are coupled, so that the homologous recombination capability of the C.glutamicum S9114 is further remarkably improved, and a new choice is provided for gene editing of a non-model strain.

Description

Technical Field

[0001] The present invention relates to a Corynebacterium glutamicum gene editing tool based on Corynebacterium endogenous recombinase and application thereof, belonging to the technical field of gene editing. Background Art

[0002] Corynebacterium glutamicum is a strain widely used in industrial production and has been applied to the biosynthesis of high-value products such as amino acids, organic acids and terpenoids. Due to its advantages such as rapid growth, rich metabolite variety and high yield, Corynebacterium glutamicum has gradually become an ideal host in the field of industrial biosynthesis. Therefore, the development of precise and efficient gene editing tools has become a current research focus, aiming to further improve the efficiency and diversity of its metabolite synthesis.

[0003] At present, significant progress has been made in gene editing tools for Corynebacterium glutamicum, mainly using the following two strategies: one is the gene editing method based on the CRISPR-Cpf1 system, and the other is to achieve gene editing by using the sacB gene lethal screening. CRISPR-Cpf1 is widely used in genome editing of various microorganisms due to its efficient DNA cutting function, while the sacB gene is often used to achieve negative screening to effectively remove cells that are not edited correctly. Although these methods improve the accuracy and controllability of editing, their editing efficiency is still limited. In order to further improve the editing efficiency, the use of homologous recombinases has gradually become an effective strategy in recent years. In prokaryotic gene editing, the RecE / RecT recombinase system and the λred system are widely used in a variety of prokaryotic microorganisms, showing high homologous recombination efficiency.

[0004] In the development of various microbial gene editing tools, current research is mainly focused on model strains, and researchers usually use homologous recombinases to enhance the efficiency of homologous recombination. However, existing recombinase systems such as RecE / RecT and λRed recombination systems have limitations in compatibility. Especially in the application of non-model strains such as Corynebacterium glutamicum, these recombinases have poor compatibility and are difficult to meet the needs of different microbial chassis, resulting in low gene editing efficiency. In addition, many developed gene editing tools are not optimized for non-model strains, which limits their effective application in non-model strains. Summary of the invention

[0005] To solve the above problems, the present invention combines a screened endogenous recombinase CauR with better compatibility with the non-model strain Corynebacterium glutamicum S9114 with other commonly used gene editing nucleases to provide a new tool for gene editing of Corynebacterium glutamicum. The tool can achieve efficient gene editing, and has the advantages of simple operation and low time cost, providing an important reference for gene editing of other non-model strains.

[0006] The first object of the present invention is to provide an enzyme composition for gene editing of Corynebacterium glutamicum, wherein the enzyme composition comprises a first tool enzyme and a second tool enzyme, the nucleotide sequence of the first tool enzyme is shown in SEQ ID NO.1, and the second tool enzyme is a recombinase and / or a nuclease.

[0007] Furthermore, the recombinase includes but is not limited to RecE recombinase, RecT recombinase, λRed recombinase, etc.; the nuclease includes CRISPR nuclease.

[0008] Preferably, the CRISPR nuclease includes but is not limited to any one or a combination of Cpf1, Cas9 and mutants of both.

[0009] The second object of the present invention is to provide a nucleic acid molecule encoding the above enzyme composition.

[0010] The third object of the present invention is to provide a Corynebacterium glutamicum gene editing plasmid, wherein the Corynebacterium glutamicum gene editing plasmid contains sequences encoding a first tool enzyme and a second tool enzyme, the nucleotide sequence of the first tool enzyme is shown in SEQ ID NO.1, and the second tool enzyme is a recombinase and / or a nuclease. Of course, those skilled in the art will appreciate that the gene editing plasmid may contain one or more expression vectors, such as only one expression vector, and the sequences encoding the first tool enzyme and the second tool enzyme are both located on the vector; if there are multiple vectors, the sequences encoding the first tool enzyme and the second tool enzyme may be located on different vectors, respectively. Preferably, the sequences encoding the first tool enzyme and the second tool enzyme are located on the same expression vector (such as a plasmid).

[0011] Further, the gene editing plasmid of Corynebacterium glutamicum also contains a promoter for starting the first tool enzyme and / or the second tool enzyme. Preferably, the promoter is a constitutive promoter or an inducible promoter, the constitutive promoter includes the hom promoter, and the inducible promoter includes the trc promoter.

[0012] Furthermore, the expression vector may be selected from plasmid pJYS3, pXMJ19 plasmid, etc. Most preferably, plasmid pJYS3 is used, the inducible promoter trc is used to inducibly express the cpf1 gene, and the constitutive promoter hom is used to express the endogenous homologous recombinase CauR from Corynebacterium aurimucosum ATCC 700975.

[0013] The fourth object of the present invention is to provide a Corynebacterium glutamicum gene editing system, which contains the enzyme composition, nucleic acid molecule or Corynebacterium glutamicum gene editing plasmid.

[0014] Furthermore, the Corynebacterium glutamicum gene editing system also contains components that cooperate with the first tool enzyme and the second tool enzyme to perform gene editing, such as crRNA, sgRNA, etc. As above, those skilled in the art can understand that these components can be located on the same vector or on different vectors as the tool enzymes, or no vector is required.

[0015] Furthermore, the Corynebacterium glutamicum gene editing system also contains a donor vector, which includes a target gene and homology arms connected to both ends of the target gene.

[0016] Furthermore, the target gene includes dsDNA and ssDNA. The dsDNA template and the ssDNA template are designed according to the target gene to be edited. Specifically, dsDNA is used to achieve gene knockout, and ssDNA is used to achieve single base mutation.

[0017] Further, the length of the homology arm is 60-5000 bp. Among them, the length of the dsDNA homology arm is 100-5000 bp; the length of the ssDNA homology arm is 60-100 bp. Preferably, the length of the dsDNA homology arm is 1000-2000 bp.

[0018] The fifth object of the present invention is to provide a recombinant Corynebacterium glutamicum containing the enzyme composition, nucleic acid molecule, gene editing plasmid or gene editing system.

[0019] Furthermore, the host bacteria of the recombinant Corynebacterium glutamicum include but are not limited to Corynebacterium glutamicum S9114.

[0020] In the present invention:

[0021] In order to solve the problem of difficult gene editing of non-model strains, the present invention uses C.glutamicum S9114, a non-model strain, as a cell to be edited, and selects the homologous recombinase CauR from Corynebacterium aurimucosum ATCC 700975 for gene editing, which significantly improves the homologous recombination ability of C.glutamicum S9114. And the endogenous recombinase CauR of Corynebacterium is combined with the Cpf1 editing system to construct an efficient gene editing tool for C.glutamicum S9114. Compared with traditional gene editing tools based on cpf1, the present invention not only improves the efficiency of gene editing, but also overcomes the problem of insufficient compatibility of the current recombinase system in non-model strains, and is easy to operate, low in time cost, and also provides a more applicable and efficient solution for genome engineering transformation of non-model microorganisms.

[0022] The sixth object of the present invention is to provide the use of the enzyme composition, nucleic acid molecule, gene editing plasmid or gene editing system in gene editing of Corynebacterium glutamicum.

[0023] Furthermore, the gene editing includes but is not limited to gene knockout, base mutation, etc.

[0024] Furthermore, when the promoter of the tool enzyme is an inducible promoter, the use includes the step of adding an inducer. Preferably, the concentration of the inducer is 0.2-2.0 mM.

[0025] Further, the application includes the step of resuscitating the successfully transformed recombinant Corynebacterium glutamicum and supplementing the inducer for resuscitation culture. Preferably, the duration of supplementing the inducer for resuscitation culture is 0-3 hours, and the inducer concentration is 0.2-2.0 mM.

[0026] The seventh object of the present invention is to provide an efficient gene editing method for Corynebacterium glutamicum, comprising the step of introducing the gene encoding the gene editing system into Corynebacterium glutamicum.

[0027] Beneficial effects of the present invention:

[0028] The present invention retrieves a series of recT-like recombinases from Corynebacterium by the method of iterative blast search, and four recombinases are found to have recE structures in the upstream of their genome. The recombination efficiency of these four recombinases was subsequently tested, and the results showed that compared with the existing efficient recombinase recET and red system, the recombinase CauR from CorynebacteriumaurimucosumATCC 700975 had the best recombination efficiency, and the recombinase was used for gene editing, which can achieve gene knockout and single base mutation. Based on this, the present invention takes C.glutamicum S9114, a non-model strain, as an example, and constructs a gene editing tool based on endogenous recombinase combined with cpf1, taking the ldhA gene knockout of C.glutamicumS9114 as an example, which significantly improves the gene editing efficiency, and the gene efficiency of the original cpf1 editing tool is 2%, and the efficiency of the gene editing tool developed by us is increased to 77%. In addition, compared with existing gene editing methods, the present invention reduces the complexity of operation while improving editing efficiency. Since the gene editing system is a single-plasmid system, it only requires one electroporation, avoiding the problem of a long editing cycle of two electroporations of a double-plasmid system, which brings significant advantages to the rapid development and application of non-model microbial genetic engineering. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 is a schematic diagram of the screening method of the present invention;

[0030] Figure 2 It is the complete screening result of the present invention;

[0031] Figure 3 It is the recombination efficiency test process and results of the present invention;

[0032] Figure 4 is the sequence alignment result of the recombinase screened in the present invention;

[0033] Figure 5 is a map of plasmid pJYS3-trc-cpf1-hom-CauR-ldhAcrRNA;

[0034] Figure 6 The editing efficiency of knocking out the ldhA gene of Corynebacterium glutamicum S9114 using a combination of gene editing tools;

[0035] Figure 7 The results are for optimizing the efficiency of gene editing tools. DETAILED DESCRIPTION

[0036] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0037] 1. The methods and materials involved in the present invention are as follows:

[0038] (I) Culture medium

[0039] E. coli culture medium LB (g / L): yeast powder 5.0, peptone 10.0, NaCl 10.0

[0040] Seed activation liquid medium BHIS (g / L): brain heart infusion 37.0, sorbitol 91.0.

[0041] Seed activation solid medium BHIS (g / L): brain heart infusion 37.0, sorbitol 91.0, nutrient agar 20.0.

[0042] Competent medium (g / L): peptone 10.0, yeast extract 5.0, NaCl 10.0, glycine 30.0, isoniazid 4.0, and 10 mL of Tween 80.

[0043] After electroporation, the recovery medium BHIS (g / L) was as follows: 5.0% peptone, 2.5% yeast extract, 5.0% NaCl, 18.5% brain heart infusion, and 91.0% sorbitol.

[0044] Solid BHIS medium for transformant coating (g / L): 5.0% peptone, 2.5% yeast extract, 5.0% NaCl, 18.5% brain heart infusion, 91.0% sorbitol, and 20.0% nutrient agar.

[0045] Sterilization conditions: 115°C, 20 min. All culture media used for transformant detection or recombinant bacterial culture were added with 25 mg / L kanamycin sulfate.

[0046] (III) PCR method

[0047] The PCR reaction system was: 25 μL PrimeSTAR Max (purchased from Takara), 1 μL forward primer (10 μM), 1 μL reverse primer (10 μM), 1 μL template DNA, and 22 μL double distilled water. The PCR amplification conditions were: 98°C pre-denaturation for 5 min; followed by 30 cycles of 98°C for 10 s, 55°C for 15 s, and 72°C for 3 min, and finally 72°C for 5 min.

[0048] (IV) Method for preparing competent E. coli cells

[0049] E. coli competent cells were prepared using a Competent Cell Preparation Kit (purchased from Takara). The preparation method is described in the kit instructions.

[0050] (V) Plasmid chemical transformation of E. coli competent cells

[0051] The competent E. coli cells stored in the ultra-low temperature refrigerator were placed on ice to melt; 6 μL of PCR product was added and gently mixed, and ice bathed for 45 minutes. The centrifuge tube containing the competent cells was placed in a 42°C water bath for heat shock for 90 seconds, and the centrifuge tube was transferred to an ice bath to cool the cells for 2 minutes; 800 μL of LB culture medium was added and cultured at 37°C for 1 hour; a small amount of supernatant was removed by centrifugation, and the bacteria were resuspended, and the culture solution was spread on the LB plate containing the corresponding antibiotics, and inverted at 37°C for 10-12 hours. The colonies were observed, and a single colony was picked to verify the positive clone using colony PCR. The positive single colony was picked and cultured in LB liquid culture medium overnight, and the plasmid was extracted and sequenced for verification.

[0052] (VI) Preparation of electrocompetent cells of Corynebacterium glutamicum

[0053] (1) Corynebacterium glutamicum was inoculated into BHIS medium (selection was required on a freshly cultured slant, otherwise the growth of the bacteria would be affected), placed on a roving shaker (200 rpm), and cultured at 30°C for 16 h until the OD600 reached 3.0.

[0054] (2) Transfer the bacterial solution in (1) to the competent medium at an inoculum volume of 10% until the OD600 reaches 0.3, place it on a roving shaker (200 rpm), and culture it at 30°C until the OD600 reaches 0.9 (culture for about 3-5 hours, and it is in the logarithmic growth phase. Generally, if the bacterial concentration remains low at about 0.6, the subsequent operation can be continued). The general concentration multiple is 100 times (50 mL of competent medium is concentrated to 0.5 mL to prepare 5 tubes of competent cells).

[0055] (3) Place the bacterial solution in an ice-water bath for 15 min, centrifuge at 4000 rpm, 4°C for 10 min, and discard the supernatant.

[0056] (4) Fully suspend the cells in 30 mL of pre-cooled 10% glycerol, centrifuge at 4000 rpm, 4°C for 10 min, discard the supernatant, and repeat the washing and resuspending process four times.

[0057] (5) Resuspend the cells in 500 μL of pre-cooled 10% glycerol (concentrated 100 times) and dispense into 1.5 mL sterile centrifuge tubes, with 90-100 μL in each tube.

[0058] (6) Store the aliquoted competent cells at -80°C until use.

[0059] (VII) Electroporation transformation of Corynebacterium glutamicum

[0060] (1) Thaw the competent bacteria of Corynebacterium glutamicum stored at -80°C in an ice bath.

[0061] (2) Add 1-5.0 μL of plasmid, mix well, and place on ice for 5-10 min.

[0062] (3) Add to a pre-cooled 0.1 cm electric shock cup and shock twice at 1.8 kV for 5 ms.

[0063] (4) Quickly add 1.0 mL of culture medium (BHIS) preheated at 46°C, mix well, and transfer to a new 1.5 mL sterile centrifuge tube and incubate in a 46°C water bath for 6 min.

[0064] (5) Place the bacteria on a circulating shaker (220 rpm) and incubate at 30°C for 2 h.

[0065] (6) Centrifuge at 4000 rpm for 2 min at room temperature, discard part of the supernatant, resuspend the remaining bacterial solution and spread it on a solid plate coated with transformants with corresponding resistance, and culture in a constant temperature incubator at 30°C for 2-3 days.

[0066] (VIII) Recombinase efficiency test method

[0067] (1) Construction of plasmid pXMJ19 expressing endogenous recombinase

[0068] Genes CliR, CtiR, CauR, ChuR, CglR, recET, recA, and λred were synthesized using the Gene Synthesis Service of GENEWIZ. The linearized pXMJ19 plasmid was obtained by PCR amplification using the upstream primer (HP-pXMJ19-F) and the downstream primer (HP-pXMJ19-R). The target genes with homology arms were amplified by PCR using the primers CliR-F, CliR-R; CtiR-F, CtiR-R; CauR-F, CauR-R; ChuR-F, ChuR-R; CglR-F, CglR-R; recET-F, recET-R; recA-F, recA-R; λred-F, λred-R with the synthesized genes CliR, CtiR, CauR, ChuR, CglR, recET, recA, and λred templates, respectively. Then, the target genes with homology arms were amplified by PCR using the ClonExpress II One Step Cloning of Novozyme Biotech Co., Ltd. The expression vector and gene fragment were connected by using the Kit rapid cloning kit. The linearized vector obtained by PCR and the target gene fragment with homologous ends of the vector were recovered by gel and mixed at a molar ratio of 3 to 1. 5×CE II Buffer 4μL and Exnase II 2μL were added at the same time. Then ddH2O was added to make the total volume of the connection system reach 20μL. The reaction was carried out at 37℃ for 30min and then reduced to 4℃ for insulation. Then 10μL of the connection system was taken to transform Escherichia coli competent cells. The correct transformants of colony PCR were selected and sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for sequencing verification. Eight plasmids expressing different recombinases were obtained, namely pXMJ19-CliR, pXMJ19-CtiR, pXMJ19-CauR, pXMJ19-ChuR, pXMJ19-CglR, pXMJ19-recET, pXMJ19-recA, and pXMJ19-λred.

[0069] (2) Testing process of recombinase efficiency

[0070] We first constructed the initial strain to verify the efficiency of gene editing. We replaced the ldhA gene in the genome of Corynebacterium glutamicum S9114 with an inactivated Spc resistance gene with a nonsense sequence inserted in the middle; the Spc resistance gene with the amino acid at position 101 replaced with the TAA stop codon, respectively, called strains CgD and CgS. We used these two strains as a basis to verify the dsDNA recombination efficiency and ssDNA recombination efficiency of the recombinase. Specifically, we used strain CgD as a template, using the upstream primer dsDNA-FF and the downstream primer dsDNA-FR to obtain the upstream homologous arm of the nonsense fragment knocked out by PCR amplification, and the upstream primer dsDNA-RF and the downstream primer dsDNA-RR to obtain the downstream homologous arm of the nonsense fragment knocked out by PCR amplification. The upstream and downstream homologous arms were fused into dsDNA by the fusion PCR method. Then we mixed the constructed plasmid with homologous recombinase and dsDNA at a concentration of 500ng / ul: 500ng / ul, and aspirated 1000ng of the mixture into the strain CgD by electroporation. The number of colonies on the plate was used as a characterization method for editing efficiency. The knockout efficiency was then verified again by agarose gel electrophoresis. Similarly, the 90bp-long primer TAT-ssDNA synthesized by Jinweizhi was used as an ssDNA template to restore the activity of the inactivated Spc gene in the strain CgS. For specific test methods, see Figure 3 .

[0071]

[0072] 2. The sequence involved in the present invention is as follows:

[0073] <SEQ ID NO.1> Putative recombinase (CauR) from Corynebacterium aurimucosum:

[0074]

[0075] <SEQ ID NO.2>cpf1:

[0076]

[0077] <SEQ ID NO.3> trc promoter:

[0078] TTGACAATTAATCATCCGGCTCGTATAATG

[0079] <SEQ ID NO.4> hom promoter:

[0080] ctgtaaggcctgcaccaacaatgattgagcgaagctccaaaatgtcctccccgggttgatattagatttcataaatatactaaaaatcttgagagtttttccgttgaaaactaaaaagctgggaaggtgaatcgaatttcggggctttaaagcaaaaatgaacagcttggtctatagtggctaggtaccctttttgttttggacacatgtagggtggccgaaacaaagtaataggacaacaacgctcgaccgcgattatttttggagaatc

[0081] <SEQ ID NO.5> ldhA gene:

[0082] atgaaagaaaccgtcggcaataagattgtcctcattggcgcaggagatgttggagttgcatacgcatacgcactgatcaaccagggcatggcagatcaccttgcgatcatcgacatcgatgaaaagaaactcgaaggcaacgtcatggacttaaaccatggtgttgtgtgggccgattcccgcacccgcgtcactaagggaacctacgctgactgcgaagacgcagccatggttgtcatttgtgccggcgcagcccaaaagccaggcgaaactcgcctccagctggtggacaaaaacgtcaagattatgaagtccatcgttggcgatgtcatggccagcggattcgacggcatcttcctcgtagcctccaacccagtggatatcctcacctacgcagtgtggaaattctccggcctggaatggaaccgcgtgatcggctccggaactgtcctggactccgctagattccgctacatgctcggcgaactctatgaagtggcaccaagctccgtccacgcctacattatcggcgaacacggcgacactgaacttccagtcctgtcctccgcgaccatcgcaggcgtatcgcttagccgcatgctagacaaagacccggagcttgagggccgtctagagaaaattttcgaagacacccgcgacgccgcctatcacatcatcgacgccaagggctccacttcctacggcatcggcatgggtcttgctcgcatcacccgcgcaatcctacaaaaccaagacgttgcagtcccagtctctgcactgctccacggtgaatacggtgaggaagacatctacatcggcaccccagcagtagtaaaccgccgaggcatccgccgcgttgtcgaactagaaatcaccgaccacgagatggaacgcttcaagcattccgcaaataccctgcgcgaaattcagaagcagttcttctaa

[0083] Example 1 Screening method for iterative screening of endogenous recombinases based on Blast

[0084] The recET and λred systems have been proven to have high homologous recombination efficiency, but due to their poor compatibility in Corynebacterium glutamicum, we explored the endogenous recombinase of Corynebacterium based on the recET and λred recombinase systems. We used the amino acid sequences of recE, recT, and λredbeta as the initial sequences, respectively, and used the website https: / / www.ebi.ac.uk / Tools / hmmer / search / jackhmmer to perform blast searches in the Corynebacterium database. In the results of the first search, only the sequence based on recT searched for the endogenous recombinase, and the search based on other recombinases was unsuccessful. Afterwards, we used the results based on the first search as the initial sequence again, and iterated blast again (such as Figure 1 ). Among them, in the final results, we also identified a recE-like enzyme in front of the first four recT-like recombinases with higher scores in their genome. At the same time, we also identified a similar recT recombinase in the model bacterium Corynebacterium glutamicum ATCC 13032 (see the complete screening results for Figure 2 ).

[0085] Afterwards, we characterized the recombination efficiency of the five recombinases screened above (CliR, CtiR, CauR, ChuR, CglR) and the commonly used recET system, λred system, and recA. Figure 3 As shown. The recombinases from Corynebacterium liangguodongii (CliR), Corynebacterium timonense (CtiR), Corynebacterium aurimucosum (CauR), and Corynebacterium humireducens (ChuR) were tested for ssDNA-based homologous recombination efficiency and dsDNA-based homologous recombination efficiency, respectively; the recombinase from Corynebacterium glutamicum (CglR) was only tested for ssDNA homologous recombination efficiency because it did not recognize the recE structure.

[0086] The final results showed that the CauR endogenous recombinase had the greatest improvement in the gene editing efficiency of Corynebacterium glutamicum S9114, and no successful mutations were detected in ssDNA recombination based on the CglR endogenous recombinase. Finally, we also compared the sequences of the four recT-like enzymes we identified, such as Figure 4 As shown, the screened recombinase has certain similarities with recT, which also proves its functional role.

[0087] Example 2 Construction of a gene editing tool based on endogenous recombinase (taking ldhA gene knockout as an example)

[0088] Using plasmid pJYS3 as a template, an upstream primer (HP-pJYS3-F) and a downstream primer (HP-pJYS3-R) were designed to obtain a linear plasmid fragment by PCR amplification, and an upstream primer (cpf1-F) and a downstream primer (cpf1-R) were designed to obtain a cpf1 gene (SEQ ID NO.2) by PCR amplification; using pXMJ19 plasmid as a template, an upstream primer (lac-F) and a downstream primer (lac-R) were designed to amplify the lacIq gene by PCR; using the genome of Corynebacterium glutamicum S9114 as a template, an upstream primer (hom-F) and a downstream primer (hom-R) were designed to amplify the hom promoter by PCR; using the genome of Corynebacterium aurimucosum as a template, an upstream primer (CauR-F) and a downstream primer (CauR-R) were designed to amplify the CauR gene (SEQ ID NO.1) by PCR. The expression vector and gene fragment were connected using ClonExpress IIOne Step Cloning Kit (non-ligase-dependent single-fragment rapid cloning kit) from Novozyme Biotechnology Co., Ltd. The linearized vector obtained by PCR and the target gene fragment with homologous ends of the vector were recovered by gel and mixed in a molar ratio of 3 to 1. At the same time, 4μL of 5×CE II Buffer and 2μL of Exnase II were added, and then ddH2O was added to make the total volume of the connection system reach 20μL. The reaction was carried out at 37℃ for 30min and then reduced to 4℃ for insulation. Then 10μL of the connection system was taken to transform Escherichia coli competent cells. The correct transformants of colony PCR were selected and sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for sequencing verification to obtain the recombinant plasmid pJYS3-trc-cpf1-hom-CauR. After that, the plasmid was used

[0089] pJYS3-trc-cpf1-hom-CauR was used as a template to design upstream primers (ldhA-crRNA-F) and downstream primers (ldhA-crRNA-R) to obtain a linear plasmid fragment with the crRNA sequence of the ldhA gene by PCR amplification. Then, the expression vector and the gene fragment were connected using the ClonExpress II One Step Cloning Kit from Novozymes Biotech Co., Ltd., and the connection was verified to be successful. Then, the plasmid pJYS3-trc-cpf1-hom-CauR-ldhAcrRNA (see the map) was Figure 5) and the constructed ldhA gene dsDNA homology arm ldhA-dsDNA were mixed at a concentration of 1:1 and electroporated into the competent cells of Corynebacterium glutamicum S9114. K-resistant plates with IPTG were coated, and after colonies grew, colony PCR was used to verify the knockout.

[0090]

[0091] The results of gene editing are shown in Figure 6 In the process of constructing the plasmid pJYS3-trc-cpf1-hom-CauR, we tested whether each gene of the plasmid could function normally. When only cpf1 and crRNA targeting the ldhA gene were expressed in the plasmid, and there was no homology arm in the plasmid, the number of strains in the plate after plasmid electroporation was very small, proving that cpf1 can function in cells and successfully cut the genome to cause cell death. When only the recombinase CauR was expressed, the number of cells in the plate after plasmid electroporation was large, indicating that the recombinase had no significant effect on cell growth. When cpf1 and crRNA targeting the ldhA gene were expressed, and the homology arm of ldhA-dsDNA was added as a template to knock out the ldhA gene, there were a small number of strains in the plate after plasmid electroporation, and agarose gel electrophoresis proved that the ldhA gene was successfully knocked out. Using this traditional cpf1 gene editing system, the editing efficiency was about 2%. When the recombinase CauR was expressed and ldhA-dsDNA was added as a template, the number of strains after electroporation was large, and the gene editing efficiency was confirmed to be about 6% by agarose gel electrophoresis. When cpf1, CauR, crRNA were co-expressed and ldhA-dsDNA homology arms were added, the gene editing efficiency was increased to 27%.

[0092] Example 3 Optimization of gene editing tool efficiency

[0093] In order to further optimize the editing efficiency of the gene editing system based on the recombinase CauR combined with cpf1, we carried out a series of optimizations on the amount of IPTG added, post-culture time, homology arm length, etc. ( Figure 7 ). Specifically:

[0094] According to the steps of Example 2, the plasmid pJYS3-trc-cpf1-hom-CauR-ldhAcrRNA and the dsDNA homology arm ldhA-dsDNA targeting the ldhA gene were mixed at a concentration of 1:1, and then electroporated into the competent state of Corynebacterium glutamicum S9114. The recombinant bacteria after electroporation were cultured in the post-electroporation recovery medium BHIS at 30°C for recovery (and then cultured for a period of time or not under the condition of supplementing IPTG). K-resistant plates with a certain concentration of IPTG were coated, and after the colonies grew, colony PCR was used to verify the knockout.

[0095] First, the amount of IPTG added was optimized by gradient. Figure 7 , the efficiency reached 55% when 1.2mM IPTG was added. On this basis, we optimized the length of the homology arms and tested the effects of different lengths of homology arms on editing efficiency. We found that the editing efficiency increased to 63% at 1200bp. Finally, in order to adjust the timing of inducing cpf1, we added two hours of post-culture time and added the corresponding IPTG (1.2mM) during the recovery phase after electroporation, which successfully increased the editing efficiency to 77%.

[0096] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. An enzyme composition for gene editing of Corynebacterium glutamicum, characterized in that: The enzyme composition comprises a first tool enzyme and a second tool enzyme, the nucleotide sequence of the first tool enzyme is shown as SEQ ID NO.1, and the second tool enzyme is a recombinase and / or a nuclease.

2. The enzyme composition according to claim 1, characterized in that The recombinase includes at least one of RecE recombinase, RecT recombinase, and λRed recombinase; the nuclease includes CRISPR nuclease; Preferably, the CRISPR nuclease comprises any one or a combination of Cpf1, Cas9 and mutants of both.

3. A nucleic acid molecule encoding the enzyme composition of claim 1 or 2.

4. A gene editing plasmid of Corynebacterium glutamicum, characterized in that The gene editing plasmid of Corynebacterium glutamicum contains sequences encoding a first tool enzyme and a second tool enzyme, the nucleotide sequence of the first tool enzyme is shown in SEQ ID NO.1, and the second tool enzyme is a recombinase and / or a nuclease.

5. The Corynebacterium glutamicum gene editing plasmid according to claim 4, characterized in that Contain at least one of the following characteristics: (1) The sequence encoding the first enzyme and the sequence encoding the second enzyme are located on the same expression vector or on different expression vectors; (2) The gene editing plasmid of Corynebacterium glutamicum also contains a promoter for initiating the first tool enzyme and / or the second tool enzyme; the promoter is a constitutive promoter or an inducible promoter.

6. The Corynebacterium glutamicum gene editing plasmid according to claim 5, characterized in that Contain at least one of the following characteristics: (1) The expression vector comprises plasmid pJYS3 and / or plasmid pXMJ19; (2) the constitutive promoter includes the hom promoter; (3) The inducible promoter includes the trc promoter.

7. A Corynebacterium glutamicum gene editing system, characterized in that The Corynebacterium glutamicum gene editing system contains the enzyme composition described in claim 1 or 2, the nucleic acid molecule described in claim 3, or the Corynebacterium glutamicum gene editing plasmid described in any one of claims 4-6.

8. The Corynebacterium glutamicum gene editing system according to claim 7, characterized in that: Contain at least one of the following characteristics: (1) The Corynebacterium glutamicum gene editing system also contains components that cooperate with the first tool enzyme and the second tool enzyme to perform gene editing; (2) The gene editing system of Corynebacterium glutamicum also contains a donor vector, which includes a target gene and homology arms connected to both ends of the target gene.

9. The Corynebacterium glutamicum gene editing system according to claim 8, characterized in that Contain at least one of the following characteristics: (1) The original includes crRNA and / or sgRNA; (2) The target gene includes dsDNA or ssDNA; (3) The length of the homology arm is 60-5000bp.

10. Use of the enzyme composition of claim 1 or 2, the nucleic acid molecule of claim 3, the Corynebacterium glutamicum gene editing plasmid of any one of claims 4 to 6, or the Corynebacterium glutamicum gene editing system of any one of claims 7 to 9 in Corynebacterium glutamicum gene editing.

11. The use according to claim 10, characterized in that: The gene editing includes gene knockout or base mutation.

12. The use according to claim 10, characterized in that: Contain at least one of the following characteristics: (1) When the promoter of the tool enzyme is an inducible promoter, the use includes the step of adding an inducer; (2) The application includes the steps of resuscitating the successfully transformed recombinant Corynebacterium glutamicum and then supplementing the inducer to resuscitate the culture.

13. The use according to claim 12, characterized in that: Contain at least one of the following characteristics: (1) The concentration of the inducer is 0.2-2.0 mM; (2) The duration of re-revitalization culture after supplementation of the induction agent is 0-3 hours.

14. A recombinant Corynebacterium glutamicum containing the enzyme composition of claim 1 or 2, the nucleic acid molecule of claim 3, the Corynebacterium glutamicum gene editing plasmid of any one of claims 4 to 6, or the Corynebacterium glutamicum gene editing system of any one of claims 7 to 9.

15. The recombinant Corynebacterium glutamicum according to claim 14, characterized in that The host bacteria of the recombinant Corynebacterium glutamicum include Corynebacterium glutamicum S9114.

16. An efficient gene editing method for Corynebacterium glutamicum, characterized in that: The method comprises the step of introducing the Corynebacterium glutamicum gene editing plasmid described in any one of claims 4 to 6 or the Corynebacterium glutamicum gene editing system described in any one of claims 7 to 9 into Corynebacterium glutamicum.

Images