Stable and efficient escherichia coli gene editing system and application thereof

Abstract

The invention relates to the technical field of biotechnology and genetic engineering, in particular to a stable and efficient escherichia coli gene editing system and application thereof.The stable and efficient escherichia coli gene editing system comprises a pEBcas9 expression plasmid and a pEBsgRNA expression plasmid, and the pEBcas9 expression plasmid contains a nucleotide sequence for coding a Cas gene and a nucleotide sequence for coding a SacB gene; the pEBsgRNA expression plasmid contains a nucleotide sequence for coding sgRNA molecules, a guide sequence which is connected with the sgRNA molecule sequence and at least one part of which is complementary with a target sequence, and a nucleotide sequence for coding Rep101 (Ts) genes. The gene editing system can perform self-elimination by controlling the expression of the SacB gene or inhibiting the activity of the Rep101 (Ts) protein after gene editing is completed, so that the cytotoxicity is reduced to the minimum, the high editing efficiency is realized, and the gene editing system has a good application prospect.

Description

Technical Field

[0001] The present invention relates to the technical field of biotechnology and genetic engineering, and in particular to a stable and efficient Escherichia coli gene editing system and applications thereof. Background Art

[0002] Escherichia coli is the most widely used cell factory in industrial biochemical production. It has a clear genetic background, can grow on basal salt medium, and can use a variety of substrates (such as glucose, xylose and glycerol) as carbon sources. In addition, it is also easy to culture on a large scale.

[0003] In the prior art, gene editing technology is generally used to construct the best E. coli cell factory. Gene editing technology refers to the technology of obtaining new characteristics or functions by targeted modification (knockout, insertion, replacement, etc.) of genes, from the first-generation DNA nuclease editing system ZFNs, the second-generation TALENs to the third-generation CRISPR / Cas9 system. CRISPR (clustered regularly interspaced shortpalindromic repeats) is an immune weapon produced by the struggle between bacteria and viruses in the history of life evolution. Simply put, viruses can integrate their own genes into the genome of bacteria and use the cell tools of bacteria to serve their own gene replication. In order to eliminate the foreign invading genes of viruses, bacteria have evolved the CRISPR system. Using this system, bacteria can specifically excise and destroy the viral genome. There are two types of CRISPR-Cas systems: Class I and Class II. Among them, Class I requires multiple Cas proteins to form a complex to cut the DNA double strand, while the Class II CRISPR-Cas system only requires one Cas protein to cut the DNA double strand. Because of this characteristic of the Class II CRISPR-Cas system, it has been modified and widely used in genome editing of prokaryotic and eukaryotic cells. The CRISPR-Cas9 system consists of two parts: the Cas9 nuclease that cuts the double-stranded DNA and the sgRNA (single guide RNA) with guiding function. In the cell, when the Cas9 protein and sgRNA exist at the same time and combine into a complex, the sgRNA guides the specific target sequence, cuts it by the Cas9 protein, and produces DNA double strand breaks (DSBs), which triggers the intracellular DNA repair mechanism. There are two repair methods in eukaryotes: homologous recombination repair (HDR) and non-homologous recombination repair (NHEJ). Heterologous end joining can easily cause random insertion, thereby affecting the function of the target gene and the stability of the genome; although homologous recombination is more accurate than end joining, its homologous recombination repair efficiency in cells is low.

[0004] However, when using the CRISPR-Cas system for gene editing, it is necessary to pay attention to balancing the expression level of the Cas protein. For example, when the expression level of the Cas9 protein in the cell is too high, it may mistakenly recognize and bind to non-target DNA sequences in the genome, resulting in non-specific DNA cutting, leading to "off-target effects". Non-targeted cutting may damage important genes, affect the normal function of cells, and even cause cell death. This potential harmful effect caused by high expression of Cas9 is called "non-target toxicity". On the contrary, if the expression level of the Cas9 protein is too low, it may not be able to effectively bind to the target DNA sequence, or it may not be able to complete the DNA cutting and repair process in a sufficient time. This will lead to a decrease in the efficiency of gene editing, that is, the probability of the target gene being successfully edited decreases, thereby affecting the experimental results or the effect of gene therapy. Summary of the invention

[0005] The present invention is conducted to solve the above-mentioned problems, and aims to provide a stable and efficient Escherichia coli gene editing system and its application, so as to resolve the contradiction between the non-target toxicity caused by high expression of Cas9 and the reduced editing efficiency caused by low expression.

[0006] The first aspect of the present invention provides a stable and efficient Escherichia coli gene editing system, characterized in that it comprises:

[0007] pEBcas9 expression plasmid and pEBsgRNA expression plasmid,

[0008] The pEBcas9 expression plasmid contains a nucleotide sequence encoding a Cas gene and a nucleotide sequence encoding a SacB gene;

[0009] The pEBsgRNA expression plasmid contains a nucleotide sequence encoding an sgRNA molecule, a guide sequence connected to the sgRNA molecule sequence and at least a portion of which is complementary to the target sequence, and a nucleotide sequence encoding a Rep101 (Ts) gene.

[0010] The present invention optimizes the precise genome editing of Escherichia coli BL21 (DE3), designs to add SacB gene and Rep101 (Ts) gene to the gene editing system, and after the gene editing is completed, controls the expression of SacB gene or inhibits the activity of Rep101 (Ts) protein, controls the expression level of Cas protein and eliminates the gene editing system, thereby reducing cytotoxicity to a minimum, and achieves high editing efficiency, allowing multiple rounds of editing, is suitable for multiple editing and large-scale genetic modification in Escherichia coli BL21 (DE3), and has good application prospects in industrial production.

[0011] In some embodiments, the nucleotide sequence of the pEBcas9 expression plasmid is shown as SEQ ID NO.1, and the nucleotide sequence of the pEBsgRNA expression plasmid is shown as SEQ ID NO.2.

[0012] In some embodiments, the nucleotide sequence of the Rep101 (Ts) gene is shown as SEQ ID NO.3.

[0013] In some embodiments, the Cas gene on the pEBcas9 expression plasmid is driven by an inducible promoter.

[0014] In some embodiments, the inducible promoter is selected from P BAD , P Tet , P lac , P rhaB and P T7 One of them.

[0015] In some embodiments, the pEBsgRNA expression plasmid contains a J23119 promoter.

[0016] In some embodiments, the gene editing system operates in an environment temperature of 30°C to 37°C.

[0017] The second aspect of the present invention provides an application of the gene editing system as described in any one of the first aspects in Escherichia coli genome editing, characterized in that the genome editing includes gene knockout, gene integration, gene replacement, multi-site continuous editing, and multi-site simultaneous editing.

[0018] The third aspect of the present invention provides an application of the gene editing system as described in any one of the first aspects in constructing a 1-cyano-cycloethylacetic acid chassis strain, characterized in that the nitrilase gene is integrated into Escherichia coli using the gene editing system to construct a 1-cyano-cycloethylacetic acid chassis strain; the nitrilase gene is from Acidovoraxfacilis ZJB09122, and the nucleotide sequence is shown in SEQ ID NO.4.

[0019] In some embodiments, the 1-cyano-cycloethylacetic acid chassis strain is used to catalyze the asymmetric synthesis of 1-cyano-cycloethylacetic acid from 1-cyano-cycloethylacetonitrile.

[0020] The fourth aspect of the present invention provides an application of a gene editing system as described in any one of the first aspects in constructing a high-yield trans-chrysanthemic acid chassis strain, characterized in that the carboxylesterase gene is integrated into Escherichia coli using the gene editing system to construct a high-yield trans-chrysanthemic acid chassis strain; the carboxylesterase gene is from Bacillus licheniformis, and the nucleotide sequence is shown in SEQ ID NO.5.

[0021] In some embodiments, the trans-chrysanthemic acid chassis strain is used to catalyze the asymmetric synthesis of trans-chrysanthemic acid from methyl chrysanthemate.

[0022] By implementing the above technical solution, the present invention has the following beneficial effects:

[0023] The present invention optimizes the precise genome editing of Escherichia coli BL21 (DE3), designs to add SacB gene and Rep101 (Ts) gene into the gene editing system, and after the gene editing is completed, controls the expression of SacB gene or inhibits the activity of Rep101 (Ts) protein, controls the expression level of Cas protein and eliminates the gene editing system, thereby reducing cytotoxicity to a minimum, and achieves high editing efficiency, allowing multiple rounds of editing, is suitable for multiple editing and large-scale genetic modification in Escherichia coli, and has good application prospects in industrial production. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 is the editing efficiency of different inducible promoters in Example 1 of the present invention;

[0025] Figure 2 The elimination efficiencies of different plasmid elimination methods in Example 2 of the present invention are shown as follows: A: the efficiency of eliminating a single plasmid using different elimination strategies; B: the efficiency of eliminating two plasmids using a combined elimination strategy.

[0026] Figure 3 The knockout editing efficiency in E. coli BL21 (DE3) mediated by pEBcas9 / pEBsgRNA in Example 3 of the present invention. A: gel electrophoresis results of colony PCR products; B: sequencing results of colony PCR products (UN: unedited BL21 (DE3)).

[0027] Figure 4 The insertion editing efficiency in E. coli BL21 (DE3) mediated by pEBcas9 / pEBsgRNA in Example 4 of the present invention. A: gel electrophoresis results of colony PCR products; B: sequencing results of colony PCR products (UN: unedited BL21 (DE3)).

[0028] Figure 5 The substitution editing efficiency in E. coli BL21 (DE3) mediated by pEBcas9 / pEBsgRNA in Example 5 of the present invention. A: gel electrophoresis results of colony PCR products; B: sequencing results of colony PCR products (UN: unedited BL21 (DE3)).

[0029] Figure 6It is the multi-site continuous editing efficiency in Escherichia coli BL21 (DE3) mediated by pEBcas9 / pEBsgRNA in Example 6 of the present invention.

[0030] Figure 7 The efficiency of simultaneous dual-site editing in Escherichia coli BL21 (DE3) mediated by pEBcas9 / pEBsgRNA in Example 7 of the present invention. A: Construction of dual-site editing plasmid; B: Comparison of original genome and edited genome model; C: Gel electrophoresis result of ushA site colony PCR product; D: Gel electrophoresis result of frvA_rhaM site colony PCR product.

[0031] Figure 8 The fluorescence intensity and copy number of different integration expression sites in Example 8 of the present invention. A: Fluorescence intensity after integration at different sites; B: Fluorescence intensity and copy number differences of strains after evolution at different sites.

[0032] Fig. 9 Comparison of copy number concentrations of the chassis strain and the control strain in Example 9 of the present invention.

[0033] Fig.10 Comparison of the yields of the chassis strain and the control strain in Example 9 of the present invention.

[0034] Fig.11 Comparison of the copy numbers of the chassis strain and the control strain in Example 10 of the present invention.

[0035] Fig.12 Comparison of the yields of the chassis strain and the control strain in Example 9 of the present invention. DETAILED DESCRIPTION

[0036] In order to make the technical means, creative features, objectives and effects achieved by the present invention easier to understand, the present invention is described in detail below in conjunction with embodiments and drawings.

[0037] Example 1: Screening for inducible promoters expressing Cas9 system and λ-Red system

[0038] 1. Construct a plasmid containing an inducible promoter for the expression of the Cas9 system and the λ-Red system. The specific steps are as follows:

[0039] Construction of plasmid pCas9-us-P T7: The Cas9 gene fragment was synthesized by Beijing Qingke Biotechnology Co., Ltd., China. The primers shown in sequences 1 and 2 in Table 1 were used to increase homology arms by PCR with the Cas9 gene fragment as a template. The pET-28a(+) linearized vector was amplified by PCR with the primers shown in sequences 3 and 4 with the plasmid pET-28a(+) as a template. The Cas9 gene fragment and the linearized pET-28a(+) vector were connected by one-step cloning using ClonExpress Ultra One Step Cloning KitV2 to obtain plasmid pet28a-Cas9. The us-λ-Red gene fragment was amplified by PCR using the primers shown in sequences 5 and 6 with plasmid pKD46 as a template. The linearized pet28a-Cas9-us vector was amplified by PCR using the primers shown in sequences 7 and 8 with plasmid pet28a-Cas9 as a template. The us-λ-Red gene fragment and the linearized pet28a-Cas9-us vector were connected by one-step cloning using ClonExpress Ultra One Step Cloning Kit V2 to obtain the plasmid pCas9-us-P T7 .

[0040] Construction of plasmid pCas9-ds-P T7 : The ds-λ-Red gene fragment was amplified by PCR using the primers shown in sequences 9 and 10 in Table 1 and plasmid pKD46 as a template. The linearized pet28a-Cas9-ds vector was amplified by PCR using the primers shown in sequences 11 and 12 and plasmid pet28a-Cas9 as a template. The ds-λ-Red gene fragment and the linearized pet28a-Cas9-ds vector were connected by one-step cloning using ClonExpress Ultra One Step Cloning Kit V2 to obtain the plasmid pCas9-ds-P T7 .

[0041] Table 1

[0042]

[0043]

[0044] The specific PCR conditions and steps are as follows: PCR reaction system (50 μL): 2 μL forward primer (100 μM), 2 μL reverse primer (100 μM), 25 μL 2×Phanta buffer, 1 μL dNTP mixture (10 mM each), 1 μL template, 1 μL DNA polymerase and 18 μL ultrapure water. The PCR program set according to the Phanta Super-Fidelity DNA polymerase manual is as follows: 95°C pre-denaturation for 5 min, then 30 cycles (95°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 3 min), 72°C final extension for 10 min, 12°C insulation. The obtained recombinant plasmid was transferred into E. coli DH5α competent cells, and the clones were cultured at 37°C for 12 h. Then the clones were picked out and transferred to 10 mL LB liquid culture medium containing 50 μg / mL kanamycin, and cultured at 37°C, 180 rpm for 10 h, sequenced and identified, and the plasmid was extracted.

[0045] Construction of plasmid pCas9-us-P lac / pCas9-ds-P lac : The lac promoter (P lac ), and then using the primers shown in sequences 3 and 4 to plasmid pCas9-us-P T7 / pCas9-ds-P T7 The pCas9-us / pCas9-ds linearized vector was amplified by PCR as a template, and the lac promoter gene fragment and the pCas9-us / pCas9-ds linearized vector were finally connected by one-step cloning using ClonExpress Ultra One Step Cloning Kit V2 to obtain the plasmid pCas9-us-P lac / pCas9-ds-P lac The specific PCR conditions and steps are the same as above.

[0046] Table 2

[0047] Primer name Sequence (5'-3') 1 ACATTAATTGCGTTGCGCGACACCATCGAATGGTGCA 2 AACAAATTATTTCTAGAGGTTGTTATCCGCTCACA 3 CCTCTAGAAATAATTTGTTTAACTTTAAGA 4 GCGCAACGCAATTAATGTAAGTTAGCTCAC

[0048] Construction of plasmid pCas9-us-P rhaB / pCas9-ds-P rhaB The rhaB promoter (P rhaB ), and then using the primers shown in sequences 3 and 4 to plasmid pCas9-us-P T7 / pCas9-ds-P T7The pCas9-us / pCas9-ds linearized vector was amplified by PCR as a template, and the rhaB promoter gene fragment and the pCas9-us / pCas9-ds linearized vector were finally connected by one-step cloning using ClonExpress Ultra One Step Cloning Kit V2 to obtain the plasmid pCas9-us-P rhaB / pCas9-ds-P rhaB The specific PCR conditions and steps are the same as above.

[0049] Table 3

[0050] Primer name Sequence (5'-3') 1 TACATTAATTGCGTTGCGCTTAATCTTTCTGCGAA 2 AAACAAATTATTTCTAGAGGTACGACCAGTCTAAA 3 CCTCTAGAAATAATTTGTTTAACTTTAAGA 4 GCGCAACGCAATTAATGTAAGTTAGCTCAC

[0051] Construction of plasmid pCas9-us-P Tet / pCas9-ds-P Tet The Tet promoter (P Tet ), and then using the primers shown in sequences 3 and 4 to plasmid pCas9-us-P T7 / pCas9-ds-P T7 The pCas9-us / pCas9-ds linearized vector was amplified by PCR as a template, and the Tet promoter gene fragment and the pCas9-us / pCas9-ds linearized vector were finally connected by one-step cloning using ClonExpress Ultra One Step Cloning Kit V2 to obtain the plasmid pCas9-us-P Tet / pCas9-ds-P Tet The specific PCR conditions and steps are the same as above.

[0052] Table 4

[0053]

[0054]

[0055] Construction of plasmid pCas9-us-P BAD / pCas9-ds-P BAD The BAD promoter (P BAD ), and then using the primers shown in sequences 3 and 4 to plasmid pCas9-us-P T7 / pCas9-ds-P T7The pCas9-us / pCas9-ds linearized vector was amplified by PCR as a template, and the Tet promoter gene fragment and the pCas9-us / pCas9-ds linearized vector were finally connected by one-step cloning using ClonExpress Ultra One Step Cloning Kit V2 to obtain the plasmid pCas9-us-P BAD / pCas9-ds-P BAD The specific PCR conditions and steps are the same as above.

[0056] Table 5

[0057] Primer name Sequence (5'-3') 1 TTAATTGCGTTGCGCTTATGACAACTTGACGGCTA 2 AAACAAATTATTTCTAGAGGATGGAGAAACAGTAG 3 CCTCTAGAAATAATTTGTTTAACTTTAAGA 4 GCGCAACGCAATTAATGTAAGTTAGCTCAC

[0058] Construction of plasmid psgRNA-ΔlacZ: The J23119 promoter (P J23119 ) and sgRNA gene fragments, and then the pSC101 linearized vector was amplified by PCR using the primers shown in sequences 3 and 4 with plasmid pSC101 as a template, and the J23119 promoter (P J23119 ) and sgRNA gene fragments were connected with the pSC101 linearized vector by one-step cloning to obtain plasmid psgRNA. The mutant psgRNA-ΔlacZ was obtained by PCR using the primers shown in sequences 5 and 6 in Table 6 and plasmid psgRNA as a template. The specific PCR conditions and steps were the same as above.

[0059] Table 6

[0060] Primer name Sequence (5'-3') 1 CTGGATCCTTFGCAGCTAGCTCAGTCCTAG 2 GAGAATTCAAAAAAAGCACCGACTCGGTGC 3 TTTTTTTGAATTCTCTAGAGTCGACCTGCA 4 CTAGCTGTCAAGGATCCAGGAGTTATACAC 5 ATGGCGCTTTGCCTGGTTTCGTTTTAGAGCTAGAAAT 6 GAAACCAGGCAAAGCGCCATCTAGTATTA

[0061] 2. Screening of inducible promoters for expression of Cas9 system and λ-Red system. The specific steps are as follows:

[0062] Step 1: First, pCas9-us-P T7 , pCas9-ds-P T7 、pCas9-us-P lac , pCas9-ds-P lac 、pCas9-us-P rhaB , pCas9-ds-P rhaB 、pCas9-us-P Tet , pCas9-ds-P Tet 、pCas9-us-P BAD , pCas9-ds-P BADTransform into E. coli BL21 (DE3) to prepare BL21-pCas9 competent cells. The specific method is as follows:

[0063] Take 10 μL from the constructed strain preservation tube and streak it on a plate containing 50 μg / mL kanamycin, and culture it at 37°C for 12 hours; take a single colony on the plate and transfer it to 10 mL LB liquid culture medium containing 50 μg / mL kanamycin and culture it at 37°C, 180 rpm for 10 hours; take the above seed liquid and inoculate it into a 100 mL LB liquid culture medium conical flask containing 50 μg / mL kanamycin and corresponding inducers (0.1 mM isopropyl-β-D-thiogalactoside, 0.1 ML-rhamnose monohydrate, 5.0-12.5 ng / mL tetracycline, 0.1 ML-arabinose) at an inoculum amount of 1%, and culture it at 37°C, 180 rpm for 2 hours; take out the conical flask and put it into a pre-prepared ice box, and ice bath it for 15 minutes; take out the conical flask, and divide the cooled bacterial liquid into 50 mL EP tubes sterilized and dried in advance on the clean bench, and ice bath it for 15 minutes, and put 50 mL After the EP tube is balanced on the balance, it is placed in a low-temperature centrifuge and centrifuged for 10 minutes at a temperature of 4°C and a speed of 5000rpm; after the centrifugation, the 50mL EP tube is taken out from the low-temperature centrifuge, placed in an ice box, taken out from the clean bench, the residual culture medium in the supernatant is discarded, 10mL of 0.1M CaCl2 solution sterilized in advance is added, and the ice bath is resuspended for 30min; put it in a low-temperature centrifuge and centrifuged for 10min at a temperature of 4°C and a speed of 4000rpm; after the centrifugation, the 50mL EP tube is taken out from the low-temperature centrifuge, placed in an ice box, taken out from the clean bench, the supernatant is discarded, 2mL of 0.1M CaCl2+15% glycerol solution sterilized in advance is added, and after complete resuspending, 100μL of liquid per tube is dispensed into 1.5mL EP tubes sterilized and dried in advance, and the corresponding competent state mark and the time of making the competent state are written, and then stored at a temperature of -80°C for standby use;

[0064] Step 2: Add 1 μg of plasmid psgRNA-ΔlacZ to 200 μl of 10 BL21-pCas9 competent cells prepared in the previous step and place on ice for 30 min;

[0065] Step 3: Place the competent cells in a pre-cooled 2 mm Gene Pulser cuvette (Bio-Rad, USA) and electroporate at 2.5 kV. Immediately after electroporation, add 700 μL of fresh LB medium and incubate at 30°C for 2 h.

[0066] Step 4: Centrifuge the competent cells obtained in step 3 at 6000rpm for 1min, discard 500μL of supernatant on the clean bench, resuspend and apply to a mixed plate containing 50μg / mL kanamycin + 50μg / mL spectinomycin + 100μg / ml X-Gal, and culture at 37℃ for 12h. Cells containing the lacZ gene can produce the blue pigment 5,5'-dibromo-4,4'-dichloroindigo. When the lacZ gene in the cells is knocked out, they cannot produce this blue pigment. Use ImageJ software to observe the ratio of blue colonies to white colonies on the agar plate to determine the editing efficiency. The results are shown in the figure below. Figure 1 As shown, the editing efficiency of Tet promoter reaches 65%, which is much higher than that of other types of promoters.

[0067] Example 2: Elimination of gene editing system in the host

[0068] After editing is completed in E. coli, the editing system usually needs to be removed from the host for subsequent applications. Three different elimination strategies are used to eliminate the Cas9-expressing plasmid or the sgRNA-expressing plasmid.

[0069] Construction of plasmid pCas9-ds-P Tet -SacB / pCas9-ds-P Tet -Rep101(Ts): The primers with the sequences shown in Table 7, 1 and 2, were used to construct the plasmid pCas9-ds-P Tet pCas9-ds-P was amplified by PCR as a template Tet The linearized vector was used, and the SacB gene fragment was amplified by PCR using the primers shown in sequences 3 and 4 with plasmid pKD46 as a template. The SacB gene fragment and pCas9-ds-P were cloned using ClonExpress Ultra One Step Cloning Kit V2. Tet The linearized vector was cloned and connected by one-step cloning to obtain the plasmid pCas9-ds-P Tet -SacB, and then using the primers shown in sequences 5 and 6 to amplify the pSC101 ori and Rep101 (Ts) gene fragments by PCR with plasmid pSC101 as a template. The nucleotide sequence of the Rep101 (Ts) gene is shown in SEQ ID NO.3. The pSC101 ori and Rep101 (Ts) gene fragments were ligated to pCas9-ds-P using ClonExpress Ultra One Step Cloning Kit V2. Tet The linearized vector was cloned and connected by one-step cloning to obtain the plasmid pCas9-ds-P Tet -Rep101(Ts).

[0070] Table 7

[0071] Primer name Sequence (5'-3') 1 CGCTCATGAATTAATTCTTAGAAAAACTCA 2 GATACATATTTGAATGTATTTAGAAAAATA 3 ATTCAAATATGTATCATGAACATCAAAAAG 4 ATTAATTCATGAGCGTTATTTGTTAACTGT 5 ATTCAAATATGTATCTCAGATCCTTCCGTATTTAGC 6 AAGAATTAATTCATGAGCGGAGTTATACACAGGGC

[0072] Construction of plasmid psgRNA-SacB / psgRNA-Rep101 (Ts): Using primers as shown in sequences 1 and 2 in Table 8, plasmid psgRNA was used as a template to amplify the psgRNA linearization vector by PCR, using primers as shown in sequences 3 and 4, plasmid pKD46 was used as a template to amplify the SacB gene fragment by PCR, and the SacB gene fragment and the psgRNA linearization vector were connected by one-step cloning using ClonExpress Ultra One Step Cloning Kit V2 to obtain plasmid psgRNA-SacB; then, using primers as shown in sequences 5 and 6, plasmid pSC101 was used as a template to amplify the Rep101 (Ts) gene fragment by PCR, and the Rep101 (Ts) gene fragment and the psgRNA linearization vector were connected by one-step cloning using ClonExpress Ultra One Step Cloning Kit V2 to obtain plasmid psgRNA-Rep101 (Ts).

[0073] Table 8

[0074]

[0075]

[0076] Construction of plasmid pCas9-ds-P Tet -Cas9 / psgRNA-ΔsgRNA: Use the primers with the sequences shown in Sequence 1 and 2 in Table 9 to construct the plasmid pCas9-ds-P Tet The mutant P was obtained by PCR using Tet -Cas9-ds-P rhaB The primers shown in the following table were used to generate plasmid P Tet -Cas9-ds-P rhaB P was amplified by PCR as a template Tet -Cas9-ds-P rhaB Linearize the vector, use the primers shown in sequences 5 and 6 and plasmid psgRNA as a template to amplify the sgRNA-ΔCas9 gene fragment by PCR, and use ClonExpress Ultra One Step Cloning Kit V2 to clone the sgRNA-ΔCas9 gene fragment and P Tet -Cas9-ds-P rhaB The linearized vector was cloned and connected by one-step cloning to obtain the plasmid pCas9-ds-PTet -Cas9. The mutant P was obtained by PCR using the primers shown in sequences 7 and 8 in the following table and plasmid psgRNA as a template. rhaB -sgRNA, using primers with the sequences 9 and 10 shown in the following table to express plasmid P rhaB -sgRNA as a template to obtain the mutant psgRNA-ΔsgRNA by PCR.

[0077] Table 9

[0078] Primer name Sequence (5'-3') 1 TGGTATTCAAATATGTATCTACGACCAGTCTAAA 2 ATTAATTCATGAGCGTTAATCTTTCTGCGAATTG 3 ATCTTTATAGTCCTGTTACGACCAGTCTAAA 4 GATACATATTTGAATGTATTTAGAAAAATA 5 ATTCAAATATGTATCGCACCGACTCGGTGCCACT 6 ACAGGACTATAAAGATACCAGTTTTAGAGCTAG 7 ACATAGACAGCCTGAGCACCGACTCGGTGC 8 GCAGCATCGCCTGTTTTAATCTTTCTGCGA 9 AAAAACACACAAAGGTCTAGTACGACCAGT 10 CTAGACCTTTGTGTGTTTTTGTTTAGAGC

[0079] The SacB gene is used to eliminate the plasmid. The SacB gene can be cloned into the host cell together with the target gene. The SacB protease expressed is an enzyme that can decompose sucrose. By adding a sucrose solution with a final concentration of 10g / L to the culture medium, the SacB enzyme hydrolyzes the sucrose to produce toxic intermediates, which are fatal to bacterial cells. Specifically, the SacB enzyme breaks down sucrose into a highly toxic intermediate, usually an aldehyde compound, which inhibits the growth of bacterial cells and causes cell death. This causes the death of cells containing the SacB gene, while cells without the SacB gene can survive in the presence of sucrose.

[0080] The specific method is as follows:

[0081] Step 1: From pCas9-ds-P Tet Take 10 μL of the -SacB strain culture tube and the psgRNA-SacB strain culture tube and transfer them to 10 mL of LB liquid medium containing 10 g / L sucrose, and culture at 37°C and 180 rpm for 10 h;

[0082] Step 2: Take 10 μL of the bacterial solution from step 1 into a sterilized and dried EP tube, then add 990 μL of sterile water to dilute, repeat the dilution for a total of 10,000 times, take 30 μL of the diluted bacterial solution and spread it on a plate containing 50 μg / mL kanamycin or spectinomycin, and culture at 37°C for 12 h;

[0083] Step 3: Use a sterilized and dried toothpick to pick a single colony from the plate cultured for 12 hours in step 2, pCas9-ds-P Tet -SacB strains were copied onto plates containing 50 μg / mL kanamycin and plates without kanamycin by copy-copying, and then cultured at 37°C for 12 h. psgRNA-SacB strains were copied onto plates containing 50 μg / mL spectinomycin and plates without spectinomycin by copy-copying, and then cultured at 37°C for 12 h.

[0084] Step 4: If pCas9-ds-P Tet If the -SacB strain does not grow on a plate containing kanamycin, the plasmid is successfully eliminated. Find the corresponding colony on a plate without kanamycin, take a single colony into 10 mL of LB liquid culture medium containing 50 μg / mL kanamycin and culture it at 37°C and 180 rpm for 12 h. If the psgRNA-SacB strain does not grow on a plate containing spectinomycin, the plasmid is successfully eliminated.

[0085] The Rep101 (Ts) gene is used to eliminate plasmids. The temperature-sensitive nature of the Rep101 (Ts) gene inhibits the replication of plasmids at 37°C, or even stops them completely. This is because when the temperature rises, the Rep101 (Ts) protein denatures or changes conformation, and cannot normally perform the replication initiation function of the plasmid, resulting in the plasmid being unable to replicate itself in the cell. Over time, the plasmid is gradually lost, and the cell retains only the genome on the chromosome.

[0086] The specific method is as follows:

[0087] Step 1: From pCas9-ds-P Tet Take 10 μL of the -Rep101(Ts) strain culture tube and the psgRNA-Rep101(Ts) strain culture tube and transfer it to 10 mL LB liquid culture medium, and culture it at 30°C and 180 rpm for 10 h;

[0088] Step 2: Take 10 μL of the bacterial solution from step 1 into a sterilized and dried EP tube, then add 990 μL of sterile water to dilute, repeat the dilution for a total of 10,000 times, take 30 μL of the diluted bacterial solution and spread it on a plate containing 50 μg / mL kanamycin, and culture at 30°C for 12 h;

[0089] Step 3: Use a sterilized and dried toothpick to pick a single colony from the plate cultured for 12 hours in step 2, pCas9-ds-P Tet -Rep101

[0090] The (Ts) strain was copied onto a plate containing 50 μg / mL kanamycin and onto a plate without kanamycin by copy-copying, and then cultured at 37°C for 12 h. The psgRNA-Rep101 (Ts) strain was copied onto a plate containing 50 μg / mL spectinomycin and onto a plate without spectinomycin by copy-copying, and then cultured at 37°C for 12 h.

[0091] Step 4: If pCas9-ds-P TetIf the -Rep101(Ts) strain does not grow on a plate containing kanamycin, the plasmid is successfully eliminated. Find the corresponding colony on a plate without kanamycin, take a single colony into 10 mL of LB liquid culture medium containing 50 μg / mL kanamycin and culture it at 37°C and 180 rpm for 12 h. If the psgRNA-Rep101(Ts) strain does not grow on a plate containing spectinomycin, the plasmid is successfully eliminated.

[0092] CRISPR-Cas9 was used to eliminate the plasmid. The specific method is as follows:

[0093] Step 1: From pCas9-ds-P Tet Take 10 μL of the -Cas9 strain culture tube and the psgRNA-ΔsgRNA strain culture tube and transfer them to 10 mL of LB liquid medium containing 0.1 M L-rhamnose, and culture at 37°C and 180 rpm for 10 h;

[0094] Step 2: Take 10 μL of the bacterial solution from step 1 into a sterilized and dried EP tube, then add 990 μL of sterile water to dilute, repeat the dilution for a total of 10,000 times, take 30 μL of the diluted bacterial solution and spread it on a plate containing 50 μg / mL kanamycin, and culture at 37°C for 12 h;

[0095] Step 3: Use a sterilized and dried toothpick to pick a single colony from the plate cultured for 12 hours in step 2, pCas9-ds-P Tet -Cas9 strains were copied onto plates containing 50 μg / mL kanamycin and plates without kanamycin by copy-copying, and then cultured at 37°C for 12 h. psgRNA-ΔsgRNA strains were copied onto plates containing 50 μg / mL spectinomycin and plates without spectinomycin by copy-copying, and then cultured at 37°C for 12 h.

[0096] Step 4: If pCas9-ds-P Tet If the -Cas9 strain does not grow on a plate containing kanamycin, the plasmid is successfully eliminated. Find the corresponding colony on a plate without kanamycin, take a single colony into 10 mL of LB liquid culture medium containing 50 μg / mL kanamycin and culture it at 37°C and 180 rpm for 12 h. If the psgRNA-ΔsgRNA strain does not grow on a plate containing spectinomycin, the plasmid is successfully eliminated.

[0097] The SacB gene and Rep101 (Ts) gene combination was used to eliminate the plasmid. The specific method is as follows:

[0098] Step 1: pCas9-ds-P Tet-SacB plasmid / psgRNA-Rep101(Ts) plasmid or pCas9-ds-P Tet -Rep101(Ts) plasmid / psgRNA-SacB plasmid was transferred into E. coli DH5α competent cells and placed in an ice bath for 30 min;

[0099] Step 2: Heat shock the competent cells in a 42°C water bath for 90 seconds, add 600 μL of pre-cooled LB liquid medium in a clean bench, place in a shaker, and incubate at 30°C and 180 rpm for 1 hour;

[0100] Step 3: Centrifuge the competent cells obtained in step 2 at 6000 rpm for 1 min, discard 500 μL of supernatant on the clean bench, resuspend and apply to a mixed plate containing 50 μg / mL kanamycin + 50 μg / mL spectinomycin, and culture at 30°C for 12 h;

[0101] Step 4: Transfer the clones obtained in step 3 into 10 mL of LB liquid medium containing 10 g / L sucrose and culture at 37°C and 180 rpm for 12 h;

[0102] Step 5: Take 10 μL of the bacterial solution from step 4 into a sterilized and dried EP tube, then add 990 μL of sterile water to dilute, repeat the dilution for a total of 10,000 times, take 30 μL of the diluted bacterial solution and spread it on a plate, and culture it at 37°C for 12 h;

[0103] Step 6: Use a sterilized and dried toothpick to take a single colony from the plate cultured for 12 hours in step 5, and use the copy printing method to copy it on a plate containing 50 μg / mL kanamycin, a plate containing 50 μg / mL spectinomycin, and a plate without any resistance. After copying, culture at 37°C for 12 hours. If there is no growth on the plates containing kanamycin and spectinomycin, the plasmid is successfully eliminated.

[0104] The SacB gene and CRISPR-Cas9 combination was used to eliminate the plasmid. The specific method is as follows:

[0105] Step 1: pCas9-ds-P Tet -SacB plasmid / psgRNA-ΔsgRNA plasmid or pCas9-ds-P Tet -Cas9 plasmid / psgRNA-SacB was transferred into E. coli DH5α competent cells and placed in an ice bath for 30 minutes;

[0106] Step 2: Repeat steps 2 and 3 of the combined elimination method of the SacB gene and the Rep101 (Ts) gene with the competent cells obtained in step 1;

[0107] Step 3: Transfer the clones obtained in step 2 into 10 mL of LB liquid medium containing 10 g / L sucrose and 0.1 M L-rhamnose and culture at 37°C and 180 rpm for 12 h;

[0108] Step 4: Repeat steps 5 and 6 of the combined elimination method of the SacB gene and the Rep101 (Ts) gene. If the plasmid does not grow on the plates containing kanamycin and spectinomycin, the plasmid is successfully eliminated.

[0109] The Rep101 (Ts) gene and CRISPR-Cas9 combination were used to eliminate the plasmid. The specific method is as follows:

[0110] Step 1: pCas9-ds-P Tet -Rep101(Ts) plasmid / psgRNA-ΔsgRNA plasmid or pCas9-ds-P Tet -Cas9 plasmid / psgRNA-Rep101(Ts) plasmid was transferred into E. coli DH5α competent cells and placed in an ice bath for 30 min;

[0111] Step 2: Repeat steps 2 and 3 of the combined elimination method of the SacB gene and the Rep101 (Ts) gene with the competent cells obtained in step 1;

[0112] Step 3: Transfer the clones obtained in step 2 into 10 mL of LB liquid medium containing 0.1 M sucrose / 0.1 M L-rhamnose and culture at 37°C and 180 rpm for 12 h;

[0113] Step 4: Repeat steps 5 and 6 of the combined elimination method of the SacB gene and the Rep101 (Ts) gene. If the plasmid does not grow on the plates containing kanamycin and spectinomycin, the plasmid is successfully eliminated.

[0114] The elimination efficiency of Cas9-expressing plasmids or sgRNA-expressing plasmids using 6 different elimination strategies is shown in Figure 2. Figure 2 The most effective combination strategy was to use the SacB gene to eliminate the plasmid expressing Cas9 and the Rep101(Ts) to eliminate the plasmid expressing sgRNA, achieving an efficiency of more than 88%. Tet -SacB / psgRNA-Rep101(Ts) was selected as the best elimination strategy as the pEBcas9 / pEBsgRNA system.

[0115] Example 3: Knockout editing in E. coli BL21 (DE3)

[0116] The plasmid pEBsgRNA-N20-ΔrecA was constructed targeting the recA site of the Escherichia coli BL21 (DE3) genome.

[0117] The pEBcas9 / pEBsgRNA system knocks out the recA gene in the Escherichia coli BL21 (DE3) genome. The specific steps are as follows:

[0118] Step 1: First, pEBcas9 was transformed into Escherichia coli BL21 (DE3) to prepare BL21-pEBcas9 competent cells. The specific method was repeated in step 1 of Example 1;

[0119] Step 2: Add the plasmid pEBsgRNA-N20-ΔrecA to the BL21-pEBcas9 competent cells and place them on ice for 30 minutes;

[0120] Step 3: Repeat step 3 of Example 1 with the competent cells obtained in step 2;

[0121] Step 4: Centrifuge the competent cells obtained in step 3 at 6000rpm for 1min, discard 500μL of supernatant on the clean bench, resuspend and apply to a mixed plate containing 50μg / mL kanamycin + 50μg / mL spectinomycin + 10ng / mL tetracycline, and culture at 30℃ for 12h. Verify whether the genome is successfully edited by colony PCR at the editing site. The results are as follows: Figure 3 The success rate is 93.75%.

[0122] Example 4: Insertion editing in E. coli BL21 (DE3)

[0123] The plasmid pEBsgRNA-N20-frvA_rhaM was constructed targeting the rvA_rhaM site of the Escherichia coli BL21 (DE3) genome.

[0124] The pEBcas9 / pEBsgRNA system mediates insertion and editing at the frvA_rhaM site of the E. coli BL21 (DE3) genome. The specific steps are as follows:

[0125] Step 1: First, pEBcas9 was transformed into Escherichia coli BL21 (DE3) to prepare BL21-pEBcas9 competent cells. The specific method was repeated in step 1 of Example 1;

[0126] Step 2: Add the plasmid pEBsgRNA-N20-frvA_rhaM to the BL21-pEBcas9 competent cells and place them on ice for 30 minutes;

[0127] Step 3: Repeat step 3 of Example 1 with the competent cells obtained in step 2;

[0128] Step 4: Centrifuge the competent cells obtained in step 3 at 6000rpm for 1min, discard 500μL of supernatant on the clean bench, resuspend and apply to a mixed plate containing 50μg / mL kanamycin + 50μg / mL spectinomycin + 10ng / mL tetracycline, and culture at 30℃ for 12h. Verify whether the genome is successfully edited by colony PCR at the editing site. The results are as follows: Figure 4 , with a success rate of 87.5%.

[0129] Example 5: Substitution editing in E. coli BL21 (DE3)

[0130] Plasmid pEBsgRNA-N20-maeA was constructed targeting the maeA site of the Escherichia coli BL21 (DE3) genome.

[0131] The pEBcas9 / pEBsgRNA system mediates replacement editing at the maeA site in the E. coli BL21 (DE3) genome. The specific steps are as follows:

[0132] Step 1: First, pEBcas9 was transformed into Escherichia coli BL21 (DE3) to prepare BL21-pEBcas9 competent cells. The specific method was repeated in step 1 of Example 1;

[0133] Step 2: Add plasmid pReRNA-N20-maeA to BL21-pEBcas9 competent cells and place on ice for 30 minutes;

[0134] Step 3: Repeat step 3 of Example 1 with the competent cells obtained in step 2;

[0135] Step 4: Centrifuge the competent cells obtained in step 3 at 6000rpm for 1min, discard 500μL of supernatant on the clean bench, resuspend and apply to a mixed plate containing 50μg / mL kanamycin + 50μg / mL spectinomycin + 10ng / mL tetracycline, and culture at 30℃ for 12h. Verify whether the genome is successfully edited by colony PCR at the editing site. The results are as follows: Figure 5 , the success rate reached 100%.

[0136] Example 6: Continuous Editing in E. coli BL21 (DE3)

[0137] Targeting the cadA / pnCC / purR / ydeIydeJ / yahNyahO sites in the Escherichia coli BL21 (DE3) genome, plasmid pEBsgRNA-N20-ΔcadA / plasmid pEBsgRNA-N20-ΔpnCC / plasmid pEBsgRNA-N20-ΔpurR / plasmid pEBsgRNA-N20-ΔydeIydeJ / plasmid pEBsgRNA-N20-yahNyahO were constructed and used Plasmid pEBsgRNA-N20-ΔcadA / plasmid pEBsgRNA-N20-ΔpnCC / plasmid pEBsgRNA-N20-ΔpurR / plasmid pEBsgRNA-N20-ΔydeIydeJ / plasmid pEBsgRNA-N20-yahNyahO, the cadA / pnCC / purR / ydeIydeJ / yahNyahO sites in the Escherichia coli BL21 (DE3) genome were continuously edited, and the results are shown in Figure 6 , the specific method is as follows:

[0138] Step 1: Transform the plasmid into BL21-pEBcas9 competent cells and verify whether the genome is successfully edited according to steps 1-4 of Example 3;

[0139] Step 2: Transfer the clone successfully edited in step 1 into 10 mL of LB liquid medium containing 50 μg / mL kanamycin and culture at 37°C and 180 rpm for 12 h;

[0140] Step 3: Take 10 μL of the bacterial solution from step 2 into a sterilized and dried EP tube, then add 990 μL of sterile water to dilute, repeat the dilution for a total of 10,000 times, take 30 μL of the diluted bacterial solution and spread it on a plate containing 50 μg / mL kanamycin, and culture at 37°C for 12 h;

[0141] Step 4: Use a sterilized and dried toothpick to take a single colony from the plate cultured for 12 hours in step 3, and use the copy printing method to copy it on a plate containing 50 μg / mL kanamycin and a mixed plate containing 50 μg / mL kanamycin + 50 μg / mL spectinomycin. After copy printing, culture at 37°C for 12 hours;

[0142] Step 5: If there is no growth on the plate containing spectinomycin, the plasmid is successfully eliminated. Find the corresponding colony on the plate without spectinomycin, take a single colony into 10mL LB liquid culture medium containing 50μg / mL kanamycin and culture it at 37℃, 180rpm for 12h, add it to the bacterial preservation tube with 30% glycerol solution at a volume ratio of 1:1, write the corresponding editing site mark and time, and store it at -80℃ for later use;

[0143] Step 6: Repeat step 1 of Example 2 with the gene-edited bacteria in step 5, write the corresponding competent state mark and the time of making the competent state, and store it at a temperature of -80°C for later use;

[0144] Step 7: Repeat steps 1-6 to continuously edit the cadA / pnCC / purR / ydeIydeJ / yahNyahO sites in the E. coli BL21 (DE3) genome. Figure 6 The first round of editing of the cadA site was 100% successful, the second round of editing of the pnCC site was 100% successful, the third round of editing of the purR site was 87.5% successful, the fourth round of editing of the ydeIydeJ site was 100% successful, and the fifth round of editing of the yahNyahO site was 100% successful.

[0145] Example 7: Simultaneous dual-site editing in E. coli BL21 (DE3)

[0146] The plasmid pEBsgRNA-ΔushA-frvA_rhaM was constructed targeting the ushA / rvA_rhaM site of the Escherichia coli BL21 (DE3) genome.

[0147] The pEBcas9 / pEBsgRNA system mediates simultaneous editing of the ushA site and rvA_rhaM site in the E. coli BL21 (DE3) genome. The specific steps are as follows:

[0148] Step 1: First, pEBcas9 was transformed into Escherichia coli BL21 (DE3) to prepare BL21-pEBcas9 competent cells. The specific method was repeated in step 1 of Example 1;

[0149] Step 2: Add the plasmid pEBsgRNA-ΔushA-frvA_rhaM into BL21-pEBcas9 competent cells and place on ice for 30 minutes;

[0150] Step 3: Repeat step 3 of Example 1 with the competent cells obtained in step 2;

[0151] Step 4: Centrifuge the competent cells obtained in step 3 at 6000rpm for 1min, discard 500μL of supernatant on the clean bench, resuspend and apply to a mixed plate containing 50μg / mL kanamycin + 50μg / mL spectinomycin + 10ng / mL tetracycline, and culture at 30℃ for 12h. Verify whether the genome is successfully edited by colony PCR at the editing site. The results are as follows: Figure 7 , the success rate reached 62.5%.

[0152] Example 8: Screening for highly efficient exogenous gene expression sites in the E. coli BL21 (DE3) genome

[0153] Compared with plasmid-based expression, integrated expression has the advantages of less burden on cell metabolism, no need for antibiotics during expression, and small differences between monoclonal clones. For the integrated expression of exogenous genes, a key is to achieve a higher copy number. The antibiotic gene and mcherry gene are coupled and integrated into the genome, and then the antibiotic concentration is continuously increased to increase the copy number of the antibiotic gene and mcherry gene.

[0154] In this study, eight sites with high RNA expression and seven reported single-copy integration sites with different expression levels were selected for comparison.

[0155] Plasmid pEBsgRNA-frwA-frwC / plasmid ipEBsgRNA-glpD-yzgL / plasmid pEBsgRNA-sibD-sibE / plasmid pEBsgRNA-dadX-cvrA / plasmid pEBsgRNA-frvA-rhaM / plasmid pEBsgRNA-ykgH-betA / plasmid pEBsgRNA-yeeJ were constructed for 15 sites in the selected Escherichia coli BL21 (DE3) genome -yeeL / plasmid pEBsgRNA-ybfC-ybfQ / plasmid pEBsgRNA-yohD-yohF / plasmid pEBsgRNA-ycgB-dadA / plasmid pEBsgRNA-lpp-ldtE / plasmid pEBsgRNA-ydeI-ydeJ / plasmid pEBsgRNA-wrbA-ymdF / plasmid pEBsgRNA-yahO-yahN / plasmid pEBsgRNA-phoA-psiF.

[0156] The pEBcas9 / pEBsgRNA system mediates genome integration and expression in E. coli BL21 (DE3). The specific steps are as follows:

[0157] Step 1: First, pEBcas9 was transformed into Escherichia coli BL21 (DE3) to prepare BL21-pEBcas9 competent cells. The specific method was repeated in step 1 of Example 1;

[0158] Step 2: Add the above plasmid to BL21-pEBcas9 competent cells and place on ice for 30 minutes;

[0159] Step 3: Repeat step 3 of Example 1 with the competent cells obtained in step 2;

[0160] Step 4: Centrifuge the competent cells obtained in step 3 at 6000 rpm for 1 min, discard 500 μL of supernatant on the clean bench, resuspend and apply to a mixed plate containing 50 μg / mL kanamycin + 50 μg / mL spectinomycin + 10 ng / mL tetracycline, culture at 30°C for 12 h, and verify whether the genome is successfully edited by colony PCR at the editing site.

[0161] Step 5: Take the cells successfully edited in step 4 and repeat steps 4 to 6 of the method for eliminating the plasmid by combining the SacB gene and the Rep101 (Ts) gene in Example 2;

[0162] Step 6: Amplification of the construct is obtained by continuous cultivation in 10 mL LB medium with chloramphenicol. Grow the chromosome-inducing strain in 10 μg / mL chloramphenicol to stationary phase. Transfer 100 μL of the medium to a new culture tube. In the new tube, increase the concentration of chloramphenicol from 10 μg / mL to 20 μg / mL and allow it to grow to stationary phase. Repeat this process until the desired concentration is reached.

[0163] Step 7: Use the FastDNA SPIN kit (MP Biomedicines, USA) to extract genomic DNA from the integrated strain for qPCR detection of gene copy number. TM qPCR was performed using ChemQ Universal SYBR qPCR Master Mix (Novozyme, China) in Real Time PCR (Applied Biosystems, USA). The copy numbers of chloramphenicol and mcherry were detected and compared with the copy number of the natural gene gyrA in the genome.

[0164] Step 8: Take 10 μL of the cells with successful plasmid elimination obtained in step 5, inoculate into 10 mL of LB medium, culture at 37°C for 10 h, transfer 1 mL of the bacterial solution into 100 mL of LB liquid medium without antibiotics, and then culture at 37°C, 180 rpm. When the OD 600 When the p-value reached 0.6, IPTG (final concentration 0.1 mM) was added to induce expression. The culture was then incubated at 28°C for 10 h. The cells were collected by centrifugation at 12000 rpm for 1 min, and the cell pellet was resuspended in phosphate buffer (pH 7.5).

[0165] Step 9: Use GreinerBio-OneμClear black plate and GreinerBio-OneμClear white plate to measure mCherry fluorescence (excitation wavelength: 575nm, emission wavelength: 625nm) and OD respectively using Tecan Spark microplate reader600 , by dividing the fluorescence value by the corresponding OD 600 The fluorescence intensity was normalized by the value.

[0166] The results are as follows Figure 8 As shown, the frvA-rhaM, yahO-yahN, frwA-frwC and lpp-ldtE loci have high potential for efficient expression of foreign genes after genome integration.

[0167] Example 9: Construction of high-yield 1-cyano-cycloethylacetic acid chassis strain

[0168] For the highly efficient exogenous gene sites screened in Example 8, the lpp-ldtE genomic site was selected. The nitrilase (ACN) nucleotide sequence was amplified from Acidovoraxfacilis ZJB09122 by PCR, and the sequence was shown in SEQ ID NO.4. Using pEBsgRNA-lpp-ldtE as a template, the mCherry sequence in the plasmid pEBsgRNA-lpp-ldtE was replaced by a continuous induced chromosomal evolution (CIChE) DNA cassette containing a chloramphenicol resistance gene, and the ACN target sequence was inserted into the continuous induced chromosomal evolution (CIChE) DNA cassette of the chloramphenicol resistance gene, thereby constructing the plasmid pEBsgRNA-ACN.

[0169] The pEBcas9 / pEBsgRNA system mediates editing at the lpp-ldtE site of the E. coli BL21 (DE3) genome. The specific steps are as follows:

[0170] Step 1: First, pEBcas9 was transformed into Escherichia coli BL21 (DE3) to prepare BL21-pEBcas9 competent cells. The specific method was repeated in step 1 of Example 1;

[0171] Step 2: Add the plasmid pEBsgRNA-ACN to the BL21-pEBcas9 competent cells and place them on ice for 30 minutes;

[0172] Step 3: Repeat step 3 of Example 1 with the competent cells obtained in step 2;

[0173] Step 4: Centrifuge the competent cells obtained in step 3 at 6000 rpm for 1 min, discard 500 μL of supernatant on the clean bench, resuspend and apply to a mixed plate containing 50 μg / mL kanamycin + 50 μg / mL spectinomycin + 10 ng / mL tetracycline, and culture at 30°C for 12 h. Perform colony PCR on the editing site to verify whether the genome is successfully edited;

[0174] Step 5: Eliminate the plasmid pEBcas9 and plasmid pEBsgRNA-ACN in the cells, pick the single colony successfully edited in step 4, and repeat steps 4 to 6 of the combined elimination method of SacB gene and Rep101 (Ts) gene in Example 2;

[0175] Step 6: Pick the single colony that successfully eliminated the plasmid in step 5 into 10mL LB liquid culture medium and culture it at 37℃, 180rpm for 12h. Add it to the bacterial preservation tube with 30% glycerol solution in a volume ratio of 1:1, write the corresponding editing site mark and time, and preserve it at -80℃ for later use.

[0176] Step 7: Take the strain from step 6, add it to 10 mL LB liquid medium, add 1 μg / mL chloramphenicol, culture at 37°C, 180 rpm for 12 h, and add it to a bacterial preservation tube with a volume ratio of 1:1 and 30% glycerol solution, marked as S1;

[0177] Step 8: Take 100 μL of the bacterial solution from step 7 and transfer it to a new culture tube, increase the chloramphenicol concentration by one-fold (2 μg / mL), culture at 37°C, 180 rpm for 12 hours, and add it to the bacterial culture tube marked as S2 with a volume ratio of 1:1. Repeat this process, increase the chloramphenicol concentration by one-fold each time, and continue to culture to obtain the amplification of the construct until the desired concentration is reached. The results are as follows: Fig. 9 .

[0178] Step 9: Take 10 μL of the constructed strain in step 8 and add it to 10 mL of LB liquid culture medium and culture it at 37°C, 180 rpm for 12 h. Then inoculate it into 100 mL of LB liquid culture medium at a ratio of 1% and culture it at 37°C, 180 rpm for 2 h. Add IPTG (final concentration 0.1 μM), culture it at 28°C, 180 rpm for 12 h, and collect the bacteria by centrifugation at 8000 rpm, 4°C for 10 min.

[0179] Step 10: The wet cells collected in step 9 are used as biocatalysts, 1-cyanocyclohexylacetonitrile is used as a substrate, and the reaction system is as follows: 50 mL of phosphate buffer (200 mmol / L, pH 7.0) is added with nitrilase wet cells (final concentration 5 g / L) and 600 mM 1-cyanocyclohexylacetonitrile, 35°C, 200 rpm, and the reaction is centrifuged to remove the cells for 12 h. The reaction yield of the product 1-cyanocyclohexylacetic acid is detected by HPLC. The results are as follows: Fig.10 As shown, the conversion rate of the synthetic 1-cyanocycloethylacetic acid product of the control strain was 46%, and the yield of the constructed chassis strain reached 98.9%.

[0180] Liquid phase detection conditions: 1-Cyanocyclohexylacetic acid (1-CA) was analyzed by high performance liquid chromatography, and the chromatographic column type was J&K Scientific C18-H column (4.6×250mm, 5μm, ); mobile phase: acetonitrile = 76:24 (v:v). The aqueous phase in the mobile phase is phosphate buffer: 0.58g / L (5mmol / L) diammonium hydrogen phosphate, 1.8375g / L (13mmol / L) sodium perchlorate, perchloric acid adjusted to pH 1.8, the solvent is ultrapure water; the organic phase of the mobile phase is chromatographic grade acetonitrile. The flow rate is 1mL / min, the injection volume is 10μL, the UV detection wavelength is 215nm, and the column temperature is 40℃. The analysis time is 20min.

[0181] Example 10: Construction of a high-yield trans-chrysanthemic acid chassis strain

[0182] The frvA-rhaM genomic site was selected from the highly efficient exogenous gene sites screened in Example 8. The carboxylesterase (EST1) nucleotide sequence was amplified from Bacillus licheniformis by PCR, and the sequence was shown in SEQ ID NO.5. Using pEBsgRNA-frvA-rhaM as a template, the carboxylesterase target sequence replaced the mCherry sequence in the plasmid pEBsgRNA-frvA-rhaM, thereby constructing the plasmid pEBsgRNA-EST1.

[0183] The pEBcas9 / pEBsgRNA system mediates editing at the frvA-rhaM site of the E. coli BL21 (DE3) genome. The specific steps are as follows:

[0184] Step 1: First, pEBcas9 was transformed into Escherichia coli BL21 (DE3) to prepare BL21-pEBcas9 competent cells. The specific method was repeated in step 1 of Example 1;

[0185] Step 2: Integrate the plasmid pEBsgRNA-EST1 into the frvA-rhaM site of the Escherichia coli BL21 (DE3) genome, and repeat steps 1 to 7 of Example 6;

[0186] Step 3: Pick a single colony in which the three-site editing is successful in step 2, and repeat steps 4 to 6 of the combined elimination method of the SacB gene and the Rep101 (Ts) gene in Example 2;

[0187] Step 4: Pick the single colony that successfully eliminated the plasmid in step 3 into 10mL LB liquid culture medium and culture it at 37℃, 180rpm for 12h. Add it to the bacterial preservation tube with 30% glycerol solution in a volume ratio of 1:1, write the corresponding editing site mark and time, and preserve it at -80℃ for later use.

[0188] Step 5: Take the strain from step 4, add it to 10 mL LB liquid medium, add 1 μg / mL chloramphenicol, culture at 37°C, 180 rpm for 12 h, and add it to a bacterial preservation tube with a volume ratio of 1:1 with 30% glycerol solution and mark it as S1;

[0189] Step 6: Take 100 μL of the bacterial solution from step 5 and transfer it to a new culture tube, increase the chloramphenicol concentration by one-fold (2 μg / mL), culture at 37°C, 180 rpm for 12 hours, and add it to the bacterial culture tube marked as S2 with a 30% glycerol solution at a volume ratio of 1:1. Repeat this process, increase the chloramphenicol concentration by one-fold each time, and culture continuously to obtain the amplification of the construct until the desired concentration is reached. The integration copy number results of the trans-chrysanthemic acid chassis strain under different chloramphenicol concentrations are shown in Figure 2. Fig.11 Shown

[0190] Step 7: Take the constructed strain in step 6 and inoculate it into a 10mL LB liquid medium test tube containing a final concentration of 100μg / mL kanamycin resistance, and culture it at 37°C and 180rpm for 12h. Then inoculate it into a fresh 500mL LB medium containing a final concentration of 100ug / ml kanamycin resistance at a volume concentration of 1% inoculum, and culture it in a shaker at 37°C and 180rpm for 2h until the bacterial OD reaches 600 After reaching 0.6-0.8, IPTG (final concentration 0.1 μM) was added, and the cells were cultured at 28°C and 180 rpm for 12 h. The cells were collected by centrifugation at 8000 rpm and 4°C for 10 min to obtain wet cells of the recombinant E. coli for later use.

[0191] Step 8: The wet bacteria prepared in step 7 are used as a biocatalyst to catalyze the synthesis of trans-chrysanthemic acid using chrysanthemic acid methyl ester as a substrate. The reaction system is as follows: 100 g / L chrysanthemic acid methyl ester, 100 mM pH 8 phosphate buffer as a buffer system, and 10 g / L recombinant Escherichia coli to form a 100 mL reaction system.

[0192] Reaction conditions: 45°C, 800 rpm for 36 h, 6 mM HCl was added to terminate the reaction, the reaction solution was extracted with ethyl acetate and dried, 500 uL of n-hexane was added to filter membrane, and the trans-chrysanthemic acid concentration was detected by HPLC, and the conversion rate and ee value were calculated.

[0193] HPLC liquid phase detection method: take the dissolved sample and filter it with a 0.22μm nylon filter membrane for liquid phase detection. The liquid phase column is CHIRALPAKQN-AX (quinine alkaloid) chiral column; the mobile phase ratio is acetonitrile: water: acetic acid = 90:10:0.5 (v / v), the flow rate is 0.8ml / min, the temperature is 15℃, the detection wavelength is 230mm, the column temperature is 15℃, and the injection volume is 20ul. The solvent retention time is 1.93min, and the peak time of right-handed trans-chrysanthemic acid is 2.85min.

[0194] The integration copy number results of trans-chrysanthemic acid chassis strains under different chloramphenicol concentrations are as follows Fig.11 As shown, the results are Fig.12 As shown, the yield of trans-chrysanthemic acid of the control strain was 51%, and the product yield of the constructed chassis strain reached a maximum of 96%.

[0195] The embodiments described above are merely descriptions of preferred implementations of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope of the present invention.

Claims

1. A stable and efficient Escherichia coli gene editing system, characterized in that: Include: pEBcas9 expression plasmid and pEBsgRNA expression plasmid, The pEBcas9 expression plasmid contains a nucleotide sequence encoding a Cas gene and a nucleotide sequence encoding a SacB gene; The pEBsgRNA expression plasmid contains a nucleotide sequence encoding a sgRNA molecule, a guide sequence connected to the sgRNA molecule sequence and at least a portion of which is complementary to the target sequence, and a nucleotide sequence encoding a Rep101 (Ts) gene.

2. The gene editing system according to claim 1, characterized in that: The nucleotide sequence of the pEBcas9 expression plasmid is shown in SEQ ID NO.1, and the nucleotide sequence of the pEBsgRNA expression plasmid is shown in SEQ ID NO.

2.

3. The gene editing system according to claim 1, characterized in that: The Cas gene on the pEBcas9 expression plasmid is driven to express by an inducible promoter.

4. The gene editing system according to claim 3, characterized in that The inducible promoter is selected from P BAD , P Tet , P lac , P rhaB and P T7 One of them.

5. The gene editing system according to claim 4, characterized in that: The gene editing system operates in an environment temperature of 30°C to 37°C.

6. Use of the gene editing system according to any one of claims 1 to 5 in editing the genome of Escherichia coli, characterized in that: The genome editing includes gene knockout, gene integration, gene replacement, multi-site continuous editing, and multi-site simultaneous editing.

7. Use of the gene editing system according to any one of claims 1 to 5 in constructing a 1-cyanocycloethylacetic acid chassis strain, characterized in that: The gene editing system is used to integrate the nitrilase gene into Escherichia coli to construct a 1-cyanocycloethylacetic acid chassis strain; the nitrilase gene is from Pseudomonas agile, and the nucleotide sequence is shown in SEQ ID NO.

4.

8. An application of the gene editing system described in claim 7 in constructing a trans-chrysanthemic acid chassis strain, characterized in that: The gene editing system is used to integrate the carboxylesterase gene into Escherichia coli to construct a trans-chrysanthemic acid chassis strain for catalyzing the asymmetric synthesis of trans-chrysanthemic acid from ethyl chrysanthemate; the carboxylesterase gene is from Pseudomonas agile, and the nucleotide sequence is shown in SEQID NO.5.

Images