Method for promoting plant growth and development and enhancing plant growth under nutrient deficiency condition by knocking out plant PUKI gene

Abstract

The invention discloses a method for knocking out a PUKI gene of a plant to promote plant development and enhance plant growth under the condition of nutrition deficiency. The invention emphatically elaborates the regulation and control application of the knockout plant source PUKI gene on the growth of overground tissues and roots under the conditions of normal plants and nutrition deficiency. After the PUKI gene in the plant is knocked out, the growth of aboveground tissues and root systems of the plant is superior to that of a wild type. According to the PUKI gene deletion mutant strain, under the culture conditions that nitrogen, phosphorus and potassium are independently deleted and three nutrient elements are simultaneously deleted, the plant aboveground tissue and root development advantages are more remarkable. The purpose of promoting the overall growth of the plant is achieved by knocking out the PUKI gene in the plant, meanwhile, the gene can be applied to a barren land area, and brand new target genes and materials are provided for cultivation of high-quality reverse crop varieties.

Description

Technical Field

[0001] The invention relates to a method for knocking out a PUKI gene of a plant to promote plant growth and development and to enhance plant growth under nutrient deficiency conditions, and belongs to the field of gene application. Background Art

[0002] Pseudouracil is one of the most common RNA modifications in cells and exists in various types of RNA, including mRNA, tRNA, rRNA, snRNA and snoRNA. As a post-transcriptional modification mechanism, pseudouracil can affect the structure, function, location and half-life of RNA, thereby regulating gene expression. It is reported that the expression regulation of some genes in plants may depend on pseudouracil modification and affect the growth and development process of plants, such as root development, leaf morphology, flowering and fruit ripening. The metabolic pathway of pseudouracil is completed by pseudouracil kinase (PUKI) and pseudouracil nucleotide hydrolase (PUMY). It can be seen that the PUKI gene is particularly important for the regulation of plant growth and development, but there are relatively few studies on this.

[0003] As one of the most important food crops in my country, the production and development of rice plays a vital role in ensuring food security in my country and even the world. Root development plays a decisive role in the effective absorption of water and various mineral nutrients, such as nitrogen, phosphorus, and potassium by rice, providing sufficient material basis to ensure the normal growth and development of rice plants. The demand for a large number of nutrients such as nitrogen, phosphorus, and potassium during rice growth is extremely large, but in reality, not all land can provide sufficient nitrogen, phosphorus, and potassium nutrients. In this context, cultivating rice varieties with excellent adaptability has become a top priority. In-depth exploration of plant stress tolerance genes can provide important ideas for solving this nutrient supply problem. Summary of the invention

[0004] Purpose of the invention: The technical problem to be solved by the present invention is to provide a method for knocking out the PUKI gene of a plant to promote plant growth and development and to enhance plant growth under conditions of nutrient deficiency.

[0005] Technical solution: To solve the above technical problems, the present invention provides the use of knocking out the PUKI gene of a plant in promoting plant growth and development.

[0006] Wherein, the plant includes Arabidopsis thaliana or rice.

[0007] The gene number of the PUKI gene is AT1G49350 (Arabidopsis thaliana) or LOC_Os05g09370 (Rice).

[0008] The present invention also provides the use of PUKI gene in regulating the growth and development of plants under the culture condition of lack of nutrient elements.

[0009] Wherein, the nutrient elements include one or more of nitrogen, phosphorus or potassium.

[0010] This includes promoting plant growth and development.

[0011] Among them, plant growth and development are promoted by knocking out the PUKI gene of the plant.

[0012] Wherein, the gene number of the PUKI gene is AT1G49350 or LOC_Os05g09370.

[0013] Among them, the knockout of the Arabidopsis PUKI gene is used in the regulation of root development under normal and nutrient-deficient culture conditions. The Atpuki mutant and wild-type plants are cultured under normal and nutrient-deficient culture conditions. The nucleotide sequence of the AtPUKI gene is shown in SEQ ID No.1, and the amino acid sequence of the protein encoded by it is shown in SEQ ID No.2.

[0014] SEQ ID No.1 (wherein capital letters represent CDS sequence):

[0015]

[0016] SEQ ID No.2:

[0017] MEPVIIGALILDVHAKPSTTPISGTTVPGQVLFAPGGVARNVADCIFKLGITPFMIGTLGLDGPANVLLKEWKLSMKGILRREDISTPIVSLVYDTNGEVAAGVAGVDAVENFLTPEWIQRFEYNISSARLLMVDANLSSLALEASCKLAAESSVPVWFEPVSVTKSQRIASIAKYVTIVSPNQDELIA MANALCAKNLFHPFRSDENKLSIEDMFRALKPAILVLLKNGVKVVIVTLGSNGALLCSKGNPKKALNIDRKFLRSGEVFKRVQSVCSPNRFSELGSNRSPSLFAMHFPTIPAKVKKLTGAGDCLVGGTVASLSDGLDLIQSLAVGIASAKAAVESDDNVPPEFKLDLISGDAELVYNGAKMLMVHQSML

[0018] The application of knocking out the rice PUKI gene to regulating the growth and development of plant aboveground tissues and / or roots under normal and nutrient-deficient culture conditions is as follows: the specific method is to knock out the rice PUKI gene to obtain an Ospuki mutant, and the Ospuki mutant and wild-type plants are cultured under normal and nutrient-deficient culture conditions. The nucleotide sequence of the OsPUKI gene is shown in SEQ ID No.3, and the amino acid sequence of the protein encoded by it is shown in SEQ ID No.4.

[0019] SEQ ID No.3 (wherein capital letters represent CDS sequence):

[0020]

[0021] SEQ ID No.4:

[0022] MAGATTTSPLRRMESVCRHLLPASPPILYQNPLGAIRLESSPVIIGGMVLDIHAKPSMQPHPGTTVPGMVKYVSGGVARNIAECICKLETRPFMISVGNDMAGDFLLKYWRSAGLCTDGILQIDDVTTPIVSNVFDGSGELIAGVASVGAVEKFLSPSWICQFRLHISTAPLLMLDANLSPDSLEAACKIAHESGVPVFFEPVSLAKG SRIAPIAKYITYTSPNEIELVAMANSLSPPEKYTFVKMEQSKNKAKAVEYLFEMLSPAMFFLLEKGIKFLLVTLGSNGVFVCCKESTSLMDQRKSEMMSFSTPLLQKLERCFPSNMLVDLPREGSSRTCVFHFPAVSASVVSLTGAGDCFVGGVISALCGGLGMMQSVAVGIAIAKSSVESEANIPDKFSAATIADDARRTLLSAKMMWCK

[0023] Wherein, the promoting plant growth and development includes promoting the growth of plant above-ground tissues and / or root systems.

[0024] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: compared with wild-type plant materials, the PUKI gene knockout plants in the present invention perform better in the growth and development process, especially under conditions of nitrogen, phosphorus and potassium deficiency, the above-ground tissue and root development advantages of the material are more significant, and it can be applied to the growth of land-poor areas. The present invention not only provides a new gene resource for crop variety improvement, but also opens up new ideas for the cultivation of stress-tolerant crops, showing great application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 It is a sequence alignment diagram of plant-derived PUKI genes;

[0026] Figure 2 The root length phenotype changes between Arabidopsis PUKI gene loss-of-function mutants and wild-type plants under normal culture conditions; a is the developmental phenotype comparison of the plants, and b is the line chart of root elongation; WT is the wild type, Atpuki-1 and Atpuki-2 are both Arabidopsis PUKI gene loss-of-function mutants; asterisks indicate significant differences (analysis of variance; *p value less than 0.05);

[0027] Figure 3 The root length phenotype changes of Arabidopsis PUKI gene loss-of-function mutants and wild-type plants under phosphorus deficiency culture conditions; a is the developmental phenotype comparison of plant roots, and b is the line chart of seedling root elongation; WT is the wild type, Atpuki-1 and Atpuki-2 are both Arabidopsis PUKI gene loss-of-function mutants; asterisks indicate significant differences (analysis of variance; *p value less than 0.05);

[0028] Figure 4 Comparison of root development phenotypes between wild type and PUKI gene loss-of-function mutant rice; a is a comparison of root development phenotypes, and b is a line chart of the elongation of seedling root development; asterisks indicate significant differences (analysis of variance; *p value less than 0.05);

[0029] Figure 5 The development of wild-type and PUKI gene function-deficient mutant rice plants under phosphorus-deficient culture conditions, a is the comparison of plant development phenotypes, b is the relative elongation of the root system, and c is the relative growth of plant height; asterisks indicate significant differences (analysis of variance; **p value less than 0.01);

[0030] Figure 6 The development of wild-type and PUKI gene loss-of-function mutant rice plants under nitrogen deficiency culture conditions, a is the comparison of plant development phenotypes, b is the relative elongation of the root system, and c is the relative growth of plant height; asterisks indicate significant differences (analysis of variance; **p value less than 0.01);

[0031] Figure 7 The development of wild-type and PUKI gene function-deficient mutant rice plants under potassium deficiency culture conditions, a is the comparison of plant development phenotypes, b is the relative elongation of the root system, and c is the relative growth of plant height; asterisks indicate significant differences (analysis of variance; **p value less than 0.01);

[0032] Figure 8 Figure 2 shows the development of wild-type and PUKI gene loss-of-function mutant rice plants under nitrogen, phosphorus and potassium deficiency conditions. a is the comparison of plant development phenotypes, b is the relative elongation of the root system, and c is the relative growth of plant height. Asterisks indicate significant differences (analysis of variance; **p value less than 0.01). DETAILED DESCRIPTION

[0033] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0034] Unless otherwise specified, the experimental methods used in the following experimental examples are all conventional methods; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0035] PUKI gene deletion mutants include Arabidopsis PUKI gene deletion mutants and rice PUKI gene deletion mutants.

[0036] The Arabidopsis Atpuki mutants SALK_006361 (Atpuki-1) and SAIL_647C12 (Atpuki-2) used in the present invention are from the Nottingham Arabidopsis Stock Center, the rice PUKI gene knockout target sequence is SEQ ID NO.5: ACAGACTCCATCCTCCGCAGGGG, and the rice PUKI gene deletion mutant (Ospuki) was ordered from BioGene Technology (Jiangsu) Co., Ltd., with the germplasm number BG110392C07.

[0037] The present invention uses sodium hypochlorite to disinfect seeds.

[0038] The present invention uses different plant nutrient solutions to cultivate rice plants. The normal nutrient solution formula is shown in Table 1. The composition of the nutrient-deficient nutrient solution: the normal nutrient solution lacks KH 2 PO 4 , and obtain a nutrient solution lacking P element; replace KNO 3 Replaced by NH 4 NO 3 , and obtain a nutrient solution lacking K element; based on the normal nutrient solution, KNO is missing 3 , and obtain a nutrient solution lacking N element; based on the normal nutrient solution, KH 2 PO 4 With KNO 3 , and obtain a nutrient solution lacking all three elements K, P, and N. The solid culture medium used for Arabidopsis thaliana culture needs to add 8% agar to the above nutrient solution and sterilize at 121°C before use.

[0039] Table 1

[0040]

[0041]

[0042] The present invention uses SPSS software to perform variance analysis on the root system and plant height growth of rice and Arabidopsis.

[0043] Example 1: Comparative analysis of PUKI gene sequences among different plants

[0044] The Arabidopsis thaliana AtPUKI gene used in the present invention was obtained from the Tair website (https: / / www.arabidopsis.org / ), and the gene number is: AT1G49350. The protein sequence of AtPUKI was used as bait, and blast was performed on the Phytozome website (https: / / phytozome-next.jgi.doe), the search results of plant sources were selected and the sequences were downloaded, and the sequences were aligned using the online sequence alignment website (https: / / www.ebi.ac.uk / jdispatcher / msa / clustalo), and the alignment results were displayed using Jalview software, as shown in FIG. Figure 1 shown.

[0045] Example 2: Application of Arabidopsis thaliana (variety: Columbia (Col)) PUKI gene deletion in regulating plant growth and development under normal culture conditions

[0046] The present invention uses 10% sodium hypochlorite to disinfect the surface of Arabidopsis seeds of wild type (WT) and PUKI gene deletion mutants (Atpuki-1, Atpuki-2), respectively. After disinfection for 10 minutes, the seeds are rinsed with sterile water 3-5 times to remove the disinfectant. The seeds are planted in a solid culture medium, vernalized at 4°C for two days, and then placed in a light incubator for light culture (light / darkness is 16 / 8 hours). After 5 days, plants with consistent root lengths are selected and transferred to a new solid culture medium for continued culture, and the root elongation is recorded. The results show that the root elongation of the PUKI gene deletion mutant is significantly higher than that of the wild type ( Figure 2 ), indicating that the PUKI gene deletion promotes the growth and development of Arabidopsis roots.

[0047] Example 3: Application of Arabidopsis PUKI gene deletion in regulating plant growth and development under phosphorus-deficient culture conditions

[0048] The wild-type (WT) and PUKI gene deletion mutants (Atpuki-1, Atpuki-2) Arabidopsis seedlings with the same growth potential were transferred to a solid medium lacking only the P element (the normal nutrient solution in Table 1 was reduced in KH 2 PO 4 The results showed that the root elongation of the PUKI gene deletion mutant was significantly higher than that of the wild type ( Figure 3 ), indicating that the PUKI gene deletion promotes the growth and development of Arabidopsis plants under low-phosphorus culture conditions.

[0049] Example 4: Application of PUKI gene deletion in regulating growth and development of rice (variety: Zhonghua 11, ZH11)

[0050] Select rice seeds of the wild type (Zhonghua 11) and the PUKI gene deletion mutant (Ospuki) with full grains and uniform size, disinfect them with 30% sodium hypochlorite solution, rinse them repeatedly with sterile water 4-5 times, and place them in a moist culture dish. The culture dish is placed in a lighted culture room to wait for germination. During this period, the rice seeds are rinsed with deionized water every day to keep the culture dish clean and moist. After the buds germinate, use tweezers to move the seedlings with good development, similar growth, and uniform root length in the culture dish to a culture box for further cultivation. Add 1L of normal nutrient solution in Table 1 to the culture box, and replace the culture solution every 3 to 4 days. Record the elongation of the root system every day. The results showed that under normal culture conditions, the root length of Ospuki rice was significantly longer than that of wild-type rice ( Figure 4 ), indicating that PUKI gene deletion also plays an important role in the growth and development of rice plants.

[0051] Example 5: Application of PUKI gene deletion in regulating rice growth and development under phosphorus deficiency conditions

[0052] The experimental method is the same as that of Example 4, wherein the KH in the formula is not added to the normal nutrient solution in Table 1. 2 PO 4 The results showed that under phosphorus-deficient culture conditions, the root length and plant height of Ospuki rice were significantly higher than those of wild-type rice ( Figure 5 ), indicating that PUKI gene deletion plays an important regulatory role in the growth and development of rice plants under phosphorus deficiency conditions.

[0053] Example 6: Application of PUKI gene deletion in regulating rice growth and development under potassium deficiency conditions

[0054] The experimental method is the same as that of Example 4, wherein the KNO in the normal nutrient solution of Table 1 is 3 Replaced by NH 4 NO 3 The results showed that under potassium-deficient culture conditions, the root length and plant height of Ospuki rice were significantly higher than those of wild-type rice ( Figure 6 ), indicating that PUKI gene deletion plays an important regulatory role in the growth and development of rice plants under potassium deficiency conditions.

[0055] Example 7: Application of PUKI gene deletion in regulating rice growth and development under nitrogen deficiency conditions

[0056] The experimental method is the same as that of Example 4, wherein the normal nutrient solution in Table 1 is not added with KNO 3 The results showed that under nitrogen deficiency conditions, the root length and plant height of Ospuki rice were significantly higher than those of wild-type rice ( Figure 7), indicating that PUKI gene deletion plays an important regulatory role in the growth and development of rice plants under nitrogen deficiency conditions.

[0057] Example 8: Application of PUKI gene deletion in regulating rice growth and development under conditions of potassium, nitrogen and phosphorus deficiency

[0058] The experimental method is the same as that of Example 4, wherein KH is not added to the normal nutrient solution in Table 1. 2 PO4 and KNO 3 The results showed that under the conditions of potassium, nitrogen and phosphorus deficiency, the root length and plant height of Ospuki rice were still significantly higher than those of wild-type rice ( Figure 8 ), indicating that the PUKI gene deletion plays an important regulatory role in the growth and development of rice plants under the culture conditions of potassium, nitrogen and phosphorus deficiency.

Claims

1. Application of knocking out the PUKI gene in plants to promote plant growth and development.

2. The application according to claim 1, characterized in that: The plant includes Arabidopsis thaliana or rice.

3. The application according to claim 1, characterized in that: The gene number of the PUKI gene includes AT1G49350 or LOC_Os05g09370.

4. Application of PUKI gene in regulating the growth and development of plants under nutrient-deficient culture conditions.

5. The use according to claim 4, characterized in that: The nutrient elements include one or more of nitrogen, phosphorus or potassium.

6. The use according to claim 4, characterized in that: Including promoting plant growth and development.

7. The use according to claim 4, characterized in that: Knocking out the PUKI gene in plants promotes plant growth and development.

8. The use according to claim 4, characterized in that: The gene number of the PUKI gene includes AT1G49350 or LOC_Os05g09370.

9. The use according to claim 4, characterized in that: The plant includes Arabidopsis thaliana or rice.

10. The use according to claim 4, characterized in that: The promoting plant growth and development includes promoting the growth of plant above-ground tissues and / or root systems.

Images