Fusion plasmid and its application in gene transfer and protein expression

Abstract

The present application relates to the field of biotechnology, in particular to a fusion plasmid and its application in gene transfer and protein expression. The present application provides a novel IncI1 and IncHI2 / IncHI2A type self-transmissible fusion plasmid containing NDM-13 and OXA-10 from clinical Salmonella, which also carries other multiple drug resistance genes and shows resistance to multiple antibiotics. Salmonella is a pathogenic bacterium of zoonosis and has the ability to infect humans and livestock. Salmonella carrying the plasmid has the potential to cause outbreaks, and active research is needed to prevent the occurrence of outbreaks.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a fusion plasmid and its application in gene transfer and protein expression. BACKGROUND

[0002] Enterobacteriaceae bacteria resistant to carbapenemases are a class of bacteria resistant to carbapenem antibiotics. The enzyme can hydrolyze carbapenem antibiotics, making these antibiotics lose their bactericidal effect. Plasmids play a very important role in the spread of Enterobacteriaceae bacteria resistant to carbapenemases. Plasmids can carry multiple drug resistance genes, including genes encoding carbapenemases (such as KPC, NDM, IMP, etc.). Plasmids can be transmitted between bacteria through conjugation, transformation or transduction and other ways. This horizontal gene transfer enables drug resistance to spread rapidly to other bacteria, especially in a hospital environment. Therefore, the molecular biology interpretation of plasmids carrying carbapenemase genes is particularly important to cut off the spread of carbapenemase genes.

[0003] Existing drug-resistant plasmids often carry a carbapenemase gene. The pNDM5-L241 plasmid has only one NDM-5 gene, the pK516_KPC has only one KPC gene, and the pIMP-4-EC62 plasmid contains only one IMP gene. The corresponding host does not have the ability to respond to multiple antibiotic drugs. Most plasmids carrying drug resistance genes have only one replicon type, such as: pSTEC636-1 (CPO61213), pSI173-1 (CP050768) replicon type is IncI1-I, pNDM5-L241 (CP033057) replicon type is IncX3, pSIM-1-BJ01 plasmid type is IncHI5. Plasmids carrying multiple drug resistance genes often do not have the ability to self-transfer, which severely limits the transmission ability of drug-resistant plasmids. Plasmid conjugation transfer test shows that pCF2075-1 plasmid carrying NDM-1 and KPC-2 cannot self-transfer. According to the prediction results of oriTfinder (https: / / bioinfo-mml.sjtu.edu.cn / oriTfinder / ): pCF2075-1 carries oriT (transfer origin site) and relaxase (relaxase) encoding genes, but does not carry T4CP (IV type companion protein) and T4SS (IV type) related genes, so the plasmid does not have the ability to self-transfer. SUMMARY

[0004] In view of this, the present invention provides fusion plasmids and their applications in gene transfer and protein expression. The present invention provides plasmids for transmitting drug resistance genes, said plasmids being derived from Salmonella. These plasmids can be used as vectors for transmitting the drug resistance gene NDM-13. Further plasmid conjugation transfer experiments showed that this plasmid can transfer the NDM-13 gene into Escherichia coli.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0006] This invention provides a fusion plasmid including IncI1 replicon, IncHI2 replicon, and IncHI2A replicon.

[0007] In some specific embodiments of the present invention, the fusion plasmid includes two IncHI2 replicons.

[0008] In some specific embodiments of the present invention, the fusion plasmid further includes a conjugation transfer module; the conjugation transfer module includes ori T, relaxant mobH, T4CP gene traD, and T4SS trh family genes.

[0009] In some specific embodiments of the present invention, the fusion plasmid further includes a drug resistance gene.

[0010] In some specific embodiments of the present invention, the drug resistance genes include aminoglycosides such as aadA2, aadA1, aac(3)-IVa, aph(4)-Ia, aph(3')-Ia, aph(6)-Id, aph(3”)-Ib, and aadA22; and beta-lactams such as bla NDM-13 bla TEM-1B blaOXA-10; bleomycin MBL One or more of the following: chloramphenicol cmlA1, cmlA5, floR; lincomycin lnu(F); rifamycin ar r-2; tetracycline tet(A); trimethoprim dfrA14; quinolone qnrS1; sulfonamide sul3; and quaternary ammonium qacL.

[0011] In some embodiments of the present application, the fusion plasmid has a nucleotide sequence as shown in SEQ ID NO. 13-SEQ ID NO. 14-SEQ ID NO. 15-SEQ ID NO. 16-SEQ ID NO. 17-SEQ ID NO. 18-SEQ ID NO. 19-SEQ ID NO. 20-SEQ ID NO. 21-SEQ ID NO. 22-SEQ ID NO. 23-SEQ ID NO. 24-SEQ ID NO. 25-SEQ ID NO. 26-SEQ ID NO. 27-SEQ ID NO. 28-SEQ ID NO. 29-SEQ ID NO. 30-SEQ ID NO. 31-SEQ ID NO. 32-SEQ ID NO. 33-SEQ ID NO. 34-SEQ ID NO. 35-SEQ ID NO. 36-SEQ ID NO. 37-SEQ ID NO. 38-SEQ ID NO. 39-SEQ ID NO. 40-SEQ ID NO. 41-SEQ ID NO. 42-SEQ ID NO. 43-SEQ ID NO. 44-SEQ ID NO. 45-SEQ ID NO. 46-SEQ ID NO. 47-SEQ ID NO. 48-SEQ ID NO. 49-SEQ ID NO. 50-SEQ ID NO. 51-SEQ ID NO. 52-SEQ ID NO. 53-SEQ ID NO. 54-SEQ ID NO. 55-SEQ ID NO. 56-SEQ ID NO. 57.

[0012] The present application also provides a biological material capable of transferring a functional gene, comprising the fusion plasmid.

[0013] The present application also provides a host comprising the fusion plasmid.

[0014] In some embodiments of the present application, the host comprises Escherichia coli and / or Salmonella.

[0015] The present application also provides the use of any of the following in the transfer of a gene and the expression of a protein:

[0016] (I) the fusion plasmid; and / or

[0017] (II) the biological material capable of transferring a functional gene; and / or

[0018] (III) the host.

[0019] In some embodiments of the present application, the transfer of the gene comprises transfer of a drug resistance gene to a recipient bacterium.

[0020] The present application also provides use of any of the following in vitro screening of an inhibitor of expression of a drug resistance gene or a drug for reversing drug resistance of a bacterial strain:

[0021] (I) the fusion plasmid; and / or

[0022] (II) the biological material of the transferable functional gene; and / or

[0023] (III) the host.

[0024] The present application provides the following advantages:

[0025] The present application discloses a novel IncI1 and IncHI2 / IncHI2A type autonomous transferable fusion plasmid containing NDM-13 and OXA-10 from a clinical Salmonella, which also carries other multiple drug resistance genes and exhibits resistance to multiple antibiotics. Salmonella is a pathogenic bacterium of zoonosis and has the ability to infect humans and livestock. Salmonella carrying the plasmid has the potential to cause outbreaks and epidemics, and therefore needs to be actively studied to prevent the occurrence of outbreaks and epidemics.

[0026] 1. The plasmid has two complete conjugative transfer modules (including oriT, relaxase mobH, T4CP gene traD and T4SS trh family gene), which have stronger conjugative transfer ability.

[0027] 2. Contains two drug resistance genes NDM-13 and one drug resistance gene OXA-10, which has high level of drug resistance. The MIC value of the strain carrying the plasmid to meropenem and imipenem is greater than 16.

[0028] 3. The plasmid is fused from two types of plasmids, which has the ability to cope with complex genetic environment and is more likely to survive and spread among strains. BRIEF DESCRIPTION OF DRAWINGS

[0029] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments or prior art description will be briefly introduced below.

[0030] Figure 1 Electrophoretogram of the carbapenem resistance Salmonella bla NDM , wherein 1 and 2 are PCR products, and M is a DNA marker;

[0031] Figure 2 Circular comparison between the plasmid pSAL22057-NDM13 and other reported plasmids;

[0032] Figure 3 Comparative genomic analysis of pSAL22057-NDM13 producing NDM-13 and other homologous plasmids based on wgSNP sequences is shown; *The numbers at the center of the phylogenetic tree represent the bootstrap value, used to assess the confidence of the phylogenetic tree branches, and only 70% to 100% of the results are shown in the figure. Detailed Implementation

[0033] This invention discloses fusion plasmids and their applications in gene transfer and protein expression. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired results. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0034] This invention isolates Salmonella from the stool of children with diarrhea, and drug susceptibility testing shows resistance to meropenem and imipenem. PCR and sequencing of the products reveal the production of the NDM-13 gene. Plasmid conjugation transfer experiments demonstrate that the Salmonella plasmid pSAL22057-NDM13 carrying the NDM-13 gene can autonomously transfer to Escherichia coli.

[0035] Sequencing was performed using the PacBio Sequel II (third-generation) platform and the Illumina NovaSeq 6000 (second-generation) platform. Large-fragment libraries (10–20 kb) and small-fragment libraries (~400 bp) were constructed from quality-tested DNA samples, and sequenced separately on different platforms to obtain raw data. Then, various assembly software programs were used to assemble the third-generation data individually or in combination with second-generation data. The final assembly results were then corrected using the second-generation data to obtain the final bacterial genome assembly. The complete plasmid sequence was ultimately obtained.

[0036] In addition to carrying the NDM-13 gene, the plasmids discovered in this study also carry multiple other drug resistance genes, such as: aminoglycosides aadA2, aadA1, aac(3)-IVa, aph(4)-Ia, aph(3')-Ia, aph(6)-Id, aph(3”)-Ib, and aadA22; and beta-lactams bla NDM-13 ,bla TEM-1B ,bla OXA-10 BleomycinMBL ; cmlAl, cmlA5, floR of phenicol; Inu(F) of lincomycin; arr-2 of rifamycin; tet(A) of tetracycline; dfrA14 of trimethoprim; qnrS1 of quinolone; sul3 of sulfonamide; and qacL of quaternary ammonium. These abundant drug resistance genes provide the plasmid with the ability to cope with a variety of antibiotic drugs.

[0037] The plasmid pSAL22057-NDM13 in the present application contains IncHI2(BX664015), IncHI2(BX664015), IncHI2A(BX664015) and IncIl-I (Alpha) (AP005147), which is an IncIl and IncHI2 / IncHI2A type fusion plasmid carrying NDM-13.

[0038] The plasmid in the present application contains a complete conjugative transfer module (including oriT, relaxase mobH (ORF1_97, AGS77392), T4 CP gene traD (ORDF_96, NP_052502) and T4SS trh family genes (ORF1_54, 58, 68, 69, 70, 71, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 94, 95, 96, 103)), which shows that the pSAL22057-NDM13 itself has conjugative transfer ability, so the pSAL22057-NDM13 is a conjugative plasmid and can be horizontally transferred. The conjugative transfer experiment also shows that the pSAL22057-NDM13 plasmid can be transferred autonomously into E. coli. The plasmid pSAL22057-NDM13 in the present application contains 2 NDM-13 genes.

[0039] oriT (SEQ ID NO: 12):

[0040] TCACTTCAGGCTCCTTACGGGGTGTCGGGGCGAAGCCCTGACCAGATGGTAATTGTAATAGC GTCGCGTGTGACGGTATTACAATTACACATCCTGTCCCGTTTTTCAGG

[0041] The nucleotide sequence of the plasmid pSAL22057-NDM13 of the application is (SEQ ID NO. 13-SEQ ID NO. 14-SEQ ID NO. 15-SEQ ID NO. 16-SEQ ID NO. 17-SEQ ID NO. 18-SEQ ID NO. 19-SEQ ID NO. 20-SEQ ID NO. 21-SEQ ID NO. 22-SEQ ID NO. 23-SEQ ID NO. 24-SEQ ID NO. 25-SEQ ID NO. 26-SEQ ID NO. 27-SEQ ID NO. 28-SEQ ID NO. 29-SEQ ID NO. 30-SEQ ID NO. 31-SEQ ID NO. 32-SEQ ID NO. 33-SEQ ID NO. 34-SEQ ID NO. 35-SEQ ID NO. 36-SEQ ID NO. 37-SEQ ID NO. 38-SEQ ID NO. 39-SEQ ID NO. 40-SEQ ID NO. 41-SEQ ID NO. 42-SEQ ID NO. 43-SEQ ID NO. 44-SEQ ID NO. 45-SEQ ID NO. 46-SEQ ID NO. 47-SEQ ID NO. 48-SEQ ID NO. 49-SEQ ID NO. 50-SEQ ID NO. 51-SEQ ID NO. 52-SEQ ID NO. 53-SEQ ID NO. 54-SEQ ID NO. 55-SEQ ID NO. 56-SEQ ID NO. 57, and due to the sequence listing preparation reason, the original SEQ ID NO. 1 sequence is split into SEQ ID NO. 13-SEQ ID NO. 14-SEQ ID NO. 15-SEQ ID NO. 16-SEQ ID NO. 17-SEQ ID NO. 18-SEQ ID NO. 19-SEQ ID NO. 20-SEQ ID NO. 21-SEQ ID NO. 22-SEQ ID NO. 23-SEQ ID NO. 24-SEQ ID NO. 25-SEQ ID NO. 26-SEQ ID NO. 27-SEQ ID NO. 28-SEQ ID NO. 29-SEQ ID NO. 30-SEQ ID NO. 31-SEQ ID NO. 32-SEQ ID NO. 33-SEQ ID NO. 34-SEQ ID NO. 35-SEQ ID NO. 36-SEQ ID NO. 37-SEQ ID NO. 38-SEQ ID NO. 39-SEQ ID NO.40 - SEQ ID NO. 41 - SEQ ID NO. 42 - SEQ ID NO. 43 - SEQ ID NO. 44 - SEQ ID NO. 45 - SEQ ID NO. 46 - SEQ ID NO. 47 - SEQ ID NO. 48 - SEQ ID NO. 49 - SEQ ID NO. 50 - SEQ ID NO. 51 - SEQ ID NO. 52 - SEQ ID NO. 53 - SEQ ID NO. 54 - SEQ ID NO. 55 - SEQ ID NO. 56 - SEQ ID NO. 57, the specific sequence information is shown in the sequence listing).

[0042] >Sal-Plas (363,671 base pairs)

[0043]

[0044] Unless otherwise specified, the raw materials and reagents used in the fusion plasmid provided by the application and its application in gene transfer and protein expression can be purchased from the market.

[0045] The application will be further described below in conjunction with examples:

[0046] Example 1 Screening of carbapenemase-resistant Salmonella resistant genes

[0047] 1. Isolation of Salmonella strain

[0048] A small amount of fecal sample was smeared on SS culture medium, and the streak was divided into zones. The culture was incubated at 37°C for 18-24h, and the hydrogen sulfide-producing strain was preliminarily screened. The species was identified by MALDI-TOF mass spectrometer and identified as Salmonella.

[0049] The single colonies of different morphologies on the above culture medium were picked and inoculated on the culture medium to purify the bacteria, and then transferred to LB culture medium for purification.

[0050] The purified bacteria (Salmonella SAL22057) were stored in a bacterial liquid storage tube and stored at -80°C.

[0051] 2. In vitro drug sensitivity test of Salmonella strain

[0052] The in vitro drug sensitivity test was performed according to the standard method of the 2020 American Clinical and Laboratory Standardization Committee (Clinical and Laboratory Standards Institute, CLSI) guidelines. The antibiotics determined included amoxicillin-clavulanic acid, piperacillin-tazobactam, cefotaxime, ceftazidime, cefepime, cefoperazone, meropenem, imipenem, amikacin, levofloxacin, ciprofloxacin, trimethoprim / sulfamethoxazole, tigecycline and polymyxin B. Escherichia coli ATCC25922 was used as a quality control strain.

[0053] The results showed (see Table 1) that Salmonella SAL22057 was resistant to meropenem and imipenem.

[0054] Table 1 In vitro drug sensitivity test of Salmonella strain

[0055]

[0056] 3. Screening of carbapenemase-resistant Salmonella resistant genes

[0057] We detected bla NDM , bla KPC , bla IMP , bla VIM and bla OXA-48The isocarbamycin-resistant gene, and the primers of each gene are shown in Table 2 below.

[0058] Table 2 Primer sequences for amplifying drug-resistant genes

[0059]

[0060] (1) Preparation of DNA template

[0061] The DNA of the purified Salmonella was extracted using an Ezup column bacterial genomic DNA extraction kit.

[0062] DNA quality detection:

[0063] 5 μL of the DNA solution was taken, 1% agarose, 1X TAE buffer solution was electrophoresed (voltage 120-180V) for detection, a single band indicated that the DNA was complete and not degraded, and a clear band indicated that the concentration could meet the requirements of PCR.

[0064] The concentration and purity were detected by spectrophotometer, 1 μL was taken for OD value detection, OD260 / 280 was 1.7-2.0, indicating that the DNA quality was good, less than 1.7 had protein contamination, and more than 2.0 had RNA contamination. Generally, a small amount of protein and RNA contamination did not affect ordinary PCR.

[0065] (2) The PCR reaction system is shown in Table 3.

[0066] Table 3 PCR reaction system

[0067]

[0068] (3) The PCR reaction conditions are shown in Table 4.

[0069] Table 4 PCR reaction conditions

[0070]

[0071]

[0072] (4) Electrophoresis detection band

[0073] 5 μL of the PCR product was taken for 1% agarose gel electrophoresis, and the electrophoresis parameters were 150V, 100mA, 10-20min electrophoresis observation.

[0074] The size of the PCR product detected by electrophoresis is shown in Figure 1 .

[0075] (5) Sequencing

[0076] PCR product purification and recovery: the target PCR band was cut and recovered, and the method was seen in SanPrep column DNA gel recovery kit (Shengwo B518131).

[0077] Data analysis: find results in result group and analyze with sequence analysis software.

[0078] The sequence of the PCR product sequencing is as follows, the BLAST result shows NDM-13, and the nucleotide sequence is shown as SEQ ID NO. 11:

[0079] CCTCGCATTTGCGGGGTTTTTAATGCTGAATAAAAGGAAAACTTGATGGAATTGCCCAATATTATGCACCCGGTCGCGAAGCTGAGCACCGCATTAGCCGCTGCATTGATGCTGAGCGGGTGCATGCCCGGTGAAATCCGCCCGACGATTGGCCAGCAAATGGAAACTGGCGACCAACGGTTTGGCGATCTGGTTTTCCGCCAGCTCGCACCGAATGTCTGGCAGCACACTTCCTATCTCGACATGCCGGGTTTCGGGGCAGTCGCTTCCAACGGTTTGATCGTCAGGGATGGCGGCCGCGTGCTGGTGGTCGATACCGCCTGGACCAATGACCAGACCGCCCAGATCCTCAACTGGATCAAGCAGGAGATCAACCTGCCGGTCGCGCTGGCGGTGGTGACTCACGCGCATCAGGACAAGATGGGCGGTATGGACGCGCTGCATGCGGCGGGGATTGCGACTTATGCCAATGCGTTGTCGAACCAGCTTGCCCCGCAAGAGGGGCTGGTTGCGGCGCAACACAGCCTGACTTTCGCCGCCAATGGCTGGGTCGAACCAGCAACCGCGCCCAACTTTGGCCCGCTCAAGGTATTTTACCCCGGCCCCGGCCACACCAGTGACAATATCACCGTTGGGATCGACGGCACCGACATCGCTTTTGGTGGCTGCCTGATCAAGGACAGCAAGGCCAAGTCGCTCGGCAATCTCGGTGATGCCGACACTGAGCACTACGCCGCGTCAGCGCGCGCGTTTGGTGCGGCGTTCCCCAAGGCCAGCATGATCGTGATGAGCCATTCCGCCCCCGATAGCCGCGCCGCAATCACTCATACGGCCCGCATGGCCGACAAGCTGCGCTGAGCCATGGCTGACCACGTCACCCCCAATCTGCCATCGCGCGAExample 2 Whole genome sequencing and bioinformatics analysis of bacteria

[0080] 1. Extraction of bacterial genome

[0081] The bacterial genome was extracted according to the instruction of QIAGEN Puregene R Yeast / Bact. Kit B.

[0082] (1) The single Salmonella SAL22057 isolated in Example 1 was inoculated in LB liquid medium and incubated overnight.

[0083] (2) The above liquid was mixed by blowing with a sample gun, 500 μL of which was taken into a 1.5 mL centrifuge tube and placed on ice.

[0084] (3) The sample was centrifuged at 13,000-16,000 x g for 5 s, and the supernatant was discarded.

[0085] (4) 300 μL of Cell Lysis Solution was added, and the sample was mixed by blowing with a sample gun back and forth. The sample was placed in a water bath at 80°C for 5 min.

[0086] (5) 1.5 μL of RNase A Solution was added, and the sample was inverted 25 times and placed in a water bath at 37°C for 15-60 min.

[0087] (6) The sample was taken out and quickly placed on ice for 1 min to cool the sample quickly.

[0088] (7) 100 μL of Protein Precipitation Solution was added, and the sample was vortexed at high speed for 20 s.

[0089] (8) The sample was centrifuged at 13,000-16,000 x g for 3 min.

[0090] (9) A new 1.5 mL centrifuge tube was taken, 300 μL of isopropanol was added, and the supernatant after centrifugation in (8) was mixed by inverting 50 times.

[0091] (10) The sample was centrifuged at 13,000-16,000 x g for 1 min. Then, the supernatant was carefully discarded, the centrifuge tube was inverted on a clean paper towel, and the moisture in the centrifuge tube was absorbed.

[0092] (11) 300 μL of 70% ethanol was added, and the DNA precipitate was washed by inverting several times.

[0093] (12) The sample was centrifuged at 13,000-16,000 x g for 1 min. The supernatant was discarded, the centrifuge tube was inverted on a clean paper towel, and the moisture in the centrifuge tube was absorbed. The sample was dried in air for 5 min.

[0094] (13) 100 μL of DNA Hydration Solution was added, and the sample was vortexed for 5 s.

[0095] (14) Place at 65°C for 1 h incubation.

[0096] (15) Place at 25°C ± 5°C for overnight incubation on a shaker. Note: Ensure that the tube cap is tightly closed to prevent leakage.

[0097] (16) Simply centrifuge the sample to let the tube cap liquid down. Store at -80°C.

[0098] 2. Sequencing and assembly of bacterial genomes

[0099] (1) The extracted bacterial DNA was sent to Beijing Novogene Sci-Tech Co., Ltd. for second-generation sequencing on the Illumina HiSeq4000-PE150 platform and third-generation sequencing on the PacBio RS II platform.

[0100] (2) After sequencing, each bacterial sample obtained a large number of paired-end fragments of about 150 bp.

[0101] (3) In this study, low-quality sequence fragments were first filtered out by quality control of Novogene pipeline, and then the filtered sequence fragments were spliced (except L683 and L725) using SPAdes 3.10.0 and Velvet 1.2.10 software to assemble contigs containing bacterial whole genome information. At the same time, SPAdes 3.11.1 software was used to mix and splice the second-generation and third-generation data of L683 and L725 Illumina platform sequencing reads and PacBio platform sequencing reads to obtain complete gene data.

[0102] The BLAST alignment results showed that the NDM-13 gene was located in the Plas1 plasmid, named pSAL22057-NDM13.

[0103] Table 5 p22057-NDM13 plasmid analysis

[0104]

[0105] The plasmid pSAL22057-NDM13 carries four plasmid replicons, including IncHI2, IncHI2, IncHI2A and IncI1-I (Alpha). Therefore, pSAL22057-NDM13 is a conjugative plasmid.

[0106] BLAST results (see Table 5) showed that pSAL22057-NDM13 had 98.9% similarity to pMR0716 from Escherichia coli, with a coverage rate of 32.7%; 99.9% similarity to pHS13-1-IncHI2 from Escherichia coli, with a coverage rate of 62.7%; and 99.8% similarity to pCFSA664- from Escherichia coli, with a coverage rate of 55.2%. pSAL22057-NDM13 is 363,671 bp in length and has a GC content of 48.20%. Predictions showed that the plasmid carried a variety of drug resistance genes, including aminoglycosides such as aadA2, aadA1, aac(3)-IVa, aph(4)-Ia, aph(3')-Ia, aph(6)-Id, aph(3”)-Ib, and aadA22; and beta-lactams such as bla. NDM-13 ,bla TEM-1B ,bla OXA-10 Bleomycin MBL The plasmid contains numerous resistance genes, including cmlA1, cmlA5, and floR for phenicol; lnu(F) for lincomycin; arr-2 for rifamycin; tet(A) for tetracycline; dfrA14 for trimethoprim; qnrS1 for quinolone; sul3 for sulfonamide; and qacL for quaternary ammonium. These abundant resistance genes provide the SAL22057 strain with the ability to resist a variety of antibiotics. Therefore, we consider p22057-NDM13 to be a novel plasmid carrying resistance genes.

[0107] Further analysis showed that the 1-111,509 bp sequence of pSAL22057-NDM13 (first gene ardA to ΔIS1294) is highly similar to the complete plasmid sequences of E. coli plasmid pHNAHS65I-1 (MN219406) and S. enterica plasmid pNDM13-SR33 (CP092912), psg_wt5 (CP037994) (coverage > 91%, identity > 99.71%) (representing the homology of this region only). We named this region Plasmid Homologous Region 1 (representing the segment homologous to the first type of plasmid). They all have the same plasmid stabilization region, as well as the conjugative transfer module (including oriT, relaxase nikB, T4 CP gene trbC, and T4SS tra family genes). Similarly, the 111,510-363,491 bp sequence of pSAL22057-NDM13 (both ends are hypothetical protein) is homologous to E. coli plasmid pSJ_255 (CP011062), pLH30-mcr1 (CM008265), p2474-MCR1 (CP021209), pSTEC636_1 (CP061213), pNDM33-1 (MN915011), and S. enterica plasmid p81741-unnamed1 (CP019443), which we call Plasmid Homologous Region 2. Based on the alignment and preliminary analysis of the plasmid sequence of pSAL22057-NDM13, we found that this plasmid is a completely new plasmid composed of two different types of plasmids.

[0108] Example 3 Plasmid conjugation transfer experiment

[0109] Plasmid carrying bla NDM-13 Gene conjugation transfer experiment

[0110] (1) Single colonies of Salmonella SAL22057 and recipient bacteria E. coli 600 were streaked on MHA medium.

[0111] (2) A single colony was picked with a disposable inoculation loop and inoculated into 2 ml of LB liquid medium, and placed in a shaking incubator at 37°C, 180 r / min, and cultured for 6-8 h to the logarithmic growth phase of the bacteria.

[0112] (3) 300 μL of LB liquid containing recipient bacteria and 600 μL of LB liquid containing donor bacteria were taken with a syringe and mixed well in a centrifuge tube.

[0113] (4) Take the mixed solution and add it to 4 mL of LB liquid medium, and place it in a shaking incubator at 37°C, 180 r / min, and cultivate for 12 h.

[0114] (5) Take 100 μL of the liquid in (4) and apply it to a drug plate using an L-shaped swab until the bacterial solution is completely absorbed. Note: The drug plate is prepared by adding MHA medium and the corresponding drug, which is rifampicin (200 mg / L) drug plate, meropenem (2 mg / L), and double drug plate (200 mg / L rifampicin and 2 mg / L meropenem).

[0115] (6) Pick a single colony growing on the double drug plate and re-inoculate it on a new double drug plate. Identify the species of the bacteria by MALDI-TOF MS, and identify whether it carries the bla NDM gene by PCR reaction and agarose gel electrophoresis.

[0116] (7) The E. coli 600-pSA L22057-NDM13 carrying the bla NDM gene identified in (6) is the successful conjugant of the plasmid transfer conjugation, and is stored in a bacterial preservation tube at -80°C.

[0117] Table 6 Preliminary screening criteria for plasmid transfer conjugation test

[0118]

[0119] The results of the plasmid conjugation transfer experiment show that the recipient bacteria E. coli C600 and E. coli 600-pSA L22057-NDM13 both meet the preliminary screening criteria for plasmid conjugation experiments. MALDI-TOF MS identification shows that the conjugant E. coli 600-pSA L22057-NDM13 is E. coli, and PCR amplification technology detection shows that the conjugant E. coli 600-pSA L22057-NDM13 carries the bla NDM-13 gene. Salmonella carrying the plasmid pSA L22057-NDM13 with the bla ND M-13 gene can be transferred autonomously to other bacteria, and the frequency of conjugation transfer is about 1.67 x 10 -2 .

[0120] Example 4 Construction and beautification of plasmid phylogenetic tree

[0121] The mapping of the screened homologous plasmid genomic sequences to the reference genome pSAL22057-NDM13, due to the large difference between the two types of plasmids, here we extracted wgSNP sequences, based on ML method to construct phylogenetic tree. The constructed phylogenetic tree was annotated and beautified using iTOL, the annotated information was the replicon type of each plasmid. With homologous plasmid as reference sequence, software: kSNP3, method: ML. Plasmid replicon prediction, software: Pathogenwatch.

[0122] Result interpretation:

[0123] Phylogenetic analysis Figure 3 ) showed that the homologous plasmids of pSAL22057-NDM13 were mainly divided into two types, one carried IncI1-I(Alpha) replicon, corresponding to Plasmid Homologous Region1, the other carried IncHI2 / IncHI2A replicon, corresponding to Plasmid Homologous Region2. A few plasmids such as pLH1-mcr1, pSJ-255 may also carry other replicons (IncFIB(K), IncN), it is speculated that these homologous plasmids may have undergone recombination integration with other types of plasmids. This is consistent with our previous results. pNDM-TJ33 is the only homologous plasmid in the reference sequence that carries IncI1-I(Alpha), IncHI2, IncHI2A three types of replicon. After comparison, we found that pNDM-TJ33 has high similarity with our pSAL22057-NDM13 plasmid, it also contains IncI1-I(Alpha) and IncHI2 / IncHI2A type plasmid replicon fusion plasmid, however, there are still some differences in genomic sequences between the two. More importantly, pNDM-TJ33 is reported to be a fusion plasmid formed by conjugation transfer experiment, while our pSAL22057-NDM13 is derived from clinical samples, to our knowledge, this is the first time to find IncI1 and IncHI2 / IncHI2A type fusion plasmid harboring bla NDM NDM-1 in Salmonella from clinical isolates.

[0124] The fusion plasmid can play an important role in the following aspects: (1) genetic engineering research: it can be used as a vector in genetic engineering research and play an important role in transfection or transformation experiments. Researchers can insert the genes they want to study into the fusion plasmid, then transfer the fusion plasmid to the target bacteria to achieve the expression and study of the target genes. (2) Biotechnology production: the stability and transferability of the fusion plasmid make it an important tool that can be used in the field of biotechnology, such as biomedicine manufacturing, enzyme engineering, protein expression, etc. (3) Environmental remediation: the fusion plasmid can be designed for environmental remediation, such as treating harmful substances in contaminated soil or water. The fusion plasmid can carry specific genes to help bacteria degrade toxic compounds and play a role in environmental governance.

[0125] The above is only the preferred embodiment of the present application, it should be noted that for those skilled in the art, without departing from the principles of the present application, can make several improvements and refinements, these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. A fusion plasmid, characterized in that, It includes IncI1 replicon, IncHI2 replicon, IncHI2A replicon, conjugation transfer module, and drug resistance gene; the conjugation transfer module includes oriT, relaxase mobH, T4CP gene traD, and T4SS trh family genes. The fusion plasmid has the following structure: SEQ ID NO.13-SEQ ID NO.14-SEQ ID NO.15-SEQ ID NO.16-SEQ ID NO.17-SEQ ID NO.18-SEQ ID NO.19-SEQ ID NO.20-SEQ ID NO.21-SEQ ID NO.22-SEQ ID NO.23-SEQ ID NO.24-SEQ ID NO.25-SEQ ID NO.26-SEQ ID NO.27-SEQ ID NO.28-SEQID NO.29-SEQ ID NO.30-SEQ ID NO.31-SEQ ID NO.32-SEQ ID NO.33-SEQ ID NO.34-SEQID NO.35-SEQ ID NO.36-SEQ ID NO.37-SEQ ID NO.38-SEQ ID NO.39-SEQ ID NO.40-SEQID NO.41-SEQ ID NO.42-SEQ ID NO.43-SEQ ID NO.44-SEQ ID NO.45-SEQ ID NO.46-SEQID The nucleotide sequences shown are NO.47-SEQ ID NO.48-SEQ ID NO.49-SEQ ID NO.50-SEQ ID NO.51-SEQ ID NO.52-SEQ ID NO.53-SEQ ID NO.54-SEQ ID NO.55-SEQ ID NO.56-SEQ ID NO.

57.

2. A biomaterial capable of transferring functional genes, characterized in that, Includes the fusion plasmid as described in claim 1.

3. The host, characterized in that, Includes the fusion plasmid as described in claim 1.

4. The host as described in claim 3, characterized in that, The host includes Escherichia coli and / or Salmonella.

5. The application of any of the following in gene transfer and protein expression: (I) The fusion plasmid as described in claim 1; and / or (II) Biomaterials with transferable functional genes as described in claim 2; and / or (III) The host as described in claim 3 or 4.

6. The application as described in claim 5, characterized in that, The transfer of the genes includes the transfer of drug resistance genes to recipient bacteria.

7. The following are applications in in vitro screening of drug resistance gene expression inhibitors or drugs for reversing drug resistance in bacterial strains: (I) The fusion plasmid as described in claim 1; and / or (II) Biomaterials with transferable functional genes as described in claim 2; and / or (III) The host as described in claim 3 or 4.

Images