Soluble expression vector of steroid C14 alpha hydroxylase as well as construction method and application of soluble expression vector

Abstract

The invention discloses a soluble expression vector of steroid C14 alpha hydroxylase as well as a construction method and application of the soluble expression vector, and belongs to the technical field of biotechnology. According to the invention, a nucleotide sequence for coding the steroid C14 alpha hydroxylase and a nucleotide sequence for coding soluble tag maltose binding protein are expressed in a carrier, the nucleotide sequence for coding the steroid C14 alpha hydroxylase is shown as SEQ ID NO.1, and the amino acid sequence of the steroid C14 alpha hydroxylase is shown as SEQ ID NO.2. According to the invention, a soluble expression vector and a soluble expression method of the fungus-derived enzyme in the escherichia coli are established, and a new idea is provided for obtaining soluble components when other CYP enzymes are subjected to heterologous expression in the escherichia coli. By constructing the intramolecular hydrogen transmission system, the electron transfer efficiency in the hydroxylation process is remarkably improved, and the problem that the overall catalytic rate is low due to the fact that the electron transfer efficiency is low in the P450 monooxygenase catalytic reaction is partially solved.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a soluble expression vector of steroid C14α hydroxylase and a construction method and application thereof. Background Art

[0002] Steroids are a large class of natural or synthetic terpenoid lipids, including bile acids, sex hormones and adrenal cortical hormones, etc., with various physiological and pharmacological activities. Their application range in the medical field is constantly expanding and has been widely used in clinical practice. In recent years, more than 300 steroid molecules have been approved for drug development. According to the structural differences and different arrangements of the functional groups connected to the steroid nucleus, steroid molecules are endowed with complex structures and specific physiological functions. Among them, the hydroxylated structure is often the key functional group of active steroid drugs. Therefore, how to achieve the selective hydroxylation of steroid drugs is a key step in the synthesis of active steroid drugs. Biocatalytic hydroxylation is one of the important transformations of steroid nucleus ring functionalization, but it is still a very challenging task in organic synthesis.

[0003] Among various steroidal hydroxylation sites, C14-OH confers special antigonadotropin and carcinogenic biological activities to steroids. The C14 hydroxylation reaction of steroids catalyzed by fungal cells has been widely used in the past few decades. Strains with 14α hydroxylation ability were first discovered in fungi, including Curvularia lunata, Mucor piriformis, Gongronella butleri, Chaetomium, Absidia coerulea, etc. It was not until 2019 that the cytochrome P450 (CYP) family protein P450 from Cochliobolus lunatus was first reported. lun , identified as having 14α-hydroxylation ability. The enzyme was heterologously expressed in Saccharomyces cerevisiae along with its electron transport chain cytochrome P450 reductase (CPR), which can convert substrates AD and RSS into 14α-AD and 14α-RSS. lun Heterologous expression in Mycobacterium smegmatis achieved 14-hydroxylation of AD and ADD.

[0004] Escherichia coli is the preferred bacterial host for the expression of exogenous proteins due to its advantages such as fast growth rate, low culture medium cost, high cell density, easy genetic manipulation and extensive knowledge of its genetics and physiology. In addition, unlike other fungi (such as Streptomyces), Escherichia coli itself does not have endogenous CYP proteins, so it will not interfere with the exogenous expression of CYP. However, the reported enzymes with C14α hydroxylation activity are all fungal in origin and are membrane-bound proteins. Due to the lack of membrane structure and protein post-translational modification function in Escherichia coli, complex structured proteins are often expressed non-functionally in the form of inclusion bodies. In addition, since the Escherichia coli system lacks the reductase system for CYP-catalyzed hydroxylation reactions, the soluble expression and catalytic function of C14 hydroxylase in Escherichia coli have not yet been achieved.

[0005] The present invention is devoted to developing a soluble expression method of fungal steroid C14 hydroxylase, and constructing a self-sufficient electron transfer system and coenzyme circulation system through genetic engineering strategy, so as to realize the functional expression of Escherichia coli chassis and the C14 hydroxylation of selectively hydroxylated steroid compounds, thereby expanding the biotransformation route of active steroid drug intermediates. Summary of the invention

[0006] In view of the problems existing in the prior art, the purpose of the present invention is to design and provide a soluble expression vector of steroid C14α hydroxylase and its construction method and application technical solutions. In order to solve the problem of insoluble non-functional expression of fungal membrane-bound CYP protein in Escherichia coli, the present invention improves the soluble expression of CYP enzyme by truncating the N-terminus of the protein sequence and replacing the introduction of the soluble tag maltose binding protein, constructs an intramolecular electron transfer system by screening the fusion protein linker sequence, and significantly improves the electron transfer efficiency of the hydroxylation reaction. In addition, the coenzyme NADPH circulation system is established by coupling glucose dehydrogenase, which reduces the dependence on exogenous coenzyme addition and the reaction cost. Through the soluble expression strategy established by the present invention, the soluble expression and intramolecular electron transfer of fungal C14α hydroxylase and its electron transfer components are realized, and the catalytic ability of C14α hydroxylase is significantly improved through multi-enzyme in vitro cascade catalysis. Under this system, the product yield is significantly improved.

[0007] The present invention is specifically implemented by the following technical solutions:

[0008] The first aspect of the present invention provides a method for constructing a soluble expression vector of steroid C14α hydroxylase, which method expresses the nucleic acid sequence encoding steroid C14α hydroxylase and the nucleic acid sequence encoding soluble tag maltose binding protein (MBP) in a vector, wherein the nucleic acid sequence encoding steroid C14α hydroxylase is shown in SEQ ID NO.1, and the amino acid sequence of steroid C14α hydroxylase is shown in SEQ ID NO.2.

[0009] The second aspect of the present invention provides a soluble expression vector of steroid C14α hydroxylase obtained by the above construction method.

[0010] The third aspect of the present invention provides an intramolecular coupled artificial electron transfer system, which is obtained by constructing a CYP-linker-CPR fusion protein in the above-mentioned soluble expression vector of steroid C14α hydroxylase, wherein the linker sequence used to construct the fusion protein is one of the following:

[0011] (1) ARA;

[0012] (2) LPPPP;

[0013] (3)STEQSAKKVRKKA.

[0014] The fourth aspect of the present invention provides the use of the above-mentioned artificial electron transfer system in promoting the steroid hydroxylation reaction catalyzed by P450 enzyme.

[0015] A fifth aspect of the present invention provides a method for P450 enzyme hydroxylation reaction, which utilizes the above-mentioned artificial electron transfer system to carry out catalytic reaction.

[0016] The sixth aspect of the present invention provides a genetically engineered bacterium, including Escherichia coli and a target gene transferred into the Escherichia coli, wherein the target gene is fused to express a fusion protein in the form of CYP-linker-CPR.

[0017] A seventh aspect of the present invention provides an application of a genetically engineered bacterium in promoting a steroid hydroxylation reaction catalyzed by a P450 enzyme.

[0018] Furthermore, the application uses wet bacteria obtained by fermentation culture of the genetically engineered bacteria, or crude enzyme solution extracted after ultrasonic disruption of the wet bacteria, or purified pure enzyme solution as a catalyst, and progesterone as a substrate to carry out a catalytic reaction.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] 1) The present invention establishes a soluble expression vector and method of fungal enzymes in Escherichia coli, which provides a new idea for obtaining soluble components when other CYP enzymes are heterologously expressed in Escherichia coli.

[0021] 2) The present invention significantly improves the electron transfer efficiency of the hydroxylation process (by 2.5-3 times) by constructing an intramolecular hydrogen transfer system, which partially solves the problem of low overall catalytic rate caused by low electron transfer efficiency in P450 monooxygenase catalytic reactions.

[0022] 3) The present invention also established an in vitro multi-enzyme reaction system, combined with a coenzyme coupling system, and the reducing power in the P450 monooxygenation reaction achieved efficient circulation. It was measured that the final yield of 14α-OH-PG in a 10 mL reaction system was 34.9 mg / L, and the conversion rate was 26.5%. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Figure 2 is the plasmid map of the recombinant expression vector.

[0024] Figure 2 This is the SDS-PAGE analysis of Example 3. M: protein marker; 1: MBP-P450 aq Supernatant; 2: MBP-P450 aq Precipitation; 3: MBP-P450 bo Supernatant; 4: MBP-P450 bo Precipitation; 5: MBP-P450 bm Supernatant; 6: MBP-P450 bm Precipitation; 7: MBP-P450 lun Supernatant; 8: MBP-P450 lun precipitation.

[0025] Figure 3 This is the SDS-PAGE analysis of pure enzyme. M: protein marker; 1: CYP whole cell expression; 2: impurity protein; 3: CYP pure enzyme.

[0026] Figure 4 is the electron transfer efficiency of the fusion protein.

[0027] Figure 5 This is the HPLC spectrum of the selective hydroxylation of progesterone to synthesize the target product catalyzed by the supernatant of recombinant Escherichia coli cell lysate. DETAILED DESCRIPTION

[0028] The present invention is further described in detail below in conjunction with specific examples, but the present invention is not limited to the following examples. The implementation conditions used in the examples can be further adjusted according to different requirements of specific use, and the implementation conditions not specified are the conditions in routine experiments.

[0029] Example 1: Construction of recombinant vector

[0030] The enzyme gene sequence from Bipolaris oryzae was codon-optimized and transferred into the NcoI and XhoI sites of the vector pET28a(+) through full gene synthesis (nucleotide sequence as shown in SEQ ID NO.1, amino acid sequence as shown in SEQ ID NO.2) to obtain pET28a(+)-P450 boThe plasmid was transformed into E. coli BL21 (DE3) to obtain E. coli BL21 (DE3) / P450 bo .

[0031] Example 2: Construction of soluble steroid C14α hydroxylase

[0032] With P450 bo The enzyme gene was used as a template to design primers 1 and 2, which were then connected to the pET28a(+) plasmid by PCR to obtain the recombinant vector pET28a(+)-P450 bo .

[0033] Primer 1 gene sequence: CCGAAACTGCAGCTGAACGC

[0034] Primer 2 gene sequence: TTACACAACAACGCGTTTAA

[0035] Using the MBP enzyme gene from Escherichia coli as a template (nucleotide sequence as shown in SEQ ID NO.3), adding the TEV restriction site, designing primers 3, 4 and 5 to obtain the MBP-TEV target fragment

[0036] Primer 3 gene sequence:

[0037]

[0038] Primer 4 gene sequence:

[0039]

[0040] Primer 5 gene sequence:

[0041]

[0042] The recombinant vector pET-28a(+)-P450 bo Linearize and add the target fragment MBP-TEV to obtain the recombinant vector pET-28a(+)-MBP-TEV-P450 bo , the construction process is as follows Figure 1 shown.

[0043] The recombinant vector pET28a+-MBP-TEV-P450 bo The recombinant vector pET-28a(+)-MBP-TEV-P450 was transformed into Escherichia coli BL21(DE3) strain and plated on LB solid medium containing kanamycin for overnight culture. bo The gene was successfully transformed into Escherichia coli BL21(DE3) strain.

[0044] Example 3: Inducible expression and soluble expression of recombinant bacteria

[0045] Pick a verified single colony and inoculate it into a test tube for overnight culture. Inoculate it into 100 mL of fresh LB medium at a 1% inoculum size, add 100 μL of kanamycin, and culture it at 37°C, 160 rpm with shaking for 2 h. Then add 100 μL of IPTG (concentration of 500 mg / mL), induce it at 20°C, 150 rpm for 24 h, and collect the bacterial liquid.

[0046] The recombinant bacteria were subjected to routine protein soluble expression analysis. The cells were centrifuged at 8000rpm for 10 minutes, the supernatant was discarded, and the cells were resuspended in Tris-HCl buffer. The cell concentration was controlled at 25g / L after resuspension. The cells were then broken by ultrasonic wave in an ice bath, with a break time of 2 seconds and a rest interval of 4 seconds, and a total breaking time of 15 minutes. 200μL of the breaking solution was taken and centrifuged at 12000rpm for 10 minutes to separate the supernatant and the precipitate. The precipitate was washed twice with an equal volume of buffer and resuspended again. The "supernatant" and "precipitate" samples were then subjected to SDS-PAGE protein electrophoresis. The soluble expression of the target protein was determined based on the running gel results. Figure 2 As shown, using this strategy, soluble expression of fungal hydroxylases in Escherichia coli can be achieved, with the soluble protein content increasing to 40-60%.

[0047] Example 4: Separation and purification of enzyme

[0048] Preparation of the crude enzyme solution of the present invention: 0.2 g of wet cells of the recombinant genetically engineered bacteria prepared by the method of Example 3 were added with 9.8 mL of 100 mM, pH 7.0 potassium phosphate buffer solution to resuspend the wet cells, and ultrasonically disrupted under ice bath conditions (20 W, 40% power, lasting 2 s, resting 4 s, and continuously disrupting for 15 min) to obtain a cell disruption solution. The cell disruption solution obtained after ultrasonic disruption was centrifuged at 12000 rpm and 4°C for 10 min, and the obtained supernatant was the crude enzyme solution.

[0049] Pure enzyme solution: Ferment the strain in a 2L shake flask containing 600mL LB medium until OD 600 When the pH reaches 0.6-0.8, add IPTG with a final concentration of 0.5 mM, induce expression at 28°C for 24 hours, collect by centrifugation to obtain wet cells, ultrasonically disrupt the wet cells, collect by centrifugation, and filter to remove impurities to obtain crude enzyme solution. Use AKTA protein separation and purification instrument affinity chromatography to separate and purify the crude enzyme solution to obtain pure enzyme solution, such as Figure 3 As shown, SDS-PAGE results show that the purified CPR lun The size of the protein is about 72 kDa, which is consistent with the theoretical size. lun After deleting the N-terminal transmembrane region of thelun Most of it exists in the soluble part.

[0050] Example 5: Self-sufficient fusion protein P450 bo -linker-CPR lun Construction and screening

[0051] The purified linker-CPR lun The amplified fragment was cloned with the linearized pET28a-MBP-P450 plasmid in one step and verified by colony PCR. The fragment was about 2000 bp, which was the linker-CPR. lun The target gene was successfully inserted into the linearized plasmid, and a single colony was picked for sequencing, which was verified to be successfully inserted into the vector.

[0052] The linker sequence is one of the following:

[0053] (1) ARA;

[0054] (2) LPPPP;

[0055] (3)STEQSAKKVRKKA.

[0056] CPR lun The nucleotide sequence is shown in SEQ ID NO.4.

[0057] The primer designs are shown in the following table:

[0058]

[0059] The collected wet cells were resuspended in buffer, ultrasonically disrupted and diluted, the crude enzyme solution was diluted to 1g / L, 1mM PG and 10mM NADPH were prepared, 180μL linker fusion protein disruption solution and 10μL PG were added to make the total reaction system 200μL, and the rate of decrease of absorbance at 340nm within 3min was quickly detected on a microplate reader after adding NADPH, and compared among different groups. The results are shown in Figure 4 As shown: When the molar addition ratio of CPR to CYP is 3:1, the electron transfer efficiency is significantly improved, which is twice that of the control group of 1:1. The electron transfer efficiency can also be significantly improved by constructing an intramolecular transfer system through a linker. Among them, the effect of linker3 is the most obvious, and the overall efficiency is increased to 2.8 times.

[0060] Example 6: P450 bo Analysis of products produced by catalytic progesterone

[0061] The induced expression of the recombinant bacteria is shown in specific example 3. A 10 mL whole-cell catalytic reaction is carried out in a 50 mL conical flask. The addition of each component is carried out according to Table 1. During the reaction, the enzyme solution and the substrate are added first, and the coenzyme is added to start the reaction. The catalytic conditions are 30 ° C, 160 rpm, and the reaction is 96 hours. Samples are taken every 24 hours, and an equal volume of ethyl acetate is added for extraction. After mixing with an oscillator, the supernatant is aspirated and dried in an oven, and then dissolved with an equal volume of methanol. Filtered into a liquid phase bottle using a 0.22 μm microporous filter membrane, the ability of the strain to produce 14α-OH-PG is detected by high performance liquid chromatography.

[0062] Table 1: Whole-cell catalytic reactions

[0063]

[0064] Sample treatment, HPLC detection: The liquid phase test instrument is Agilent G7115A, the product 14α-OH-PG is dissolved in methanol, the mobile phase is methanol: water = 80:20, the column temperature is 42°C, the detection wavelength is 254nm, the flow rate is 1mL / min, and the injection time is 12min. Figure 5 As shown, the HPLC results show that the target product 14α-OH-PG exists at 4.0 min, and its elution time corresponds to that of the standard sample. There is an accumulation of byproduct peaks at 4.2 min, which may be the peaks of hydroxylation products at other sites.

[0065] Example 7: Construction of a glucose dehydrogenase coenzyme regeneration system

[0066] pET-28a-MBP-P450 bo , pET-28a-CPR, and pET-28a-GDH were expressed separately. When glucose was used as a substrate, glucose dehydrogenase could convert NADP + Converted into NADPH and promote normal hydroxylation reactions. Since glucose dehydrogenase generates acidic gluconolactone during the reaction, it is necessary to add an appropriate amount of 3M NaOH during the reaction to stabilize the pH. Through single-factor condition optimization, the addition of each component of the three-enzyme circulation system is shown in Table 2. The total volume is 10mL, the molar addition ratio of CYP-CPR to GDH is 3:1, and the pH is adjusted every 6 hours to maintain the pH at 7.2-7.4. Finally, the cumulative concentration of the product was detected by liquid chromatography. The results showed that using this reaction system, the cumulative concentration of the final product 14α-OH-PG was 34.9mg / L.

[0067] Table 2: Coenzyme regeneration cycle system

[0068]

Claims

1. A method for constructing a soluble expression vector of steroid C14α hydroxylase, characterized in that: The nucleic acid sequence encoding steroid C14α hydroxylase and the nucleic acid sequence encoding soluble tag maltose binding protein are expressed in a vector, the nucleic acid sequence encoding steroid C14α hydroxylase is shown as SEQ ID NO.1, and the amino acid sequence of steroid C14α hydroxylase is shown as SEQ ID NO.

2.

2. A soluble expression vector of steroid C14α hydroxylase obtained by the construction method of claim 1.

3. An intramolecular coupled artificial electron transfer system, characterized in that: The artificial electron transfer system is obtained by constructing a CYP-linker-CPR fusion protein in the soluble expression vector of the steroid C14α hydroxylase according to claim 2, wherein the linker sequence used to construct the fusion protein is one of the following: (1) ARA; (2) LPPPP; (3)STEQSAKKVRKKA.

4. Use of the artificial electron transfer system as claimed in claim 3 in promoting the steroid hydroxylation reaction catalyzed by P450 enzyme.

5. A method for P450 enzyme hydroxylation reaction, characterized in that: The catalytic reaction is carried out using the artificial electron transfer system as claimed in claim 2.

6. A genetically engineered bacterium comprising Escherichia coli and a target gene transferred into the Escherichia coli, characterized in that: The target gene fusion expresses a fusion protein in the form of CYP-linker-CPR.

7. Application of a genetically engineered bacterium in promoting steroid hydroxylation reaction catalyzed by P450 enzyme.

8. The use according to claim 7, characterized in that The catalytic reaction is carried out using wet bacteria obtained by fermentation culture of the genetically engineered bacteria or crude enzyme liquid extracted after ultrasonic crushing of the wet bacteria or purified pure enzyme liquid as catalyst and progesterone as substrate.

Images