Fusion plasmid and application thereof in gene transfer and protein expression

Abstract

The invention relates to the technical field of biology, in particular to a fusion plasmid and application thereof in gene transfer and protein expression. The invention provides brand new IncI1 and IncHI2 / IncHI2A fusion plasmids which are derived from clinical salmonella, contain NDM-13 and OXA-10 at the same time and can be transferred autonomously, and the plasmids also carry other various drug-resistant genes and show drug resistance to various antibiotics. The salmonella is a pathogenic bacterium of zoonosis and has the capacity of infecting people and livestock. The salmonella carrying the plasmid has the potential of outbreak prevalence, and needs to be positively researched to prevent the outbreak prevalence.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a fusion plasmid and its application in gene transfer and protein expression. Background Art

[0002] Carbapenemase-resistant Enterobacteriaceae are a class of bacteria that have developed resistance to carbapenem antibiotics. These enzymes hydrolyze carbapenems, rendering them ineffective. Plasmids play a crucial role in the spread of carbapenemase-resistant Enterobacteriaceae. Plasmids can carry a variety of resistance genes, including those encoding carbapenemases (e.g., KPC, NDM, IMP, etc.). Plasmids can be transmitted between bacteria through conjugation, transformation, or transduction. This horizontal gene transfer allows resistance to spread rapidly to other bacteria, particularly in hospital settings. Therefore, understanding the molecular biology of plasmids carrying carbapenemase genes is crucial for preventing the spread of carbapenemase-resistant genes.

[0003] Existing drug-resistant plasmids often carry a single carbapenemase gene. The pNDM5-L241 plasmid has only one NDM-5 gene, the pK516_KPC plasmid has only one KPC gene, and the pIMP-4-EC62 plasmid contains only one IMP gene. These plasmids lack the ability to resist multiple antibiotics. Most plasmids carrying drug-resistant genes have only a single replicon type. For example, the replicon types of pSTEC636-1 (CPO61213) and pSI173-1 (CP050768) are IncI1-I, the replicon type of pNDM5-L241 (CP033057) is IncX3, and the pSIM-1-BJ01 plasmid is IncHI5. Plasmids carrying multiple drug-resistant genes often lack the ability to self-transfer, which severely limits their ability to spread. Plasmid conjugative transfer experiments showed that the pCF2075-1 plasmid, carrying NDM-1 and KPC-2, was incapable of autonomous transfer. According to oriTfinder (https: / / bioinfo-mml.sjtu.edu.cn / oriTfinder / ), pCF2075-1 carries genes encoding oriT (transfer origin) and relaxase, but lacks genes for T4CP (type IV chaperone protein) and T4SS (type IV), indicating that the plasmid lacks autonomous transfer. Summary of the Invention

[0004] In light of this, the present invention provides a fusion plasmid and its use in gene transfer and protein expression. The present invention also provides a plasmid for transmitting drug-resistance genes. The plasmid is derived from Salmonella and can serve as a vector for transmitting the drug-resistance gene NDM-13. Further plasmid conjugative transfer experiments have demonstrated that the plasmid can transfer the NDM-13 gene to Escherichia coli.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a fusion plasmid comprising IncI1 replicon, IncHI2 replicon and IncHI2A replicon.

[0007] In some specific embodiments of the present invention, the fusion plasmid comprises two IncHI2 replicons.

[0008] In some specific embodiments of the present invention, the fusion plasmid further comprises a conjugative transfer module; the conjugative transfer module comprises ori T, relaxase mobH, T4CP gene traD and T4SS trh family genes.

[0009] In some specific embodiments of the present invention, the fusion plasmid further comprises a drug-resistant gene.

[0010] In some specific embodiments of the present invention, the drug resistance genes include aadA2, aad A1, aac(3)-IVa, aph(4)-Ia, aph(3')-Ia, aph(6)-Id, aph(3")-Ib, aadA22 of aminoglycosides; bla of Beta-lactams NDM-13 、bla TEM-1B , blaOXA-10; bleomycin MBL ; cmlA1, cmlA5, floR of chloramphenicol; lnu(F) of lincomycin; ar r-2 of rifamycin; tet(A) of tetracycline; dfrA14 of trimethoprim; qnrS1 of quinolone, sul3 of sulfonamide and qacL of quaternary ammonium.

[0011] In some specific embodiments of the present invention, the fusion plasmid has a nucleotide sequence as shown in SEQ ID NO.1.

[0012] The present invention also provides biological materials capable of transferring functional genes, including the fusion plasmid.

[0013] The present invention also provides a host comprising the fusion plasmid.

[0014] In some embodiments of the present invention, the host comprises Escherichia coli and / or Salmonella.

[0015] The present invention also provides the use of any of the following in gene transfer and protein expression:

[0016] (I), the fusion plasmid; and / or

[0017] (II), the biological material capable of transferring functional genes; and / or

[0018] (III) the host.

[0019] In some specific embodiments of the present invention, the gene transfer includes transferring a drug-resistant gene to a recipient bacterium.

[0020] The present invention also provides the use of any of the following in in vitro screening of drug-resistant gene expression inhibitors or strain resistance reversal drugs:

[0021] (I), the fusion plasmid; and / or

[0022] (II), the biological material capable of transferring functional genes; and / or

[0023] (III) the host.

[0024] The present invention provides the following beneficial effects:

[0025] This study discovered a novel, autonomously transferable fusion plasmid, IncI1 and IncHI2 / IncHI2A, derived from clinical Salmonella, containing both NDM-13 and OXA-10. This plasmid also carries multiple other resistance genes, demonstrating resistance to multiple antibiotics. Salmonella is a zoonotic pathogen, capable of infecting both humans and livestock. Salmonella carrying this plasmid has the potential to cause epidemics, necessitating active research to prevent such outbreaks.

[0026] 1. This plasmid contains two complete sets of conjugative transfer modules (including oriT, relaxase mobH, T4CP gene traD and T4SS trh family genes), which has stronger conjugative transfer ability.

[0027] 2. Contains two resistance genes, NDM-13, and one resistance gene, OXA-10, demonstrating high levels of drug resistance. The MIC values ​​of the plasmid-carrying strain to both meropenem and imipenem were greater than 16.

[0028] 3. This plasmid is a fusion of two types of plasmids, has the ability to cope with complex genetic environments, and is easier to survive and spread between strains. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for describing the embodiments or the prior art.

[0030] Figure 1 Carbapenem-resistant Salmonella bla NDM Gene electrophoresis diagram; 1 and 2 are PCR products, and M is a DNA marker;

[0031] Figure 2 The circularity comparison between plasmid pSAL22057-NDM13 and other reported plasmids is shown;

[0032] Figure 3 Shows comparative genomic analysis of NDM-13-producing pSAL22057-NDM13 and other homologous plasmids based on wgSNP sequences; *The number in the center of the phylogenetic tree represents the bootstrap value, which is used to evaluate the credibility of the phylogenetic tree branches. Only 70% to 100% of the results are shown in the figure. DETAILED DESCRIPTION

[0033] The present invention discloses fusion plasmids and their applications in gene transfer and protein expression. Those skilled in the art can refer to the contents herein and appropriately modify the process parameters to achieve the desired results. It should be noted that all similar substitutions and modifications will be apparent to those skilled in the art and are considered to be encompassed by the present invention. The methods and applications of the present invention have been described through preferred embodiments, and it is apparent that those skilled in the art can modify or appropriately alter and combine the methods and applications described herein without departing from the content, spirit, and scope of the present invention to implement and apply the technology of the present invention.

[0034] The present invention isolated Salmonella from the stool of a child with diarrhea. Drug sensitivity testing revealed resistance to meropenem and imipenem. PCR and product sequencing revealed the production of the NDM-13 gene. Plasmid conjugative transfer experiments demonstrated that the plasmid pSAL22057-NDM13, carrying the Salmonella NDM-13 gene, could autonomously transfer to Escherichia coli.

[0035] Sequencing was performed using the third-generation PacBio Sequel II platform and the second-generation Illumina NovaSeq 6000 platform. Large fragment libraries (10-20 kb) and small fragment libraries (~400 bp) were constructed from DNA samples that passed quality inspection and sequenced on separate platforms to generate raw data. Subsequently, various assembly software packages were used to assemble the third-generation data separately or a mix of the second and third generation data. The final assembly was then corrected using the second-generation data to obtain the final assembly of the bacterial genome. Ultimately, the complete plasmid sequence was obtained.

[0036] In addition to the NDM-13 gene, the plasmids discovered in this study also carry a variety of other drug-resistant genes, such as aadA2, aadA1, aac(3)-IVa, aph(4)-Ia, aph(3')-Ia, aph(6)-Id, aph(3")-Ib, and aadA22 of aminoglycosides; bla of Beta-lactams NDM-13 、bla TEM-1B 、bla OXA-10 bleomycin MBL The plasmid contains a rich set of resistance genes, including cmlA1, cmlA5, and floR for chloramphenicol, lnu(F) for lincomycin, arr-2 for rifamycin, tet(A) for tetracycline, dfrA14 for trimethoprim, qnrS1 for quinolone, sul3 for sulfonamide, and qacL for quaternary ammonium salts. These resistance genes provide the plasmid with the ability to cope with a variety of antibiotics.

[0037] The plasmid pSAL22057-NDM13 of the present invention contains IncHI2 (BX664015), IncHI2 (BX664015), IncHI2A (BX664015) and IncI1-I (Alpha) (AP005147), and is a fusion plasmid of IncI1 and IncHI2 / IncHI2A carrying NDM-13.

[0038] The plasmid of the present invention contains a complete conjugative transfer module (including oriT, relaxase mobH (ORF1_97, AGS77392), T4CP gene traD (ORDF_96, NP_052502) and T4SS trh family genes (ORF1_54, 58, 68, 69, 70, 71, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 94, 95, 96, 103)), which indicates that the components constituting pSAL22057-NDM13 themselves have conjugative transfer ability. Therefore, pSAL22057-NDM13 is a conjugative plasmid capable of horizontal transfer. Conjugative transfer experiments also show that the pSAL22057-NDM13 plasmid can be autonomously transferred into Escherichia coli. The plasmid pSAL22057-NDM13 of the present invention contains two NDM-13 genes.

[0039] The nucleotide sequence of the plasmid pSAL22057-NDM13 of the present invention is (SEQ ID NO.1):

[0040] >Sal-Plas (363,671 base pairs)

[0041]

[0042] oriT (SEQ ID NO: 13):

[0043] TCACTTCAGGCTCCTTACGGGGTGTCGGGGCGAAGCCCTGACCAGATGGTAATTGTAATAGC GTCGCGTGTGACGGTATTACAATTACACATCCTGTCCCGTTTTTCAGG

[0044] Unless otherwise specified, the fusion plasmid provided by the present invention and the raw materials and reagents used in its application in gene transfer and protein expression can be purchased from the market.

[0045] The present invention will be further described below in conjunction with the embodiments:

[0046] Example 1 Screening of Carbapenemase-Resistant Salmonella Resistance Genes

[0047] 1. Isolation of Salmonella strains

[0048] A small amount of fecal sample was smeared on SS culture medium, divided into sections and streaked, and cultured at 37°C for 18 to 24 hours. The hydrogen sulfide-producing strains were preliminarily screened and identified as Salmonella using MALDI-TOF mass spectrometry.

[0049] Single colonies of different morphologies on the above culture medium were picked and re-inoculated on the culture medium to purify the bacteria, and then transferred into LB culture medium for purification.

[0050] The purified bacteria (Salmonella SAL22057) were stored in bacterial suspension tubes at -80°C.

[0051] 2. In vitro drug susceptibility testing of Salmonella strains

[0052] In vitro antimicrobial susceptibility testing was performed according to standard methods from the 2020 Clinical and Laboratory Standards Institute (CLSI) guidelines. Antibiotics tested included amoxicillin-clavulanic acid, piperacillin-tazobactam, cefotaxime, ceftazidime, cefpirome, cefepime, meropenem, imipenem, aztreonam, levofloxacin, ciprofloxacin, trimethoprim / sulfamethoxazole, tigecycline, and polymyxin B. Escherichia coli ATCC25922 was used as a quality control strain.

[0053] The results showed (see Table 1) that Salmonella SAL22057 was resistant to meropenem and imipenem.

[0054] Table 1 In vitro drug susceptibility test of Salmonella strains

[0055]

[0056] 3. Screening of carbapenemase-resistant Salmonella genes

[0057] We tested bla NDM 、bla KPC 、bla IMP 、bla VIM and bla OXA-48 Carbapenem-resistant genes such as the following, and the primers for each gene are shown in Table 2 below.

[0058] Table 2 Primer sequences for amplifying drug-resistant genes

[0059]

[0060] (1) Preparation of DNA template

[0061] The purified Salmonella DNA was extracted using the Ezup column-based bacterial genomic DNA extraction kit.

[0062] DNA quality testing:

[0063] Take 5 μL DNA solution and perform electrophoresis (voltage 120-180 V) on 1% agarose and 1X TAE buffer solution. A single band indicates that the DNA is intact and not degraded, and a clear band indicates that the concentration can meet the PCR requirements.

[0064] Check the concentration and purity using a spectrophotometer. Take 1 μL of DNA and check the OD value. An OD260 / 280 value between 1.7 and 2.0 indicates good DNA quality. A value below 1.7 indicates protein contamination, while a value above 2.0 indicates RNA contamination. Generally, small amounts of protein and RNA contamination do not affect standard PCR.

[0065] (2) PCR reaction system is shown in Table 3.

[0066] Table 3 PCR reaction system

[0067]

[0068]

[0069] (3) PCR reaction conditions are shown in Table 4.

[0070] Table 4 PCR reaction conditions

[0071]

[0072] (4) Electrophoresis detection bands

[0073] 5 μL of PCR product was subjected to 1% agarose gel electrophoresis at 150 V, 100 mA, and 10 to 20 min for observation.

[0074] The size of PCR products was detected by electrophoresis. Figure 1 shown.

[0075] (5) Sequencing

[0076] Purification and recovery of PCR products: The target PCR bands were excised and recovered from the gel using the SanPrep column-based DNA gel recovery kit (Sangong B518131).

[0077] Data analysis: Search for results in the result group and analyze them using sequence analysis software.

[0078] The sequence of the PCR product is as follows. The BLAST result shows NDM-13, and the nucleotide sequence is shown in SEQ ID NO.12:

[0079] CCTCGCATTTGCGGGGTTTTTAATGCTGAATAAAAGGAAAACTTGATGGAATTGCCCAATATTATGCACCCGGTCGCGAAGCTGAGCACCGCATTAGCCGCTGCATTGATGCTGAGCGGGTGCATGCCCGGTGAAATCCGCCCGACGATTGGCCAGCAAATGGAAACTGGCGACCAACGGTTTGGCGATCTGGTTTTCCGCCAGCTCGCACCGAATGTCTGGCAGCACACTTCCTATCTCGACATGCCGGGTTTCGGGGCAGTCGCTTCCAACGGTTTGATCGTCAGGGATGGCGGCCGCGTGCTGGTGGTCGATACCGCCTGGACCAATGACCAGACCGCCCAGATCCTCAACTGGATCAAGCAGGAGATCAACCTGCCGGTCGCGCTGGCGGTGGTGACTCACGCGCATCAGGACAAGATGGGCGGTATGGACGCGCTGCATGCGGCGGGGATTGCGACTTATGCCAATGCGTTGTCGAACCAGCTTGCCCCGCAAGAGGGGCTGGTTGCGGCGCAACACAGCCTGACTTTCGCCGCCAATGGCTGGGTCGAACCAGCAACCGCGCCCAACTTTGGCCCGCTCAAGGTATTTTACCCCGGCCCCGGCCACACCAGTGACAATATCACCGTTGGGATCGACGGCACCGACATCGCTTTTGGTGGCTGCCTGATCAAGGACAGCAAGGCCAAGTCGCTCGGCAATCTCGGTGATGCCGACACTGAGCACTACGCCGCGTCAGCGCGCGCGTTTGGTGCGGCGTTCCCCAAGGCCAGCATGATCGTGATGAGCCATTCCGCCCCCGATAGCCGCGCCGCAATCACTCATACGGCCCGCATGGCCGACAAGCTGCGCTGAGCCATGGCTGACCACGTCACCCCCAATCTGCCATCGCGCGA

[0080] Example 2 Whole Genome Sequencing and Bioinformatics Analysis of Bacteria

[0081] 1. Extraction of Bacterial Genome

[0082] The bacterial genome was extracted according to the instructions of the Puregene R Yeast / Bact.Kit B kit from QIAGEN.

[0083] (1) The single Salmonella SAL22057 isolated in Example 1 was selected and incubated in LB liquid culture medium overnight.

[0084] (2) Use a pipette to mix the above liquid, pipette 500 μL into a 1.5 mL centrifuge tube, and place it on ice.

[0085] (3) Centrifuge at 13,000-16,000 × g for 5 seconds and discard the supernatant.

[0086] (4) Add 300 μL of Cell Lysis Solution and mix thoroughly by pipetting back and forth with a pipette. Place the sample in an 80°C water bath for 5 minutes.

[0087] (5) Add 1.5 μL of RNase A Solution, invert the tube 25 times, and incubate in a 37°C water bath for 15–60 min.

[0088] (6) Take out the sample and quickly place it on ice for 1 minute to quickly cool the sample.

[0089] (7) Add 100 μL of Protein Precitation Solution and vortex at high speed for 20 seconds.

[0090] (8) Centrifuge at 13,000-16,000 × g for 3 min.

[0091] (9) Take a new 1.5 mL centrifuge tube, add 300 μL of isopropanol and the supernatant after centrifugation in (8), and mix by inverting 50 times.

[0092] (10) Centrifuge at 13,000-16,000 × g for 1 min. Carefully discard the supernatant and invert the tube onto a clean paper towel to dry it.

[0093] (11) Add 300 μL of 70% ethanol and invert the tube several times to wash the DNA pellet.

[0094] (12) Centrifuge at 13,000–16,000 × g for 1 min. Discard the supernatant and invert the tube onto a clean paper towel to dry it. Allow to air dry for 5 min.

[0095] (13) Add 100 μL DNA Hydration Solution and vortex for 5 seconds.

[0096] (14) Incubate at 65°C for 1 hour.

[0097] (15) Place on a shaker at 25°C ± 5°C overnight. Note: Make sure the tube cap is tightly closed to prevent leakage.

[0098] (16) Briefly centrifuge the sample to separate the liquid from the tube cap. Store at -80℃.

[0099] 2. Sequencing and assembly of bacterial genomes

[0100] (1) The extracted bacterial DNA was sent to Beijing Novogene Technology Co., Ltd. for second-generation sequencing on the Illumina HiSeq4000-PE150 platform and third-generation sequencing on the PacBio RS II platform.

[0101] (2) After sequencing, a large number of paired-end fragments of approximately 150 bp were obtained for each bacterial sample.

[0102] (3) This study first filtered out low-quality sequence fragments through quality control using the Novogene pipeline. SPAdes 3.10.0 and Velvet 1.2.10 software were then used to splice the filtered sequence fragments (except for L683 and L725) into contigs containing the complete bacterial genome information. At the same time, SPAdes 3.11.1 software was used to splice the second- and third-generation sequencing reads of the Illumina platform and the PacBio platform sequencing reads of L683 and L725 to obtain complete gene data.

[0103] BLAST comparison results showed that the NDM-13 gene was located in the Plas1 plasmid, named pSAL22057-NDM13.

[0104] Table 5p22057-NDM13 plasmid analysis

[0105]

[0106]

[0107] Plasmid pSAL22057-NDM13 carries four plasmid replicons, including IncHI2, IncHI2, IncHI2A, and IncI1-I (Alpha). Therefore, pSAL22057-NDM13 is a conjugative plasmid.

[0108] BLAST results (see Table 5) showed that pSAL22057-NDM13 shared 98.9% similarity and 32.7% coverage with pMR0716 from E. coli; 99.9% similarity and 62.7% coverage with pHS13-1-IncHI2 from E. coli; and 99.8% similarity and 55.2% coverage with pCFSA664- from E. coli. pSAL22057-NDM13 is 363,671 bp in length and has a GC content of 48.20%. The prediction results showed that the plasmid carried a variety of drug resistance genes, including aadA2, aadA1, aac(3)-IVa, aph(4)-Ia, aph(3')-Ia, aph(6)-Id, aph(3")-Ib, and aadA22 of aminoglycosides; bla of Beta-lactams NDM-13 、bla TEM-1B 、bla OXA-10 bleomycin MBL The p22057-NDM13 plasmid contains a variety of resistance genes, including cmlA1, cmlA5, and floR for chloramphenicol; lnu(F) for lincomycin; arr-2 for rifamycin; tet(A) for tetracycline; dfrA14 for trimethoprim; qnrS1 for quinolone; sul3 for sulfonamide; and qacL for quaternary ammonium. These abundant resistance genes provide the SAL22057 strain with the ability to cope with a wide range of antibiotics. Therefore, we conclude that p22057-NDM13 is a novel plasmid carrying resistance genes.

[0109] Further analysis revealed that the 1-111,509 bp sequence of pSAL22057-NDM13 (from the first gene, ardA, to ΔIS1294) is highly similar (coverage ≥ 91%, identity ≥ 99.71%) to the complete plasmid sequences of E. coli plasmid pHNAHS65I-1 (MN219406) and S. enterica plasmids pNDM13-SR33 (CP092912) and psg_wt5 (CP037994). This region is designated Plasmid Homologous Region 1 (denoting the region homologous to the first type of plasmid). They all share the same plasmid stability region and conjugative transfer module (including oriT, the relaxase nikB, the T4CP gene trbC, and the T4SS tra family genes). Similarly, the 111,510-363,491 bp sequence of pSAL22057-NDM13 (both beginning and ending with a hypothetical protein) is homologous to E. coli plasmid pSJ_255 (CP011062), pLH30-mcr1 (CM008265), p2474-MCR1 (CP021209), pSTEC636_1 (CP061213), pNDM33-1 (MN915011), and S. enterica plasmid p81741-unnamed1 (CP019443), and we termed it Plasmid Homologous Region 2. Based on alignment and preliminary analysis of the pSAL22057-NDM13 plasmid sequence, we found that this plasmid is composed of two different types of plasmids and constitutes a novel plasmid.

[0110] Example 3 Plasmid conjugation transfer experiment

[0111] Carrying bla NDM-13 Plasmid conjugation transfer experiment

[0112] (1) Single colonies of pure Salmonella SAL22057 and recipient bacteria E. coli 600 were streaked out on MHA medium.

[0113] (2) Use a disposable inoculation loop to pick a single colony and inoculate it into 2 ml of LB liquid medium. Place the culture in a shaking incubator at 37°C, 180 rpm, and culture for 6 to 8 hours until the bacteria grow into the logarithmic phase.

[0114] (3) Use a pipette to take 300 μL of LB liquid containing the recipient bacteria and 600 μL of LB liquid containing the donor bacteria into a centrifuge tube and mix them by pipetting.

[0115] (4) Pipette the mixed solution into 4 mL of LB liquid medium and place in a shaking incubator at 37°C, 180 rpm, and culture for 12 h.

[0116] (5) Pipette 100 μL of the liquid in (4) onto the drug plate and spread it with an L-shaped smear stick until the bacterial liquid is completely absorbed. Note: The drug plates are prepared by adding corresponding drugs to MHA medium, namely rifampicin (200 mg / L) drug plate, meropenem (2 mg / L) and double drug plate (200 mg / L rifampicin and 2 mg / L meropenem).

[0117] (6) Pick a single colony grown on the double-drug plate and re-inoculate it on a new double-drug plate. Identify the bacterial species by MALDI-TOF MS and identify whether it carries bla by PCR reaction and agarose gel electrophoresis. NDM Gene.

[0118] (7) Passed the preliminary screening criteria of the plasmid transfer conjugation test in Table 6 and was identified as carrying bla NDM The E. coli 600-pSA L22057-NDM13 of the gene was a successful plasmid transfer conjugate and was stored in a bacterial storage tube at -80°C.

[0119] Table 6 Preliminary screening criteria for plasmid transfer conjugation assay

[0120]

[0121]

[0122] The results of the plasmid conjugation transfer experiment showed that both the recipient bacteria E. coli C600 and E. coli 600-pSAL22057-NDM13 met the preliminary screening criteria for the plasmid conjugation experiment. MALDI-TOF MS identification showed that the conjugate E. coli 600-pSAL22057-NDM13 was E. coli. PCR amplification detection showed that the conjugate E. coli 600-pSAL22057-NDM13 carried bla NDM-13 gene. Salmonella carries bla ND M-13 The plasmid pSAL22057-NDM13 carrying the gene can be autonomously transferred to other bacteria, with a frequency of conjugative transfer of approximately 1.67×10 -2 .

[0123] Example 4 Construction and beautification of plasmid evolutionary tree

[0124] The genomic sequences of the selected homologous plasmids were mapped to the reference genome pSAL22057-NDM13. Due to the significant differences between the two types of plasmids, wgSNP sequences were extracted and a phylogenetic tree was constructed using the ML method. The resulting phylogenetic tree was annotated using iTOL, with information on the replicon type of each plasmid. The homologous plasmids were used as reference sequences, using the software kSNP3 and the ML method. Plasmid replicon prediction was performed using the software Pathogenwatch.

[0125] Interpretation of the results:

[0126] Phylogenetic analysis ( Figure 3 ) showed that the homologous plasmids of pSAL22057-NDM13 are mainly divided into two types: one carries the IncI1-I (Alpha) replicon, corresponding to Plasmid Homologous Region 1, and the other carries the IncHI2 / IncHI2A replicon, corresponding to Plasmid Homologous Region 2. A few plasmids, such as pLH1-mcr1 and pSJ-255, may also carry additional replicons (IncFIB(K) and IncN), suggesting that these homologous plasmids may have undergone recombination and integration with other types of plasmids. This is consistent with our previous results. pNDM-TJ33 is the only homologous plasmid in the reference sequence to carry all three replicons: IncI1-I (Alpha), IncHI2, and IncHI2A. After comparison, we found that pNDM-TJ33 is very similar to our pSAL22057-NDM13 plasmid. It is also a fusion plasmid containing both IncI1-I (Alpha) and IncHI2 / IncHI2A type plasmid replicons. However, there are still some differences in the genomic sequences between the two. More importantly, pNDM-TJ33 is reported to be a fusion plasmid formed by conjugation transfer experiments, while our pSAL22057-NDM13 is derived from clinical samples. To our knowledge, this is the first time that bla has been found in clinically isolated Salmonella. NDM -harboring IncI1 and IncHI2 / Inc HI2A-type fusion plasmids.

[0127] This fusion plasmid can play an important role in the following aspects: (1) Genetic engineering research: It can be used as a vector in genetic engineering research and play an important role in transfection or transformation experiments. Researchers can insert the gene to be studied into the fusion plasmid, and then transfer the fusion plasmid into the target bacteria to achieve the expression and research of the target gene. (2) Biotechnology production: The stability and transferability of the fusion plasmid make it an important tool that can play a role in the field of biotechnology. It can be used in biopharmaceutical manufacturing, enzyme engineering, protein expression and other fields. (3) Environmental remediation: The fusion plasmid can be designed for environmental remediation, such as for treating harmful substances in contaminated soil or water. The fusion plasmid can carry specific genes to help bacteria degrade toxic compounds and play a role in environmental governance.

[0128] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A fusion plasmid, characterized in that: Including IncI1 replicon, IncHI2 replicon and IncHI2A replicon.

2. The fusion plasmid according to claim 1, characterized in that It also includes a conjugation transfer module; the conjugation transfer module includes oriT, relaxase mobH, T4CP gene traD and T4SS trh family genes.

3. The fusion plasmid according to claim 1 or 2, characterized in that: Also includes drug resistance genes.

4. The fusion plasmid according to any one of claims 1 to 3, characterized in that The fusion plasmid has a nucleotide sequence as shown in SEQ ID NO.

1.

5. A biomaterial capable of transferring functional genes, characterized in that: The method comprises the fusion plasmid according to any one of claims 1 to 4.

6. A host, characterized in that The method comprises the fusion plasmid according to any one of claims 1 to 4.

7. The host according to claim 6, characterized in that The host includes Escherichia coli and / or Salmonella.

8. Application of any of the following in gene transfer and protein expression: (I), the fusion plasmid according to any one of claims 1 to 4; and / or (II), the biomaterial capable of transferring functional genes as claimed in claim 5; and / or (III) The host according to claim 6 or 7.

9. The use according to claim 8, characterized in that The gene transfer includes the transfer of drug-resistant genes to recipient bacteria.

10. Use of any of the following in in vitro screening of drug-resistant gene expression inhibitors or strain resistance reversal drugs: (I), the fusion plasmid according to any one of claims 1 to 4; and / or (II), the biomaterial capable of transferring functional genes as claimed in claim 5; and / or (III) The host according to claim 6 or 7.

Images