Engineering bacterium for expressing transporter TBDT11 through outer membrane of bacterium as well as preparation and application of engineering bacterium

Abstract

The invention belongs to the field of bioengineering, and particularly relates to an engineering bacterium for expressing transporter TBDT11 by an outer membrane as well as preparation and application of the engineering bacterium. The preparation method of the engineering bacteria comprises the following steps: (1) connecting a TBDT11 gene with an escherichia coli expression vector pET-28a to obtain a recombinant vector pET-TBDT11; (2) transforming the recombinant vector pET-TBDT11 into an escherichia coli competent cell, so as to obtain an engineering bacterium EcN-pET-TBDT11; and (3) carrying out induced expression on the engineering bacterium EcN-pET-TBDT11 by using isopropyl thiogalactoside IPTG, and culturing to obtain the engineering bacterium of the transporter TBDT11 expressed by the outer membrane of the bacterium. The engineering bacteria prepared by the method can be ingested to reduce the benzopyrene content in the intestinal environment, and the preparation method has the advantages of simplicity, high efficiency, safety, no toxicity, no need of protein purification, low cost and the like.

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering, and specifically relates to an engineered bacterium expressing a transport protein TBDT11 in its outer membrane, and a preparation and application thereof. Background Art

[0002] Benzo(a)pyrene (BaP) is the most typical polycyclic aromatic hydrocarbon (PAH) and is classified as a Group I carcinogen by the International Agency for Research on Cancer. BaP is a common environmental pollutant produced by the incomplete combustion of organic materials and is widely present in barbecued foods, ambient air, and cigarette smoke. Food is one of the main sources of human exposure to BaP, including vegetables (13 ng / kg), grains (262 ng / kg), smoked fish (800-13,900 ng / kg), and dairy products (11-78 ng / kg). Data show that the average daily intake of BaP per person is as high as 125 ng. Human exposure to an environment containing BPA is unavoidable. BPA is not only a carcinogen but can also damage metabolic organs such as the liver and kidneys, and even poses a risk of neurological damage. In the past decade, increasing evidence has demonstrated the neurotoxicity of BaP. Due to its high lipophilicity, it can cross the blood-brain barrier and accumulate in the brain, leading to neurotoxicity and behavioral disorders. Furthermore, the neurotoxicity of BaP has hereditary effects.

[0003] Currently, intervention for benzo[a]pyrene-induced neurological damage is mainly carried out through the use of anti-inflammatory and antioxidant natural medicines. However, the above-mentioned intervention method is an intervention carried out after benzo[a]pyrene has caused substantial damage, which belongs to tertiary prevention. The intestine is the first barrier to prevent oral exposure to benzo[a]pyrene. Studies have shown that benzo[a]pyrene affects the nervous system through the gut-brain axis. Therefore, how to control the excretion of benzo[a]pyrene by the digestive system before it is absorbed by the body in the intestine is the key to blocking benzo[a]pyrene from causing damage to the body through the gut-brain axis. Summary of the Invention

[0004] In light of this, the present invention aims to overcome the shortcomings of the aforementioned prior art by providing an engineered bacterium expressing the transporter protein TBDT11 on its outer membrane, as well as its preparation and application. The TBDT11 transporter protein expressed on the outer membrane of Sphingomonas US6-1 is capable of transporting benzo[a]pyrene into the cell and metabolizing it. Based on the TBDT11 protein's benzo[a]pyrene transport function, the present invention expresses it on the outer membrane of Escherichia coli Nissle1917, creating an engineered probiotic bacterium capable of absorbing benzo[a]pyrene from the external environment.

[0005] To achieve the above object, the technical solution of the present invention is as follows:

[0006] In a first aspect, the present invention provides a method for preparing an engineered bacterium expressing a transport protein TBDT11 in its outer membrane, comprising the following steps:

[0007] (1) The TBDT11 gene was ligated with the Escherichia coli expression vector pET-28a to obtain the recombinant vector pET-TBDT11;

[0008] (2) Transforming the recombinant vector pET-TBDT11 into competent Escherichia coli cells to obtain the engineered bacteria EcN-pET-TBDT11;

[0009] (3) The engineered bacteria EcN-pET-TBDT11 was induced to express with isopropylthiogalactoside (IPTG) and cultured to obtain an engineered bacterium expressing the transport protein TBDT11 in the bacterial outer membrane.

[0010] Furthermore, in step (1), the nucleotide sequence of TBDT11 is shown as SEQ ID NO: 1.

[0011] Furthermore, in step (3), the competent E. coli cells are derived from E. coli Nissle1917.

[0012] Furthermore, the specific steps of step (3) are as follows: inoculating the engineered bacteria EcN-pET-TBDT11 into LB liquid culture medium containing kanamycin Kan for expansion culture, and when OD 600 When the concentration reaches 0.5 and IPTG is added for induction culture, the TBDT11 transporter protein is automatically expressed on the outer membrane of Escherichia coli.

[0013] Furthermore, the final concentration of the isopropylthiogalactoside is 1 mM.

[0014] In a second aspect, the present invention provides an engineered bacterium expressing the transport protein TBDT11 on the outer membrane of Escherichia coli prepared by the method described in the first aspect, wherein the TBDT11 protein is expressed on the outer membrane of Escherichia coli using genetic engineering technology.

[0015] In a third aspect, the present invention provides the use of the engineered bacteria expressing the transport protein TBDT11 in the bacterial outer membrane as a benzopyrene adsorbent according to the second aspect.

[0016] Furthermore, the engineered bacteria expressing the transport protein TBDT11 in the bacterial outer membrane are used as an adsorbent for benzopyrene in the intestine.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] 1. The engineered bacteria expressing the transporter protein TBDT11 in the bacterial outer membrane prepared by the present invention can enter the human body through oral administration, adsorb benzopyrene in the intestine and excrete it through the digestive tract system, thereby reducing the content of benzopyrene in the body and effectively preventing benzopyrene from causing damage to the body.

[0019] 2. After inducing expression in the engineered bacteria, the recombinant protein can be expressed on the outer membrane of E. coli, eliminating the steps of protein separation and purification, reducing protein loss, and being highly efficient and low-cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The construction diagram of the pET-TBDT11 recombinant plasmid of the present invention;

[0021] Figure 2 Immunoblotting of the expression of the TBDT11 transporter of the present invention;

[0022] Figure 3 Figure 2 shows the in vitro adsorption test of benzopyrene by the engineered bacteria of the present invention;

[0023] Figure 4 Zeta potential detection diagram of the present invention;

[0024] Figure 5 Schematic diagram of the surface of EcN-TBDT11(C / A)2 of the present invention;

[0025] Figure 6 Gastric acid resistance test chart;

[0026] Figure 7 BaP test chart in blood;

[0027] Figure 8 BaP detection chart in feces;

[0028] Figure 9 Open field experiment diagram;

[0029] Figure 10 Water maze experiment diagram;

[0030] Figure 11 Inflammatory factor detection chart;

[0031] Figure 12 Intestinal permeability test chart. DETAILED DESCRIPTION

[0032] To facilitate understanding of the present invention, the present invention will be described more fully below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0033] Example 1

[0034] The preparation of engineered bacteria expressing the transport protein TBDT11 in the bacterial outer membrane is as follows:

[0035] 1. Construction of engineered bacteria

[0036] The nucleotide sequence of TBDT11 (AGFM01000019.1) was obtained from NCBI (as shown in SEQ ID NO: 1); Figure 1 As shown in the figure, the TBDT11 gene was double-digested with 5'NcoI and 3'XhoI and then connected to the expression vector pET-28a to construct the pET-TBDT11 recombinant plasmid; the obtained recombinant plasmid pET-TBDT11 was transformed into Escherichia coli Nissle1917 to obtain the EcN-pET-TBDT11 engineered bacteria; the EcN-pET-TBDT11 engineered bacteria was inoculated into LB medium containing kanamycin Kan, shaken at 37°C and 200 rpm overnight, and then inoculated into liquid medium containing kanamycin Kan at a ratio of 1:100, and the culture medium was cultured at OD 600 When the pH value was 0.5, isopropylthiogalactoside (IPTG) was added at a final concentration of 1 mM, and the mixture was induced at 200 rpm and 20°C for 24 h by centrifugation. The bacteria were collected to obtain the engineered bacteria expressing the transport protein TBDT11 in the outer membrane.

[0037] 2. Identification and expression of TBDT11

[0038] Wash the obtained bacteria twice with PBS buffer, resuspend with bacterial lysis buffer, place in an ice bath and ultrasonically break, take the homogenate after ultrasonication and centrifuge, collect the supernatant; add 5X loading buffer to the supernatant and boil in water for 5 minutes, then use 7.5% separation gel for SDS-PAGE electrophoresis, semi-dry transfer for 1 hour and 30 minutes, block with 5% skim milk powder for 2 hours, wash with TBST 3 times for 10 minutes each time, add mouse anti-His primary antibody for incubation, recover the primary antibody and wash with TBST 3 times for 10 minutes each time, add HPR-labeled anti-mouse secondary antibody for incubation for 50 minutes, recover the secondary antibody and wash with TBST 3 times for 10 minutes each time before developing. Figure 2 As shown, the immunoblotting results showed that the expression of the transporter TBDT11 was successfully induced.

[0039] Example 2

[0040] The adsorption capacity of benzopyrene by the engineered bacteria expressing the transport protein TBDT11 in the bacterial outer membrane was tested as follows:

[0041] The engineered bacterial suspension expressing the transporter TBDT11 in the outer membrane (EcN-TBDT11) was centrifuged at 5000 g for 15 minutes and washed twice with ultrapure water to obtain cell pellets. The cell pellets were resuspended in ultrapure water containing 10 μg / mL benzopyrene. After incubation at 150 rpm and 37°C for 2 hours, the supernatant was centrifuged and the residual benzopyrene concentration was analyzed. Benzopyrene levels were measured using high-performance liquid chromatography (HPLC) equipped with a C 18A reversed-phase column (4.6 × 250 mm × 5 μm, 30°C) was used. The mobile phase consisted of acetonitrile:water (70:30 by volume). The injection volume was 20 μL, the flow rate was 1 mL / min, and the fluorescence detector was set at an excitation wavelength of 290 nm and an emission wavelength of 406 nm.

[0042] The benzopyrene binding capacity of the engineered bacteria is expressed as the benzopyrene removal rate, which is calculated as follows:

[0043]

[0044] Among them, C0 represents the initial benzopyrene level and C1 represents the residual benzopyrene level.

[0045] like Figure 3 As shown, compared with the engineered bacteria (EcN) without the outer membrane expression of the transport protein TBDT11, benzopyrene was successfully removed with a removal rate of 91.4%.

[0046] Example 3

[0047] The specific method for the experiment of encapsulating engineered bacteria into the body is as follows:

[0048] Chitosan (2 mg / mL) was dissolved in 1% acetic acid, and sodium alginate (2 mg / mL) was dissolved in 0.5 M sodium chloride. The pH of the two solutions was adjusted to 6.0. First, the EcN-pET-TBDT11 precipitate was collected, washed twice with 0.5 M sodium chloride and resuspended. Then, chitosan solution was added to the suspension, magnetically stirred at room temperature for 30 minutes, and chitosan was wrapped to obtain EcN-TBDT11 (C). Centrifuge and discard the supernatant, wash twice with 0.5 M sodium chloride and resuspend, then add sodium alginate solution and continue magnetic stirring at room temperature for 30 minutes, and wrap sodium alginate to obtain EcN-TBDT11 (C / A). The wrapping process was repeated twice to obtain EcN-TBDT11 (C / A) in turn. 1.5 、EcN-TBDT11(C / A)2.

[0049] Zeta potential of EcN-TBDT11, EcN-TBDT11(C), EcN-TBDT11(C / A), EcN-TBDT11(C / A) was determined according to the manufacturer's instructions. 1.5 Surface potential detection was performed with EcN-TBDT11(C / A)2, as Figure 4 As shown, EcN-TBDT11, EcN-TBDT11(C / A), and EcN-TBDT11(C / A)2 are negatively charged, and EcN-TBDT11(C), EcN-TBDT11(C / A) 1.5 The bacterial morphology of EcN-TBDT11 and EcN-TBDT11(C / A)2 observed by transmission electron microscopy is shown in Figure 2. Figure 5 As shown, EcN-TBDT11(C / A)2 was successfully encapsulated.

[0050] Example 4

[0051] In vitro acid resistance test, the specific method is as follows:

[0052] Equal amounts of EcN-TBDT11 and EcN-TBDT11(C / A)2 were resuspended in 1 mL of simulated gastric fluid (pH 2.0) and incubated at 37°C with gentle shaking. At predetermined time points, 100 μl of each sample was collected, washed with PBS, and appropriately diluted. 100 μl of each diluted sample was spread on LB agar plates containing kanamycin and incubated at 37°C for 24 hours before counting.

[0053] The results are as follows Figure 6 As shown, the survival rate of EcN-TBDT11(C / A)2 in a pH = 2.0 environment was significantly higher than that of EcN-TBDT11.

[0054] Example 5

[0055] The in vivo clearance of BaP was verified by the following experimental method:

[0056] Fifteen adult male ICR mice (6 weeks old; N = 5) were randomly divided into 6 groups: Group 1 was given sterile corn oil (i.e., control group); Group 2 was given benzopyrene 50 mg / kg / d (i.e., BaP group); Group 3 was given 1×10 9 CFU EcN plus benzopyrene 50mg / kg / d (i.e., BaP+EcN group); 4 groups were given 1×10 9 CFU EcN(C / A)2 plus benzopyrene 50mg / kg / d (i.e., BaP+EcN(C / A)2 group); 5 groups were given 1×10 9 CFU EcN-TBDT11 plus benzopyrene 50 mg / kg / d (i.e., BaP+EcN-TBDT11 group); 6 groups were given 1×10 9 Mice were fed a diet containing CFU of EcN-TBDT11(C / A)2 plus 50 mg / kg / day of benzopyrene (i.e., the BaP+EcN-TBDT11(C / A)2 group) and IPTG in their drinking water for 5 weeks. Feces were collected from each group on the final day and stored at -80°C. Mice were then anesthetized with 5% chloral hydrate, and blood was collected from the eyeballs and centrifuged at 3000g for 15 minutes. After sample preparation, BPA levels in serum and feces were determined using high-performance liquid chromatography.

[0057] The results are as follows Figure 7 、 8As shown, compared with the other groups, the five groups of mice had less benzo[a]pyrene in their blood and more benzo[a]pyrene in their feces. This indicates that the packaging material successfully enhanced the engineered bacteria's resistance to gastric juice and successfully reduced BaP in the mice.

[0058] Example 6

[0059] The open field experiment was carried out as follows:

[0060] Mice were grouped as in Example 5. The mining experiment consisted of a 50 cm x 50 cm square box. Each mouse was placed in the center and allowed to move freely within the box for 5 minutes. A video camera was used to record their movements, and the data was subsequently analyzed. After each test, the apparatus was cleaned with 75% ethanol to eliminate any potential odor cues. The total distance traveled and the time spent in the center and edge zones were calculated to measure the mice's anxiety-like behavior.

[0061] The results are as follows Figure 9 As shown, mice treated with group 2 walked a shorter total distance and spent less time in the center compared to mice treated with group 1. However, mice treated with groups 5 and 6 walked a longer distance and spent more time in the center. Eliminating BaP from the gut alleviated the anxiety-like behavior induced by BaP.

[0062] Example 7

[0063] The water maze experiment was carried out as follows:

[0064] The mice were grouped as in Example 5. To investigate their spatial learning and working memory abilities, they were tested in a Morris water maze. The Morris water maze consists of a large, circular plastic pool divided into four quadrants. A circular platform (10 cm in diameter) was located 1 cm below the surface of the opaque water, maintained at 22°C. Geometric images of circles, squares, triangles, and irregular shapes of different colors were affixed to the pool walls as visual-spatial cues. Orienteering was performed on the first four days, followed by spatial exploration on the fifth day.

[0065] The results are as follows Figure 10 As shown in the figure, during the orientation navigation period, Groups 5 and 6 took less time to find the platform than the other groups, and were closer to Group 1. During the fifth day of the spatial exploration experiment, the number of times the platform was crossed and the distance of movement in the platform quadrant increased in the two exposure groups, and improved in Groups 5 and 6 after intervention.

[0066] Example 8

[0067] The detection of inflammatory factors in the mouse brain is carried out as follows:

[0068] Mice were grouped as in Example 5. After the animal behavior experiment, mice were intraperitoneally injected with 0.3% sodium pentobarbital at 50 mg / kg and then sacrificed by dislocation. Brain tissue was collected and the expression of IL-6, TNF-α, and IL-1β proteins in brain tissue was measured according to the ELISA kit instructions.

[0069] The results are as follows Figure 11 As shown in the data, the BaP+EcN-TBDT11 group and the BaP+EcN-TBDT11(C / A)2 group reduced the expression of inflammatory TNF-α, IL-6 and IL-1β proteins in the brain tissue compared with the BaP exposure group, and the expression of TNF-α, IL-6 and IL-1β proteins in the brain tissue of the BaP+EcN-TBDT11(C / A)2 group was even lower than that of the EcN-TBDT11 group.

[0070] Example 9

[0071] The intestinal permeability test of mice was carried out as follows:

[0072] The mice were grouped as in Example 5. The effect of EcN-TBDT11(C / A)2 on intestinal permeability was explored by observing intestinal morphology and detecting tight junction proteins (ZO-1, Occludin). After killing the mice, the colon was collected and photographed for morphology, and the colon length was calculated. Approximately 1 cm of the colon was fixed in 4% paraformaldehyde and embedded in paraffin for HE staining and immunofluorescence staining of tight junction proteins (ZO-1, Occludin).

[0073] The results are as follows Figure 12 As shown: After BaP exposure, the colon shortened, but returned to normal length after intervention with EcN-TBDT11(C / A)2. The BaP group had irregular crypt surfaces, abnormal glandular structure, a small amount of inflammatory cell infiltration, and mild edema in the submucosal layer of the tissue. The protein content and relative mRNA expression levels of ZO-1 and Occludin were significantly reduced in the BaP group. However, intervention with EcN-TBDT11(C / A)2 alleviated BaP-induced colon damage and significantly increased the protein content and mRNA expression levels of ZO-1 and Occludin. This suggests that EcN-TBDT11(C / A)2 can alleviate the increased intestinal permeability caused by BaP exposure, thereby alleviating the neurotoxicity caused by BaP.

[0074] These results indicate that EcN-pET-TBDT11 engineered bacteria can reduce the neurotoxicity caused by BaP exposure in mice.

[0075] The above description is only for better explanation of the embodiments of the present invention and is not intended to limit the present invention. Any modifications or equivalent substitutions that do not depart from the spirit and scope of the present invention are intended to be within the scope of the present invention.

[0076] SEQ ID NO:1

[0077] ATGAAGGGATTGCTCTTTTGCAGCGCAGCGGTGGGTGGCCTGTTTGCTCACCGCCCCGGC

[0078] TCTGGCGCAGGACAGCGGCGCGGCGGGGGCTGCCCCGTCCAGGCAGGCGGGAAATGC

[0079] AGCAGGCGTCACCCTGGATGCGAACCAGCTCGCCGAGATCATCGTGACCGCGCAGCGC

[0080] GTAGAAGAAAACAGCCAGCGCATCCCTCGGCGCTCGATGTGATCGACTCGGGTGAACT

[0081] GACGCGTCAGAACGTGGTGCGCGCCGAGGATCTTTCGAGGACTTCTACGGCGCTTTCTG

[0082] CTTCGAGCAGCGGGAGGGCCGACAGCTATCTTCTATGTCCGCGGCGTCGGCAACGGCACC

[0083] GTGAATGCCTATTCGGATCCGGCGATCGCCTTCAACTACGACGGTGTCTACATCGGGCGT

[0084] CCCAGTTCCACCTCCGGCATGTTCTATGACCTTCAGCGCGTCGAACTGCTCAAGGGGCC

[0085] GCAAGGAACGCTGTATGGCCGCAATGCGACGGCAGGCCATCAACGTGATTCCCAAG

[0086] CGGCCCCAGATCGGCGAGCTCTCGGGCGAGATCACTGCAGGCTATGGAAATTACGACTG

[0087] GTATAGCGGCCAGGCGGCTCCAACGTGCCGATCGGCGATCGCGGAGCATTTCGTCTCT

[0088] CCGGGACGGTTTCCAATCACGACGGCTTTCAGAAGGACGGCACCGGCAGCCAAAACGA

[0089] ATATGGCGCCCGTGCGCAGGTCTATGCGGAGCTCACGGAAGCATTGAATGTCAGGGTCG

[0090] CTGCCGATTACGCGCATCAGGGCGGTTCGAGCAGCAGCGGCTACTACATCGGTGCAATC

[0091] AACCCCACCTTCGGGCCCGGCGGCTTTACCGGCTACCAGTTCGTCCCATCGGGCTTCGG

[0092] CCCTGGTGAGGGCGTACATACTCCCGCAGCGGAAGCCTATCTCGCCTCGCGTTTTTCGAC

[0093] CCAGTTGGGACGCGCGGGCGCAACGCTTTCAAGCTATCCGTACAACGACAACGACTATT

[0094] GGGGCGTGACCGCCGAGATCAACTGGTCGACCGATGCGGGAACTCTGACGGTGCAGCC

[0095] CGCGTATCGCGAAGCATCTCTGGATTATCAGTTCACGAACTCGATGCGGGCAGGATTTTC

[0096] GCAGGAGAAGGACCAGCAGACCAGCGTCGAGGCACGATGGGCGGGTGATATCGGCACA

[0097] TCGGTCGATTATCTGCTTGGTGCGATCTATTTCAACGAGGCGATCGATGCGCGGGCGATC

[0098] TATAACCAGCTGTCGCTGATCCCGTTTCAGGCGTTCAGTTCGAAGACCGAATCCTACGCC

[0099] GGCTTCGGCAAGGTGACGGTGCATCCGGTCGAAGGACTCAGCCTGACTGCAGGTGGCC

[0100] GCTATACGTCGGACCGCAAGCGTTTCGATGGAGACGCCACCGTCTATCTGCCGTTCTGTG

[0101] GCAATCCCGCGCCGCCGCAGGACTTCTGCCCCAATCTGCCCTTCACCCCGCTGCTCTAC

[0102] AACCAGGCGGATTTCGAGAGCTTCTATCAAACGCGCGGAATACCGGTCACGCCCGTGCC

[0103] GCTCTACGTGTTGCCGGGCTACGTTGACGGCACGCCTTTCGTTCTCAGGGCGCCGATGT

[0104] CGATAGATTCGGCATTGCATAACGACAAGTTCACATACCGCCTGGCCGCGCAGTACGATT

[0105] TCACGCCGAGCAACATGGTCTATGCGAGCTTCGAGACAGGCTATCACGCAGGCGGTTTT

[0106] TCGTTCGCGCGCGGCCTGGAGAGTTAGAGCCGGAGTCGATCGATGCCTATACCATCGGT

[0107] TCGAAGAACCGCTTTTTCGGTCGTAAGCTTCAGCTGAACCTCGAGGCTTTCCTCTGGAA

[0108] ATACAAGAACCAGCAGTTCAGCCAATATGGTTATGACCTGGGTAATCCACCCTCTACGGT

[0109] TTATCTGACGCGCAACATTGGCAACAGCACCATCAAGGGTCTCGACCTGGATGTCGAGT

[0110] GGCTGGCTACGCCAACCACGCTGCTGCAGGCGAACGTCCAGTATCTGGACACGAAATAC

[0111] GACAGCTTTGTTTACTTCACACCGAACCAGGGGCTGCCGCCGATCACCAGTTGCCCCTA

[0112] TGCGCCGACCACCCAGAATACCGCCTCGGGCACGATTTCGGTTTTCAAGGTCGATTGCT

[0113] CCGGGTTTCCGGCATTCAACTCGCCGAAATGGGCGTTCAACGTGAACGCACGGCAGAC

[0114] TGTGCCACTGGGCAAGGTCAAGTTCGTGCTCGAAGCAGGCACGCGTTATCGCGCCGGA

[0115] ACCTGGGTCGCCGCAGACTATCCCACCTACACCCGTGCGAGCGCCAATTTCGTGTCGAA

[0116] TGCGTCGATTACATTGGCCAGCGAAGACAATCGCTGGTTCGTCACGGCGTATATTCTCAA

[0117] CATCGAGGACGAACGCCGGCTGGCTGCGGTGCAGAACAATTCTGCCGCCTCGCTGGCG

[0118] GCCGGCGGAACCGAGCAGCCGCGCACCTACGGTATCCGTGTGGGCAGCAAGTTC

Claims

1. A method for preparing an engineered bacterium expressing a transport protein TBDT11 in the outer membrane of the bacterium, characterized in that: The steps include: (1) Connecting the TBDT11 gene to the Escherichia coli expression vector pET-28a to obtain the recombinant vector pET-TBDT11; (2) Transforming the recombinant vector pET-TBDT11 into competent Escherichia coli cells to obtain the engineered bacteria EcN-pET-TBDT11; (3) The engineered bacteria EcN-pET-TBDT11 was induced to express with isopropylthiogalactoside (IPTG) and cultured to obtain an engineered bacterium expressing the transport protein TBDT11 in the bacterial outer membrane.

2. The method for preparing an engineering bacterium expressing the transport protein TBDT11 in the outer membrane of claim 1, characterized in that: In the step (1), the nucleotide sequence of TBDT11 is shown in SEQ ID NO:

1.

3. The method for preparing an engineering bacterium expressing the transport protein TBDT11 in the outer membrane of claim 1, characterized in that: In the step (3), the competent E. coli cells are from E. coli Nissle1917.

4. The method for preparing an engineering bacterium expressing the transport protein TBDT11 in the outer membrane of claim 1, characterized in that: The specific steps of step (3) are: inoculating the engineered bacteria EcN-pET-TBDT11 into LB liquid culture medium containing kanamycin Kan for expansion culture, and when OD 600 When the concentration reaches 0.5 and IPTG is added for induction culture, the TBDT11 transporter protein is automatically expressed on the outer membrane of Escherichia coli.

5. The method for preparing an engineering bacterium expressing the transport protein TBDT11 in the outer membrane of claim 4, characterized in that: The final concentration of the isopropylthiogalactoside is 1 mM.

6. An engineered bacterium expressing the transport protein TBDT11 in the bacterial outer membrane prepared by the method according to any one of claims 1 to 5, characterized in that: TBDT11 protein is expressed on the outer membrane of Escherichia coli using genetic engineering technology.

7. Use of the engineered bacteria expressing the transport protein TBDT11 in the bacterial outer membrane as claimed in claim 6 as a benzopyrene adsorbent.

8. The use of the engineering bacteria expressing the transport protein TBDT11 in the bacterial outer membrane according to claim 7, characterized in that: As an intestinal benzopyrene adsorbent.

Images