Preparation for optimizing sperm function in extracellular vesicle way, preparation method and application in sperm injury repair system

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to a preparation for optimizing a sperm function through an extracellular vesicle way, a preparation method and application of the preparation to a sperm injury repair system. The method comprises the following steps: step 1, constructing plasmids; step 2, transfecting cells and constructing a cell line; and step 3, separating the exosome. The method for constructing the plasmid in the step 1 comprises the following steps: firstly, amplifying an SKAP2-CDS sequence from a PCR (Polymerase Chain Reaction) of cDNA; and inserting the SKAP2-CDS sequence into a PHY-GFP plasmid between a BamHI site and an EcoRI site, so as to obtain a recombinant plasmid. According to the invention, the influence of seminal plasma extracellular vesicle protein on sperm functions is used for reference, an exosome transformation technology is adopted, the key protein SKAP2 in seminal plasma extracellular vesicles is expressed into the engineering exosome, sperm motility, capacitation and acrosome reaction can be effectively improved by adding and culturing in vitro sperms, and sperm functions are improved.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a preparation for optimizing sperm function through an extracellular vesicle pathway, a preparation method, and an application in a sperm damage repair system. Background Art

[0002] Oxidative stress is the main cause of male infertility. Under oxidative stress, excessive reactive oxygen will have a pathological effect on sperm, resulting in reduced sperm density, reduced vitality, reduced fertilization and even apoptosis. Its mechanism not only destroys the integrity of sperm membrane, mitochondria and nuclear DNA, but also leads to epigenetic changes. Extracellular vesicles in seminal plasma have a positive regulatory effect on sperm motility, capacitation and acrosome reaction, and can promote the repair of sperm damage. Therefore, preparing a preparation that can optimize sperm function and using the preparation to establish a sperm damage repair system is of great significance for auxiliary research on improving sperm damage and improving sperm motility in vitro in patients with asthenospermia. Summary of the invention

[0003] In order to solve the above technical problems, the purpose of the present invention is to provide a preparation for optimizing sperm function through the extracellular vesicle pathway, and to achieve auxiliary research on male infertility treatment such as related drug development research by establishing a sperm damage repair system.

[0004] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0005] A method for preparing a preparation for optimizing sperm function through an extracellular vesicle pathway comprises the following steps:

[0006] Step 1: construct plasmid;

[0007] The SKAP2-CDS sequence was amplified from the PCR reaction (polymerase chain reaction) of cDNA;

[0008] The SKAP2-CDS sequence was inserted into the PHY-GFP plasmid between the BamHI and EcoRI sites to obtain a recombinant plasmid;

[0009] Step 2: Cell transfection and construction of cell lines;

[0010] First, use EZ reverse transfection reagent to transfect the recombinant plasmid, and then use the recombinant plasmid product to transfect HEK293T cells. After the transfection is completed, centrifuge and collect the supernatant;

[0011] HEK293T cells were cultured using the collected supernatant and an equal volume of fresh culture medium. After the culture was completed, the HEK293T cells were transferred to a culture medium containing 1 μg / mL puromycin for further culture. After further culture, the HEK293T cells were transferred to a culture medium containing 0.5 μg / mL puromycin for subsequent culture to obtain a cell line;

[0012] Step 3: Isolation of exosomes;

[0013] The cell line is expanded and cultured, and after the expansion and culture is completed, the cell line is washed and then cultured in a serum-free medium. After the culture is completed, the supernatant is collected; the supernatant is centrifuged, filtered, and concentrated, and PBS is added to the concentrated solution, which is concentrated again to obtain an exosome suspension;

[0014] The exosome suspension is a preparation for optimizing sperm function through the extracellular vesicle pathway.

[0015] Preferably, in step 1, the cDNA includes human cDNA and mouse cDNA;

[0016] The human SKAP2-CDS sequence was amplified from the PCR reaction of human cDNA, and the mouse SKAP2-CDS sequence was amplified from the PCR reaction of mouse cDNA;

[0017] The sequence of the forward primer of human SKAP2-CDS is shown in SEQ ID NO. 1: 5'-TGATAAGGCCATTGCCGTGGATCCAATGCCCAACCCCAGCAGCACCTCCT-3';

[0018] The sequence of the reverse primer of human SKAP2-CDS is shown in SEQ ID NO. 2: 5′-CGCCGCTGCCGCCACCGCCGAATTCAATATCATACATCTCCATTATGTAG-3′;

[0019]

[0020] The sequence of the mouse SKAP2-CDS forward primer is shown in SEQ ID NO. 4: 5′-TGATAAGGCCATTGCCGTGGATCCAATGCCCAACCCCAGCTGTACCTCTT-3′;

[0021] The sequence of the mouse SKAP2-CDS reverse primer is shown in SEQ ID NO. 5: 5′-CGCCGCTGCCGCCACCGCCGAATTCAATATCATACATCTCCATTAGGTAG-3′;

[0022]

[0023] Preferably, in step 1, the PCR reaction system includes: 2×PhantaMax MasterMix, upstream primers, downstream primers, cDNA template, DNA polymerase, deionized water, and the PCR reaction program includes: pre-deformation, denaturation, annealing, extension, cycling, and complete extension.

[0024] Preferably, in step 1, the process of inserting the SKAP2-CDS sequence into the PHY-GFP plasmid between the BamHI and EcoRI sites includes: using BamHI and EcoRI endonucleases to double-digest the SKAP2 PCR product and the PHY-GFP plasmid respectively, and using DNA ligase to connect the target gene fragment after enzyme digestion with the plasmid fragment to form a recombinant plasmid.

[0025] Preferably, in step 2, the process of cell transfection specifically includes:

[0026] (1) Using EZ Transfection Reagent for recombinant plasmid transfection: dilute EZ Trans transfection reagent into serum-free high-glucose DMEM medium, mix well, and obtain diluted transfection reagent; dilute recombinant plasmid DNA into serum-free high-glucose DMEM medium, mix well, add diluted transfection reagent, mix well, and place at room temperature for 15 minutes to complete recombinant plasmid transfection and form EZ Trans-DNA complex, i.e., recombinant plasmid product;

[0027] (2) Drop the EZ Trans-DNA complex into a culture dish containing HEK293T cells, disperse it evenly, and co-incubate the cells to transfect them.

[0028] Preferably, the present invention also discloses another method for preparing a preparation for optimizing sperm function via an extracellular vesicle pathway, comprising the following steps:

[0029] Step (1), extracting milk-derived exosomes;

[0030] The milk is centrifuged for the first time, the supernatant of the first centrifugation is taken, the supernatant of the first centrifugation is centrifuged for the second time, the supernatant of the second centrifugation is taken, the supernatant of the second centrifugation is centrifuged for the third time, the centrifuged precipitate is collected, washed, and filtered to obtain an exosome suspension; the exosome suspension is milk-derived exosomes;

[0031] Step (2), exosome protein coating;

[0032] The milk-derived exosomes are loaded onto the SKAP2 protein through an ultrasonic system: the milk-derived exosomes and the SKAP2 protein are mixed in PBS at a mass ratio of 1:1, and after ultrasonic treatment, incubation is performed to obtain SKAP2 protein-coated milk-derived exosomes; the SKAP2 protein-coated milk-derived exosomes are the preparation for optimizing sperm function via the extracellular vesicle pathway.

[0033] Preferably, in step (1), the first centrifugation is carried out at 4°C and 13,000 x g for 25-35 min, the second centrifugation is carried out at 4°C and 100,000 x g for 50-70 min, and the third centrifugation is carried out at 4°C and 145,000 x g for 80-100 min.

[0034] Preferably, in step (2), the ultrasonic treatment is performed at an amplitude of 20% for 30 seconds, followed by cooling for 2 minutes, and the ultrasonic-cooling process is repeated 6 times; and the incubation is performed at 37° C. for 50-70 minutes.

[0035] The present invention also discloses a preparation for optimizing sperm function via an extracellular vesicle pathway, which is prepared by the method for preparing the preparation for optimizing sperm function via the extracellular vesicle pathway.

[0036] The present invention also discloses an application of the above-mentioned preparation for optimizing sperm function through the extracellular vesicle pathway in a sperm damage repair system.

[0037] Preferably, the application includes a sperm damage repair model established based on a preparation for optimizing sperm function via the extracellular vesicle pathway.

[0038] Compared with the prior art, the present invention has the following beneficial effects:

[0039] In the present invention, by drawing on the influence of seminal plasma extracellular vesicle proteins on sperm function, exosome modification technology is adopted to prepare a preparation capable of optimizing sperm function, and the preparation is used to establish a sperm damage repair system, thereby achieving improvement in the motility activity of lead-contaminated sperm and improving the sperm motility of patients with asthenospermia in vitro, providing a theoretical basis for auxiliary research on male infertility treatment, such as related drug development research. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 This is a standard curve of SKAP2 protein concentration using the BCA method when measuring the concentration of SKAP2 supernatant in Example 3; Figure 2 This is a diagram showing the results of mouse sperm damage repair in Example 4; Figure 3 This is a diagram showing the results of human sperm damage repair in Example 5; Figure 4This is a diagram showing the results of human sperm damage repair in Example 6; Figure 5 This is a graph showing the change in rat body weight over the lead exposure time in Example 7; Figure 6 The figure is the result of the effect of lead poisoning on the sperm quality of epididymis in rats in Example 7; Figure 7 This is a graph showing the results of sperm morphology examination of lead-poisoned rats in Example 7; Figure 8 The testicle structure of the lead-poisoned rat in Example 7; Fig. 9 This is a transmission electron microscopic identification result of extracellular vesicles extracted from healthy male rat seminal plasma in Example 8; Fig.10 This is a diagram showing the diameter and concentration distribution identification results of extracellular vesicles extracted from healthy male rat seminal plasma by nanoparticle tracking analysis in Example 8; Fig.11 This is a graph showing the protein marker identification results of extracellular vesicles of seminal plasma of healthy male rats extracted in Example 8 by Western immunoblotting; Fig.12 This is a graph showing the effect of extracellular vesicles of seminal plasma on the motility of rat sperm in Example 8; Fig.13 This is a graph showing the effect of extracellular vesicles of seminal plasma on human sperm motility in Example 9; Fig.14 This is a graph showing the effect of extracellular vesicles of seminal plasma on sperm capacitation in Example 8; Fig.15 This is a graph showing the effect of extracellular vesicles of seminal plasma on the acrosome reaction of rat sperm in Example 8; Fig.16 This is a graph showing the effect of extracellular vesicles of seminal plasma on the acrosome reaction of human sperm in Example 9; Fig.17 This is a diagram showing the identification results of extracellular vesicle proteins in rat prostate fluid, seminal vesicle fluid, and epididymal fluid in Example 8; Fig.18 This is a differential protein map of extracellular vesicles in rat epididymal fluid lead-exposed group and control group in Example 8; Fig.19 This is a differential protein map of extracellular vesicles of rat seminal plasma in lead-exposed group and control group in Example 8; Fig. 20 This is a cluster analysis diagram of 37 differentially expressed proteins in extracellular vesicles of rat epididymal fluid in Example 8; Fig.21 This is a cluster analysis diagram of 7 differentially expressed proteins in extracellular vesicles of rat seminal plasma in Example 8; Fig. 22 This is a GO enrichment analysis diagram of differential proteins in extracellular vesicles of rat seminal vesicle fluid in Example 8; Fig.23 This is the GO enrichment analysis diagram of differential proteins in extracellular vesicles of rat prostatic fluid in Example 8; Fig.24 This is a GO enrichment analysis diagram of differential proteins in extracellular vesicles of rat epididymal fluid in Example 8; Fig.25 This is the GO enrichment analysis diagram of differential proteins in extracellular vesicles of rat seminal plasma in Example 8; Fig.26 This is a KEGG enrichment analysis diagram of differential proteins in extracellular vesicles of rat seminal plasma in Example 8; Fig. 27 This is a KEGG enrichment analysis diagram of differential proteins in extracellular vesicles of rat seminal vesicle fluid in Example 8; Fig.28 This is a KEGG enrichment analysis diagram of differential proteins in extracellular vesicles of rat prostatic fluid in Example 8; Fig.29 This is a KEGG enrichment analysis diagram of differential proteins in extracellular vesicles of rat epididymal fluid in Example 8. DETAILED DESCRIPTION

[0041] Example 1

[0042] This embodiment discloses a method for preparing a preparation for optimizing sperm function through an extracellular vesicle pathway, comprising the following steps:

[0043] Step 1: construct plasmid;

[0044] The human SKAP2-CDS sequence was amplified from the PCR reaction of human cDNA;

[0045] The components of the PCR reaction system are: 2×Phanta Max Master Mix 25 μL, upstream primer (10 μM) 1 μL, downstream primer (10 μM) 1 μL, human cDNA template 10 ng, DNA polymerase 1 μL, and the balance is deionized water, which is added to 50 μL. The PCR reaction procedure is as follows: (1) pre-denaturation, keep at 95°C for 5 min, (2) denaturation, keep at 95°C for 1 min; (3) annealing, control the temperature at 55°C, and keep it for 2 min; (4) extension, at 72°C, each kb (DNA kilobase pair) DNA fragment is extended for 90 s; (5) cycle, cycle (2)-(4), for a total of 35 cycles; (6) complete extension, at 72°C, for 5 min to ensure that all DNA segments are fully extended; the human SKAP2 PCR reaction product (human SKAP2-CDS sequence) was stored at 10°C;

[0046] The sequence of the forward primer of human SKAP2-CDS is shown in SEQ ID NO. 1: 5′-TGATAAGGCCATTGCCGTGGATCCAATGCCCAACCCCAGCAGCACCTCCT-3′;

[0047] The sequence of the reverse primer of human SKAP2-CDS is shown in SEQ ID NO. 2: 5′-CGCCGCTGCCGCCACCGCCGAATTCAATATCATACATCTCCATTATGTAG-3′;

[0048]

[0049] The human SKAP2-CDS sequence was inserted into the PHY-GFP plasmid between the BamHI and EcoRI sites to obtain a recombinant plasmid;

[0050] The process of inserting the human SKAP2-CDS sequence into the PHY-GFP plasmid between the BamHI and EcoRI sites includes: using BamHI and EcoRI endonucleases to perform double enzyme digestion on the human SKAP2 PCR reaction product and the PHY-GFP plasmid, respectively, the double enzyme digestion reaction is reacted in a 37°C water bath for 2 hours, using 1% agarose gel electrophoresis to recover the target gene fragments, using DNA ligase to react the target gene fragment with the plasmid fragment so that the target gene fragment and the plasmid fragment are connected, and the reaction conditions are 16°C for 12 hours to obtain a recombinant plasmid;

[0051] Further, whether the recombinant plasmid is successfully constructed and contains the target gene can be confirmed by culturing, screening and identification steps, including the following steps: taking 10 μL of the recombinant plasmid and 100 μL of DH5a competent bacteria, mixing them, ice bathing for 30 minutes, heat shocking at 42°C for 90 seconds, immediately placing them on ice for 5 minutes, adding 700 μL of LB medium preheated to room temperature, culturing at 37°C constant temperature shaker for 50 minutes, taking 200 μL of bacterial solution, mixing them with a pipette, and evenly coating them on an LB plate containing 100 μg / mL Ampicillin resistance, culturing them inverted in a 37°C constant temperature incubator overnight, picking 5 single colonies and inoculating them in 5 mL of LB culture solution containing 100 μg / mL Ampicillin resistance, culturing them at 300 rpm, 37°C constant temperature shaker overnight, amplifying the overnight bacterial solution, selecting the positive bacterial solution, extracting the plasmid with a plasmid small amount extraction kit, and then sequencing and verifying;

[0052] Step 2: Cell transfection and construction of cell lines;

[0053] (1) Using EZ Transfection Reagent for recombinant plasmid transfection: dilute EZ Trans transfection reagent into serum-free high-glucose DMEM medium, mix well, and obtain diluted transfection reagent; dilute recombinant plasmid DNA into serum-free high-glucose DMEM medium, mix well, add diluted transfection reagent, mix well, and place at room temperature for 15 minutes to complete recombinant plasmid transfection and form EZ Trans-DNA complex, i.e., recombinant plasmid product;

[0054] The EZ Trans-DNA complex was evenly dropped into the culture dish containing HEK293T cells, and gently shaken to make the EZ Trans-DNA complex dispersed evenly. The culture was incubated in a 37°C, 5% CO2 incubator for 18 hours, and a new high-glucose DMEM medium containing serum was replaced. The culture was continued for 24 hours to analyze the expression of the transferred gene fragment. After the transfection was completed, the supernatant was collected by centrifugation at 4000 rpm for 5 minutes at 4°C.

[0055] (2) When the HEK-293T cells grew to 80%, the collected supernatant and an equal volume of fresh MEM medium (containing 10% exosome-free fetal bovine serum) were used to incubate the HEK293T cells in a 37°C, 5% CO2 incubator. After incubation for 48 hours, the HEK293T cells were transferred to a MEM medium containing 1 μg / mL puromycin for further culture. After further culture for 48 hours, the HEK293T cells were transferred to a MEM medium containing 0.5 μg / mL puromycin for subsequent culture to obtain a cell line;

[0056] Step 3: Isolation of exosomes;

[0057] The cell line was expanded and cultured in 10 culture dishes with a diameter of 15 cm. When the cell concentration reached 70%, the cells were rinsed three times with 1x PBS and then continued to be cultured with serum-free MEM medium. After 48 hours of culture, the supernatant was collected; the supernatant was centrifuged under the conditions of first centrifuging at 4°C and 2000g for 30 minutes, then centrifuging at 4°C and 12000g for 30 minutes, filtered with a 0.22μm sterilizing filter, and the supernatant was concentrated to 500μL using a 100kD ultrafiltration tube at 4°C and 4000g, 10mL PBS was added to the concentrate, and it was concentrated again to 500μL to obtain a human SKAP2-HEK2293T exosome suspension, i.e., a preparation for optimizing sperm function through the extracellular vesicle pathway.

[0058] Example 2

[0059] This embodiment discloses a method for preparing a preparation for optimizing sperm function through an extracellular vesicle pathway, comprising the following steps:

[0060] Step 1: construct plasmid;

[0061] The mouse SKAP2-CDS sequence was amplified by PCR reaction from mouse cDNA;

[0062] The components and reaction procedures of the PCR reaction system were the same as those in Example 1;

[0063] The sequence of the mouse SKAP2-CDS forward primer is shown in SEQ ID NO. 4: 5'-TGATAAGGCCATTGCCGTGGATCCAATGCCCAACCCCAGCTGTACCTCTT-3';

[0064] The sequence of the mouse SKAP2-CDS reverse primer is shown in SEQ ID NO. 5: 5′-CGCCGCTGCCGCCACCGCCGAATTCAATATCATACATCTCCATTAGGTAG-3′;

[0065]

[0066] The mouse SKAP2-CDS sequence was inserted into the PHY-GFP plasmid between the BamHI and EcoRI sites to obtain a recombinant plasmid;

[0067] The process of inserting the mouse SKAP2-CDS sequence into the PHY-GFP plasmid between the BamHI and EcoRI sites was the same as the process of inserting the mouse SKAP2-CDS sequence into the PHY-GFP plasmid between the BamHI and EcoRI sites in Example 1;

[0068] Step 2: Cell transfection and construction of cell lines;

[0069] The operation process of cell transfection and construction of cell line is the same as that of Example 1;

[0070] Step 3: Isolate exosomes to obtain a mouse SKAP2-HEK2293T exosome suspension, i.e., a preparation for optimizing sperm function through the extracellular vesicle pathway; the operation process for isolating exosomes is the same as that in Example 1.

[0071] Example 3

[0072] This embodiment discloses a method for preparing a preparation for optimizing sperm function through an extracellular vesicle pathway, comprising the following steps:

[0073] Step (1), extracting milk-derived exosomes:

[0074] The milk is subjected to a first centrifugation to remove fat globules, cells and cell debris; the first centrifugation is carried out under the centrifugal force of 13000×g for 30 minutes at 4°C, the first centrifugation supernatant is collected, the first centrifugation supernatant is subjected to a second centrifugation to remove large particles and microvesicles, the second centrifugation is carried out under the centrifugal force of 100,000×g for 60 minutes at 4°C, the second centrifugation supernatant is collected, the second centrifugation supernatant is subjected to a third centrifugation, the third centrifugation is carried out under the centrifugal force of 145000×g for 90 minutes at 4°C, the centrifugal precipitate is collected, washed three times with PBS, and filtered through a 0.22 μm filter membrane to obtain an exosome suspension, i.e., milk-derived exosomes (mEXOs);

[0075] Step (2), exosome protein coating;

[0076] The milk-derived exosomes were loaded onto the SKAP2 protein by an ultrasonic system: the milk-derived exosomes and the SKAP2 protein were mixed in PBS at a mass ratio of 1:1, the final concentration of the milk-derived exosomes in the mixture was 4 μg / mL, and the mixture was ultrasonicated for 30 seconds at an amplitude of 20%, cooled for 2 minutes, and the ultrasonication-cooling process was repeated for 6 times. After the ultrasonication was completed, the mixture was incubated at 37°C for 60 minutes to obtain the SKAP2 protein-coated milk-derived exosomes; the SKAP2 protein-coated milk-derived exosomes (SKAP2-milk) were the preparations for optimizing sperm function via the extracellular vesicle pathway;

[0077] Furthermore, the loading rate of SKAP2 protein was determined by the following test method:

[0078] a) Labeling milk exosomes (exosome suspension) with red fluorescent dye (Dil, Biotium, USA) as follows: Mix the exosome suspension with Dil at a ratio of 1000 μg exosome suspension to 10 μL Dil stock solution, and repeatedly and slowly pipette to fully dissolve and avoid agglomeration; Incubate at 37°C in the dark for 30 min, and slowly and repeatedly pipette every 5 min (50 times), and then centrifuge at 140,000 g for 90 min, remove the supernatant after centrifugation, and retain the precipitate, and remove the dye not bound to the exosomes. The precipitate is resuspended with sterile PBS and transferred to a light-proof EP tube to obtain Dil-mEXOs;

[0079] If the obtained Dil-mEXOs are to be used in the short term, they need to be stored in a 4°C refrigerator. If they are to be stored for a long time, they need to be kept in a -80°C refrigerator.

[0080] b) Dil-mEXOs and SKAP2 proteins were mixed in sterile PBS and repeatedly resuspended with a pipette to mix them evenly. The mixed system included 0.1 mL of sterile PBS, the mass ratio of Dil-mEXOs and SKAP2 proteins was 1:1, and the content of both was 0.4 μg / μL;

[0081] c) subjecting the mixed system to ultrasonic treatment, wherein the process of the ultrasonic treatment is as follows: ultrasonic treatment at an amplitude of 20% for 30 seconds, followed by cooling for 2 minutes, and a cycle of ultrasonic treatment-cooling for 6 times. After the ultrasonic treatment is completed, the mixture is incubated at 37° C. for 60 minutes. The ultrasonic treatment process is required to be performed on ice;

[0082] d) Loading rate of SKAP2 protein: The concentration of unencapsulated SKAP2 protein in the supernatant at 562 nm was measured using a microplate reader. The loading rate of SKAP2 protein was determined by taking the average value after multiple measurements. The determination was based on the following formula: Loading rate of SKAP2 protein = (total concentration of SKAP2 protein - concentration of SKAP2 supernatant) / total concentration of SKAP2 protein. The loading rate of SKAP2 protein was measured to be 93.35%;

[0083] When determining the concentration of SKAP2 supernatant, the BCA protein concentration standard curve of SKAP2 is as follows: Figure 1 shown.

[0084] Example 4

[0085] This example discloses a mouse sperm damage repair model established by using an extracellular vesicle approach to optimize sperm function. The steps for establishing the mouse sperm damage repair model are as follows:

[0086] Step 1, separation of damaged mouse sperm: centrifugation of the semen of lead-poisoned mice to separate seminal plasma and sperm, adding sperm cell BWW culture medium to the semen, centrifuging at a centrifugal speed of 900 rpm for 5 minutes to obtain damaged mouse sperm;

[0087] If the seminal plasma and spermatozoa are not completely separated, remove the supernatant and add sperm cell BWW medium again, centrifuge at 900 rpm for 5 min until the seminal plasma and spermatozoa are separated;

[0088] The lead poisoning process of mice is as follows: male mice are fed with 0.1wt% lead acetate aqueous solution through drinking water for a 3-month exposure experiment;

[0089] Step 2: Repair incubation: Use a 24-well plate, 2.5×10 6 1.72 μL of the preparation for optimizing sperm function through the extracellular vesicle pathway (prepared in Example 2) was added to each well of each sample, and the mixture was incubated in an incubator at 37° C., 5% CO 2 , and 95% humidity for 1 h.

[0090] Further, after the incubation was completed, the motility of the sperm was detected, and the test results are shown in Table 1:

[0091] Table 1 Improvement of mouse sperm motility level stimulated in vitro

[0092]

[0093] a-The results were presented as the mean±SD; b-Comparedwith theControl,P<0.05; c-Compared with the EVs-Empty,P<0.05; d-Compared with theControl,P<0.01; e-Compared with the EVs-Empty,P<0.01;

[0094] In the table, sperm motility-related indicators: PR (Progressive Motility, percentage of forward-moving sperm): blank control group: 14.94±2.97%; negative control group: 15.14±1.97%; treatment group: 25.92±4.92% (compared with blank and negative control groups, P<0.001); analysis: the percentage of forward-moving sperm in the treatment group was significantly higher than that in the blank and negative control groups, indicating that the treatment may have enhanced the forward-moving ability of sperm; PRNP (Progressive and Non-Progressive Motility, percentage of forward-moving and non-progressive-moving sperm): blank control group: 22.57±4.55%; negative control group: 22.96±3.13%; treatment group: 33.91±6.76% (compared with blank and negative control groups, P<0.001); analysis: the percentage of forward-moving and non-progressive-moving sperm in the treatment group was also significantly higher than that in the blank and negative control groups, indicating that the treatment had a positive effect on the overall motility of sperm;

[0095] Sperm motility index: Hyperactivation (hyperactivation percentage): blank control group: 2.79±1.04%; negative control group: 1.68±0.73%; treatment group: 4.08±1.18% (compared with blank and negative control groups, P<0.01); Analysis: The hyperactivation percentage of the treatment group increased, indicating that the treatment may promote the hyperactivation movement of sperm, which is one of the key factors for successful sperm fertilization;

[0096] Sperm motility related indicators: VCL (Curvilinear Velocity): blank control group: 21.98±3.18μm / s; negative control group: 23.50±3.91μm / s; treatment group: 41.24±8.21μm / s (compared with blank and negative control groups, P<0.001); Analysis: The curvilinear velocity of the treatment group increased significantly, indicating that the treatment increased the overall movement speed of sperm; VSL (Straight Line Velocity): blank control group: 4.64±1.45μm / s; negative control group: 4.54±1.06μm / s; treatment group: 8.68±2.60μm / s (compared with blank and negative control groups, P<0.01); Analysis: The straight line velocity of the treatment group also increased significantly, indicating that the treatment made the sperm move faster in the straight line direction; VAP (Average Path Velocity, average path speed): blank control group: 9.80±1.73μm / s; negative control group: 10.42±1.84μm / s; treatment group: 18.22±3.93μm / s (compared with blank and negative control groups, P<0.001); Analysis: The average path speed of the treatment group increased significantly, indicating that the treatment improved the stability and efficiency of sperm movement;

[0097] Sperm morphology and dynamics indicators: STR (Straightness): blank control group: 0.10±0.03; negative control group: 0.09±0.02; treatment group: 0.15±0.03 (compared with the blank control group, P<0.05); Analysis: The linearity of the treatment group was improved, but it was only significantly different from the blank control group, indicating that the treatment may make the sperm closer to a straight line during movement; BCF (Beat Cross Frequency, whipping frequency): blank control group: 2.22±0.53Hz; negative control group: 2.14±0.38Hz; definition of ALH: ALH refers to the maximum amplitude of the lateral swing of the sperm head on its trajectory, which is an important indicator to measure the dynamics and exploration ability of sperm; blank control group: 2.22±0.28μm; negative control group: 2.44±0.43μm; treatment group: 4.08±0.73μm (compared with blank and negative control groups, P<0.001); analysis: from the experimental results, it can be seen that the ALH value of the treatment group was significantly higher than that of the blank and negative control groups, which indicates that the treatment may enhance the lateral swing ability of the sperm head, thereby improving the dynamics and exploration ability of sperm in complex environments; clinical significance of ALH: the increase of ALH may help improve the fertilization ability of sperm, because the larger amplitude of lateral displacement of the head may make sperm more flexible when crossing the female reproductive tract, and it is easier to find eggs and complete the fertilization process; in addition, ALH is also an important parameter for evaluating sperm quality and male fertility;

[0098] Depend on Figure 2 It can be seen that mouse SKAP2-HEK2293T exosomes can improve mouse sperm motility indicators. After mouse SKAP2-HEK2293T exosomes stimulated and damaged mouse sperm in vitro, compared with the blank control (Blank Control) and empty HEK293T exosomes (EVs-Empty), the sperm motility and sperm vitality increased significantly, and each case was higher than the original control, and its motility indicators ALH, BCF, STR, VAP, VCL, VSL and sperm Hyperactivation (super activation percentage) were significantly higher than the two control groups;

[0099] In the figure, PR stands for premotility rate, which is the sum of grade A and grade B sperm; PRNP is sperm motility, which represents the sum of grade A, grade B and grade C sperm.

[0100] Example 5

[0101] This example discloses a human sperm damage repair model established by using an extracellular vesicle approach to optimize sperm function. The steps for establishing the human sperm damage repair model are as follows:

[0102] Step 1, separation of damaged human sperm: centrifugation of semen from humans with asthenozoospermia to separate seminal plasma and sperm, adding sperm cell BWW culture medium to the semen, centrifuging at a centrifugal speed of 900 rpm for 5 minutes to obtain damaged human sperm; if the seminal plasma and sperm are not completely separated, the supernatant is removed and the sperm cell BWW culture medium is added again, centrifuging at a centrifugal speed of 900 rpm for 5 minutes until the seminal plasma and sperm are separated;

[0103] Step 2: Repair incubation: Use a 24-well plate, 2.5×10 6 10 damaged human spermatozoa were placed in 1 mL of BWW medium, and 1.72 μL of the preparation for optimizing sperm function through the extracellular vesicle pathway (prepared in Example 1) was added to each well and incubated in an incubator at 37° C., 5% CO 2 , and 95% humidity for 1 h;

[0104] Further, after the incubation was completed, the motility of the sperm was detected, and the test results are shown in Table 2:

[0105] Table 2 Improvement of human sperm motility level stimulated in vitro

[0106]

[0107] a-The results were presented as the mean±SD; d-Comparedwith the blankcontrol,P<0.05; e-Compared with the negative control,P<0.05;

[0108] Depend on Figure 3 It can be seen that human SKAP2-HEK2293T exosomes can improve the motility index of sperm in asthenozoospermia. After human SKAP2-HEK2293T exosomes stimulated and damaged human sperm in vitro, compared with the blank control and empty HEK2293T exosomes, the sperm motility and sperm vitality increased significantly, and each case was higher than the original control, while the D-grade dead sperm ratio decreased significantly;

[0109] In the figure, A+B represents the preceding motility rate, which is the sum of the A and B sperm rates; A+B+C is the sperm motility.

[0110] Example 6

[0111] This example discloses a human sperm damage repair model established by using an extracellular vesicle approach to optimize sperm function. The steps for establishing the human sperm damage repair model are as follows:

[0112] Step 1, separation of damaged human sperm: centrifugation of semen from humans with asthenozoospermia to separate seminal plasma and sperm, adding sperm cell BWW culture medium to the semen, centrifuging at a centrifugal speed of 900 rpm for 5 minutes to obtain damaged human sperm; if the seminal plasma and sperm are not completely separated, the supernatant is removed and the sperm cell BWW culture medium is added again, centrifuging at a centrifugal speed of 900 rpm for 5 minutes until the seminal plasma and sperm are separated;

[0113] Step 2: Repair incubation: Use a 24-well plate, 2.5×10 6 1.72 μL of the preparation for optimizing sperm function through the extracellular vesicle pathway (prepared in Example 3) was added to each well of each sample, and the mixture was incubated in an incubator at 37° C., 5% CO 2 , and 95% humidity for 1 h;

[0114] Further, after the incubation was completed, the motility of the sperm was detected, and the test results are shown in Table 3:

[0115] Table 3 Improvement of human sperm motility level stimulated in vitro

[0116]

[0117]

[0118] a-The results were presented as the mean±SD; d-Comparedwith the blankcontrol,P<0.05; e-Compared with the negative control,P<0.05;

[0119] Depend on Figure 4 It can be seen that SKAP2 protein-coated milk-derived exosomes can improve the motility index of sperm in asthenozoospermia. After SKAP2 protein-coated milk-derived exosomes stimulated and damaged human sperm in vitro, compared with the blank control and empty milk exosomes (EVs-Empty), the sperm motility and sperm vitality increased significantly, and each case was higher than the original control;

[0120] In the figure, A+B represents the preceding motility rate, which is the sum of the A and B sperm rates; A+B+C is the sperm motility.

[0121] Example 7

[0122] This embodiment discloses a method for establishing a rat lead acetate chronic poisoning model, comprising the following steps:

[0123] Step (1), preparing reagents:

[0124] 1.1 Prepare lead acetate poisoning solution: Taking 0.2% lead acetate solution as an example, weigh 2.00g of anhydrous lead acetate, dissolve it in 100mL of distilled water, transfer it to a volumetric flask and make up to 1L to obtain 0.2% lead acetate solution;

[0125] The preparation method of 0.04% lead acetate solution, 0.4% lead acetate solution and 0.8% lead acetate solution is the same as that of 0.2% lead acetate solution;

[0126] Label 0.04% lead acetate solution, 0.2% lead acetate solution, 0.4% lead acetate solution, and 0.8% lead acetate solution, mark the date, and wait for use;

[0127] 1.2 Prepare SDS-PAGE electrophoresis buffer: Take a 1L bottle of Biyuntian SDS-PAGE electrophoresis buffer powder and put it in a clean beaker, add 900mL of double distilled water, mix and dissolve with a magnetic stirrer, transfer to a volumetric flask and dilute to 1L to obtain SDS-PAGE electrophoresis buffer; label the SDS-PAGE electrophoresis buffer, mark the date, and store at 4°C until use;

[0128] 1.3 Prepare transfer solution: Take a 1L bottle of Biyuntian semi-dry transfer solution powder and put it in a clean beaker, add 700mL of double distilled water, mix and dissolve with a magnetic stirrer, add 200mL of anhydrous ethanol, mix, transfer to a volumetric flask and make up to 1L to obtain transfer solution; label the transfer solution, mark the date, and store at 4℃ until use;

[0129] 1.4 Prepare membrane washing solution (PBST washing solution): Take a bag of 18.7g PBS powder and put it in a clean beaker, add 1900mL double distilled water, mix and dissolve with a magnetic stirrer, add 2mL Tween-20, mix, transfer to a volumetric flask and dilute to 2L to obtain membrane washing solution; label the membrane washing solution, mark the date, and store at 4℃ until use;

[0130] 1.5 Prepare standard curve solution:

[0131] 1.5.1 Dilute the internal standard: Use the gradient dilution method to dilute the internal standard stock solution with a concentration of 10 ppm to the internal standard application solution with a concentration of 100 ppb;

[0132] 1.5.2 Dilution of external standard: Use gradient dilution method to dilute the external standard stock solution with a concentration of 10ppm into external standard application solutions with concentrations of 1ppm, 100ppb, 10ppb, and 1ppb respectively;

[0133] 1.5.3 The final concentration gradient of the external standard in the standard curve solution is: 50ppb, 10ppb, 2ppb, 0.4ppb, 0.2ppb, the final concentration of the internal standard is 10ppb, and the rest is 3% nitric acid aqueous solution. The total volume of the standard curve solution is 8mL;

[0134] Step (2): Establishing a rat model of chronic lead acetate exposure

[0135] 2.1 Selection of experimental subjects

[0136] Healthy male SD rats (3-4 weeks old) weighing 60-110 g SPF (Specific Pathogen Free) were purchased from the Experimental Animal Center of the Army Medical University and were adaptively raised in the laboratory animal room for 1 week. The temperature of the animal room was 26±1°C, the relative humidity was 45%-65%RH, and the light-dark cycle was 12 h (light on at 8:00 am and light off at 8:00 pm). Animal breeding was carried out in strict accordance with the manual of the Experimental Animal Experiment Committee of the Army Medical University.

[0137] 2.2 The rats selected in 2.1 were randomly divided into six groups, each with 12 rats. The rats were fed with corresponding lead acetate poisoning doses through drinking water to establish a chronic poisoning model. The six groups of lead acetate poisoning experiments were: negative control group (control group), sodium acetate control group (0.4% sodium acetate, NaAC), low lead exposure group (0.04% lead acetate, PbAC), medium lead exposure group (0.2% lead acetate), high lead exposure group (0.4% lead acetate), and ultra-high exposure group (0.8% lead acetate). Diet and growth and development were recorded, and body weight was measured every week. The poisoning experiment lasted for 4 months. The changes in rat body weight with poisoning time are shown in Tables 4 and Figure 5 As shown:

[0138] Table 4

[0139]

[0140] From Table 4 and Figure 5It can be seen that the appetite of rats in the sodium acetate control group increased significantly after 1 week of exposure, and the appetite of rats in the 0.80% lead-exposed group decreased significantly after 3 weeks of exposure. There was no change in appetite in the other lead-exposed groups, but some showed symptoms such as diarrhea and mental tension. After 5 weeks of exposure, the body color darkened, the hair became loose, chlorotic, and even lost hair. Compared with the control group, the weight of the 0.80% PbAC group decreased significantly; although the weight of rats in the other lead-exposed groups changed with time less than that of the control group and the NaAC control group, compared with the control group, no statistically significant effect of lead exposure on the weight of the rat brain, testicles, prostate, and seminal vesicle was observed; the changes in the visceral coefficient of rats were analyzed, and the calculation formula was: visceral coefficient = tissue / organ weight / animal weight. Only the prostate coefficient of the 0.04% PbAC group was significantly higher than that of the control group, and no statistical difference was found in the changes in the visceral coefficients of other lead-exposed groups and the control group. The weights of rat tissues and organs are shown in Table 5:

[0141] Table 5

[0142]

[0143] Furthermore, the rats were tested and analyzed after the poisoning experiment, including:

[0144] (1) Whole blood lead test

[0145] After the poisoning experiment, the rats were placed in a rat holder and their tails were exposed. They were immersed in warm water at about 50°C to dilate the blood vessels. The tails were red. The tails were repeatedly wiped with alcohol cotton balls for disinfection. The tails were wiped dry with dry cotton balls. About 0.5 cm of the tail tip was cut off. The blood flowed out from the tail tip and dripped into an EDTA blood collection tube. The collected rat whole blood samples were frozen at -80°C for later use.

[0146] Inductively coupled plasma mass spectrometry (ICP-MS) was used to measure the blood lead concentration in frozen rat whole blood samples. The operation steps are as follows:

[0147] Blood sample processing: take out the frozen rat whole blood sample, keep it in a constant temperature water bath at 37°C for 5 minutes, vortex and shake to mix thoroughly, take 40 μL of rat whole blood sample in a 2mL polytetrafluoroethylene digestion tube, add 150 μL of internal standard working solution with a concentration of 100 ppb, add 3wt% nitric acid aqueous solution to make the volume to 1.5mL, turn it upside down to mix thoroughly, ultrasonicate for 1 hour, let it stand for 24 hours, centrifuge it at a speed of 10000 r / min for 20 minutes, and extract the supernatant for testing; use ICP-MS to determine the lead (Pb) content in the supernatant, and the settings of the inductively coupled plasma mass spectrometer are: wavelength 283.3nm, lamp current 8mA, slit 0.7L / nm;

[0148] (2) Analysis of semen quality

[0149] 2.1 Extracting semen: Cut open the epididymal tails of rats after the poisoning experiment longitudinally and place them in a 6-well plate with 1 mL of HTF medium. Place the HTF medium on a 37°C thermostat for 2 minutes. During this period, use a pipette to gently blow the epididymal tail 5 times to fully release the semen.

[0150] 2.2 Take 20 μL of semen and add it to 1 mL of HTF in 37°C culture medium. Mix well by inverting the tube three times. Quickly drip 40 μL onto a disposable sperm analysis slide. Perform routine semen analysis on the sperm automatic detection and analysis system (CASA). Count 500 sperm for each rat.

[0151] The detection indexes mainly include semen routine parameters and sperm motility parameters; routine parameters include: semen volume, sperm concentration, total sperm count, sperm motility (percentage of forward-moving sperm PR, percentage of non-forward-moving sperm NP, percentage of immobile sperm IM) and other indicators; sperm motility parameters mainly include: VCL average curve velocity (μm / s), VSL average linear velocity (μm / s), VAP average path velocity (μm / s), LIN linearity (%), STR forwardness (%), WOB swing (%), ALH sperm average lateral swing amplitude (μm), BCF sperm average whipping frequency (Hz), the detection results are shown in Table 6 and Figure 6 As shown:

[0152] Table 6

[0153]

[0154]

[0155] From Table 6 and Figure 6 It can be seen that compared with the control group, the percentage of non-progressive sperm NP (P=0.043) and the percentage of C-grade sperm (P=0.044) in the 0.20% and 0.80% PbAC-treated groups were significantly reduced, and the percentage of immotile sperm IM, i.e. the percentage of D-grade sperm (P=0.002) was significantly increased; the percentage of A-grade sperm in the 0.80% PbAC-treated group was significantly reduced (P<0.001); the average linear velocity VSL, the swinging WOB of movement, the linear LIN of movement, and the forward STR of movement in the 0.04% PbAC-treated group were significantly increased; the swinging WOB of movement in the 0.20% PbAC-treated group was also significantly increased; the average whipping frequency BCF in the 0.40% PbAC-treated group was significantly reduced;

[0156] (3) Sperm morphology examination

[0157] The 2% eosin staining method was used to examine the abnormal sperm of rats. The experimental steps are as follows:

[0158] 3.1 Preparation of semen smear:

[0159] 3.1.1 Wipe both sides of the slide with lint-free paper;

[0160] 3.1.2. Use an HB pencil to record the rat number on the white paint area of ​​the slide, and add 10 μL of the semen extracted in 2.1 to the edge of the slide;

[0161] 3.1.3 Use another slide to press the semen on the surface of the first slide and push the slide forward;

[0162] 3.1.4 Fix with anhydrous ethanol and dry the slide naturally at room temperature to obtain a fixed sperm smear;

[0163] 3.22% eosin staining: Place the fixed sperm smear on a slide rack and put it into a dyeing tank with a mass concentration of 2% eosin staining solution. Let it stand for 48 hours, rinse the excess dye with water, and observe under a microscope;

[0164] 200 sperms in different fields of view were examined, and the proportions of normal sperm, head deformity, neck and mid-section deformity, tail deformity, and simultaneous deformity were counted. The sperm deformity index TZI and sperm deformity index SDI were calculated. The results of rat sperm morphology examination are shown in Tables 7 and Figure 7 As shown:

[0165] Table 7

[0166]

[0167] From Table 7 and Figure 7 It can be seen that the normal sperm rate in the 0.20% PbAC group, 0.40% PbAC group and 0.80% PbAC poisoning group was significantly reduced (P<0.001), and the sperm deformity index SDI was significantly increased (P<0.01); the head deformity rate (P<0.001), neck and middle deformity rate (P<0.001) in the 0.80% PbAC poisoning group were significantly increased; the tail deformity rate in the 0.20% and 0.40% PbAC poisoning groups was significantly increased (P<0.001, P=0.028); while the abnormal sperm index TZI (103.18±2.78VS101.34±1.39, P<0.001) in the 0.04% PbAC poisoning group was significantly reduced;

[0168] (4) Testicular paraffin sections and HE staining

[0169] The testicular tissue of rats after the poisoning experiment was fixed with testicular tissue fixative, and the paraffin section samples were stained with hematoxylin-eosin (HEstaining) to observe the testicular structure of rats in each group. The experimental steps are as follows:

[0170] 4.1 Sampling: Take the rat testicles out of the fixative and trim the target tissue with a scalpel in a fume hood. Place the trimmed tissue and the corresponding label in the embedding frame.

[0171] 4.2 Dewaxing: The paraffin sections of rat testicular tissue were dewaxed with xylene for 10 min, then dewaxed with fresh xylene for another 10 min, and then soaked in anhydrous ethanol, 90% ethanol aqueous solution, 80% ethanol aqueous solution, 70% ethanol aqueous solution and distilled water in a volume ratio of 5 min in sequence;

[0172] 4.3 Embedding: Embed the wax-soaked tissue in an embedding machine. First, put the melted wax into the embedding frame. Before the wax solidifies, take the tissue out of the dehydration box and put it into the embedding frame according to the requirements of the embedding surface and attach the corresponding label. Cool it in a -20℃ freezer. After the wax solidifies, take the wax block out of the embedding frame and trim the wax block.

[0173] 4.4 Sectioning: Place the trimmed wax block on a paraffin slicer and slice it to a thickness of 4 μm. Float the slices on 40°C warm water on the slicer to flatten the tissue. Pick up the tissue with a glass slide and bake it in a 60°C oven. After the moisture is dried and the wax is melted, take it out and store it at room temperature for later use.

[0174] 4.5 Staining:

[0175] 4.5.1 After dewaxing, the rat testis tissue sections were stained with hematoxylin staining solution for 10 min;

[0176] 4.5.2 Rinse with tap water for 10 minutes, and then wash once with distilled water to remove impurities;

[0177] 4.5.3 Soak in 1% hydrochloric acid ethanol differentiation solution (prepared with 1 mL 37 wt % concentrated hydrochloric acid and 99 mL 75 wt % ethanol aqueous solution) for 30 seconds, and rinse with tap water for 10 minutes;

[0178] 4.5.4 After staining with eosin solution for 2 minutes, rinse with tap water for 10 minutes;

[0179] 4.6 Dehydration: Dehydrate the slices with 70% ethanol aqueous solution, 80% ethanol aqueous solution, 90% ethanol aqueous solution, and anhydrous ethanol, respectively. The dehydration time is 10 seconds for 70% ethanol aqueous solution, 10 seconds for 80% ethanol aqueous solution, 10 seconds for 90% ethanol aqueous solution, and 10 seconds for anhydrous ethanol.

[0180] 4.7 Transparency: Place the dehydrated rat testicular tissue sections in xylene for transparent treatment for 5 min, then replace with fresh xylene for transparent treatment for another 5 min;

[0181] 4.8 Sealing: Use sealing agent to seal the transparent rat testicular tissue slices. After sealing, set aside for use;

[0182] The stained rat testicular tissue sections were observed under an ordinary optical microscope to observe the structure of the testicular spermatogenic epithelium and diagnose tissue damage; the results of rat testicular HE staining are shown in Figure 8 As shown by Figure 8 It can be seen that the testicular structure of rats in the lead acetate poisoning group showed obvious pathological changes: in the control group, normal 5-7 layers of spermatogenic cells were visible in the testicular seminiferous tubules of rats, and the cells were pole-oriented and arranged neatly. A small number of short spindle-shaped supporting cells were visible between the spermatogenic cells, and sperm production was seen in the middle of the tubular lumen; in the 0.20% PbAC poisoning group, the spermatogenic cells in the testicular seminiferous tubules of rats were significantly reduced, with only 2-3 layers, and a small number of sperm were seen in the middle of the tubular lumen; while in the 0.40% group, the spermatogenic cells in the seminiferous tubules disappeared, leaving only short spindle-shaped or oval supporting cells, the tubular wall was slightly collapsed, and no sperm was produced in the tubular lumen.

[0183] Example 8

[0184] This embodiment discloses a method for establishing a rat sperm lead poisoning model, comprising the following steps:

[0185] Step (1), extracting EVs from seminal plasma of healthy male rats;

[0186] The experimental subjects were the same as step 2.1 of Example 7;

[0187] EVs refer to double-layer membrane vesicles that fall off the cell membrane or are secreted by cells. They have a diameter of 50-1000 nm and include exosomes, large vesicles, and apoptotic bodies. Therefore, 50kD ultrafiltration tube centrifugation is used for extraction. The extraction steps are as follows:

[0188] 1.1 Collection of seminal vesicle fluid and prostatic fluid: After killing healthy male rats by cervical dislocation, the seminal vesicle and prostate were taken and placed in PBS aqueous solution (PH=7.4), cut open to allow the contents to flow out, and the tissues were repeatedly rinsed and discarded. The collected fluids were seminal vesicle fluid and prostatic fluid respectively;

[0189] 1.2 Collection of epididymal fluid: Cut the intact epididymis of the rats after collecting seminal vesicle fluid and prostatic fluid longitudinally, rinse repeatedly with PBS solution, collect semen, centrifuge, and the upper layer is the epididymal fluid;

[0190] 1.3 Prepare rat seminal plasma, which is prepared by 65% ​​seminal vesicle fluid, 25% prostatic fluid and 10% epididymal fluid;

[0191] 1.4 Extracting extracellular vesicles (EVs) from rat seminal plasma;

[0192] 1.4.1 Transfer the rat seminal plasma into a sterile EP tube and centrifuge at 13000g for 10 min at 4°C to remove cells and other substances;

[0193] 1.4.2 Take the centrifuged supernatant, add it to the ultrafiltration tube, add 10 mL of exosome diluent, and centrifuge it in a horizontal rotor centrifuge. The centrifugation conditions are 22 ° C and 3000 g centrifugal force until the liquid volume in the ultrafiltration tube is 2 mL to remove small molecules, salts and other substances;

[0194] 1.4.3 Add 15 mL of exosome dilution solution to the ultrafiltration tube again and repeat the above steps until the liquid volume in the ultrafiltration tube is about 250 μL. Puff the ultrafiltration tube to wash out the liquid to obtain healthy male rat seminal plasma EVs;

[0195] Healthy male rat seminal plasma EVs were frozen at -80°C;

[0196] Step (2): Identification of EVs in seminal plasma of healthy male rats

[0197] 2.1 Determination of the morphology of EVs in seminal plasma of healthy male rats

[0198] Transmission electron microscopy (TEM) was used to observe the double-layered capsule ultrastructure of EVs in seminal plasma of healthy male rats:

[0199] Use tweezers to clamp the edge of a 300-mesh copper mesh, place the copper mesh on an inclined silica gel plate and fix it, resuspend the healthy male rat seminal plasma EVs extracted by ultrafiltration in 300 μL PBS aqueous solution (PH=7.4), take 100 μL of the resuspension, drip it on the front of a 2-mm-diameter carbon-loaded copper mesh, dry it in a fume hood, drip 3 wt% sodium phosphotungstate aqueous solution (pH=6.8), negatively stain it at room temperature for 5 min, wash it gently in ultrapure water droplets once, dry it at room temperature, bake it under an incandescent lamp for 2 min, observe it with a microscope, and observe the morphology of male rat seminal plasma EVs at 80 FkV and take pictures; Fig. 9 It can be seen that the extracted vesicles are spherical and have a double-layer plasma membrane structure, which is consistent with the structural characteristics of extracellular vesicles;

[0200] 2.2 Nanoparticle Tracking Analysis (NTA)

[0201] The Brownian motion of each particle was tracked and analyzed, and the particle size distribution and concentration of EVs in male rat seminal plasma were calculated using the Stockes-Einstein equation:

[0202] 2 μL of rat seminal plasma EVs was drawn into a 5 mL EP tube, and 2 mL of ultrapure water was added to dilute the sample to be tested 1000 times. After the diluted sample was mixed, it was drawn through a 0.22 μm filter membrane with a 1 mL syringe, and the filtrate was centrifuged at 5000 x g for 1 min to remove small bubbles in the sample. The centrifuged sample was injected into the NS300 nanoparticle tracking analyzer (NS300, Malvern), and after the sample number page was stable, 5 different fields of view were selected for measurement, and the measured data were analyzed using NTA3.2 software.

[0203] The setting parameters of the NS300 nanoparticle tracking analyzer are as follows: CameraLevel is set to 13, TimeofVideoRecords is set to 60s, DetectThreshold is set to 6, and other parameters use the system default parameters; Fig.10 It can be seen that the diameter of the vesicles extracted from each group is in the range of 50-150nm, the particle size peak is narrow and the size is uniform, which is consistent with the size characteristics of extracellular vesicles, and the concentration distribution is 5.82×10 8 -2.57×10 9 ;

[0204] 2.3 Protein marker identification

[0205] Western blotting was used to identify the surface proteins CD9, CD63, and CD81 on the membrane of male rat seminal plasma EVs;

[0206] 2.3.1 Protein sample preparation

[0207] Dissolve RIPA lysis buffer (strong), add PMSF (phenylmethylsulfonyl fluoride) at a volume ratio of PIRA:PMSF = 100:1 to make the final concentration of PMSF 1 mM, mix well, and obtain cell lysis buffer;

[0208] Take 50 μL of rat seminal plasma EVs, add 150 μL of prepared cell lysis buffer, mix well, lyse on ice for 30 min, centrifuge at 13000 x g for 15 min at 4°C, aspirate the supernatant and place it in a new 1.5 mL EP tube to obtain the protein stock solution; during the aspiration process, be careful not to aspirate the precipitate, and all operations must be performed on ice;

[0209] 2.3.2 Protein concentration determination

[0210] The protein concentration of the protein stock solution was detected by BCA protein concentration assay (enhanced, Biyuntian), and the operation steps are as follows:

[0211] 2.3.2.1 Place the protein stock solution in a 1.5 mL EP tube and dilute the protein stock solution 2 times with PBS aqueous solution (PH = 7.4) to obtain the sample to be tested; the sample to be tested is placed on ice for later use;

[0212] 2.3.2.2 Prepare 0.5 mg / mL BSA protein standard solution and set aside;

[0213] 2.3.2.3 According to the required amount of sample (200 μL for each sample), prepare BCA working solution by mixing BCA Solution A and BCA Solution B in a ratio of 50:1, mix thoroughly and set aside;

[0214] 2.3.2.4 Add 0.5 mg / mL BSA protein standard solution to a 96-well plate at 0 μL, 1 μL, 2 μL, 4 μL, 8 μL, 12 μL, 16 μL, and 20 μL, and then add the corresponding PBS aqueous solution (PH = 7.4) to make the standard concentrations: 0 mg / mL, 0.025 mg / mL, 0.05 mg / mL, 0.1 mg / mL, 0.2 mg / mL, 0.3 mg / mL, 0.4 mg / mL, and 0.5 mg / mL, respectively. Add 2 μL of sample to each well, and make up all wells with 20 μL of PBS aqueous solution (PH = 7.4);

[0215] 2.3.2.5 Add 200 μL of the prepared BCA working solution to each well, tap gently to mix, and incubate at 37°C in a constant temperature box for 30 min. Stop incubation when the standard shows a clear blue color.

[0216] 2.3.2.6 Place the 96-well plate in a multifunctional microplate reader and measure the absorbance of each well at a wavelength of 562 nm;

[0217] 2.3.2.7 Use ELISAcalc software to draw the standard curve equation, substitute the absorbance value of the sample to be tested to obtain the calculated protein concentration value in the sample to be tested. The actual protein concentration value is the calculated protein concentration value × 10;

[0218] 2.3.3 Leveling and denaturation: The protein concentration of male rat seminal plasma EVs obtained by BCA protein concentration determination method in 2.3.2 was evenly mixed with 5× protein loading buffer in a ratio of 4:1, and the concentration was increased at 100°C. The protein concentration of the seminal plasma EVs sample was adjusted with PBS aqueous solution (PH = 7.4) to obtain a leveled protein dilution. The protein concentration in the leveled protein dilution was 4 mg / mL. The leveled protein dilution was heated for 15 minutes to denature the protein, cooled to room temperature and stored in a -20°C refrigerator for later use;

[0219] 2.3.4SDS-PAGE electrophoresis

[0220] 2.3.4.1 Gel preparation: According to the instructions of the SDS-PAGE gel preparation kit (Biyuntian), 12 wt% separation gel and 5 wt% concentration gel were prepared;

[0221] 2.3.4.2 Glue filling: Clean the glass plate for glue making and dry it in a constant temperature oven. Align the bottoms of the long and short plates and put them into the glue rack. Clamp the device and add the prepared 12% separation glue into the glass plate along the edge with a 1mL pipette (add to 2 / 3 of the short plate). Then add a small amount of anhydrous ethanol to seal it to prevent the glue from contacting the air. Let it stand at room temperature for 30 minutes. After the separation glue solidifies, pour out the alcohol and absorb it with filter paper. Use the same method to fill the prepared 5% concentrated glue. Insert the comb obliquely in time to avoid bubbles. Let it solidify at room temperature for 30 minutes.

[0222] 2.3.4.3 SDS-PAGE electrophoresis: Pull out the comb, fill it with the prepared 1× electrophoresis buffer, add 5μL of color pre-stained protein marker (170kD) from the leftmost lane, add 40μg of leveled protein diluent sample to the sample well; install the electrophoresis tank and fill it with electrophoresis buffer, turn on the power, run the electrophoresis at 80V for 30min, and when the sample enters the separation gel and forms a straight line, run the electrophoresis at 120V for 80min;

[0223] 2.3.5 Transfer (semi-dry method) and blocking

[0224] 2.3.5.1 Cut polyvinylidene fluoride (PVDF) membrane to a size of 5 cm × 8 cm;

[0225] 2.3.5.2 Soak the PVDF membrane in anhydrous ethanol for 2 minutes to activate it;

[0226] 2.3.5.3 Transfer the activated PVDF membrane, filter paper and gel to the transfer solution prepared in step 1.4 of Example 1 and soak them at room temperature for 30 seconds to fully wet them. Turn on the semi-dry transfer apparatus, cut the gel according to the position of the protein marker, and place them in the order of filter paper (negative) - PVDF membrane - gel - filter paper (positive). Use a roller to compact them during the process so that there are no bubbles between each layer.

[0227] 2.3.5.4 Cover the transfer apparatus with the cover plate and transfer at a constant voltage of 20V for 20 minutes;

[0228] 2.3.5.5 Rapid blocking solution (PBSTw, Bio-Tech) was used as the blocking solution. After the transfer was completed, the membrane was washed with PBST washing solution on a decolorizing shaker for 2 minutes, and then placed in the blocking solution for 1 hour at room temperature.

[0229] 2.3.6 Incubation with primary and secondary antibodies

[0230] 2.3.6.1 Prepare CD9, CD63, and CD81 primary antibodies at a volume ratio of primary antibody diluent: antibody = 1000:1, blot the PVDF membrane with filter paper, place it in the primary antibody box, and incubate it overnight on a shaker in a cold storage (4.3°C);

[0231] 2.3.6.2 After the primary antibody incubation, wash the membrane three times with PBST washing solution on a shaker, each wash for 15 minutes;

[0232] 2.3.6.3 Prepare the secondary antibodies (HRP labeled) corresponding to the primary antibodies in a volume ratio of secondary antibody diluent: antibody = 2000:1. Blot the membrane with filter paper and place it in the secondary antibody box. Incubate at room temperature for 1 hour.

[0233] 2.3.6.4 After the secondary antibody incubation, wash the membrane three times with PBST washing solution on a shaker, each wash for 15 minutes;

[0234] 2.3.7 Gel imaging system analysis

[0235] ECL ultra-sensitive luminescent solution A solution: B solution = 1:1 equal volume mixed thoroughly, the washed PVDF membrane was placed in a dish containing luminescent solution, placed in a gel imaging system (Fusion FX) for exposure and photography, and the bands were analyzed using ImageJ software; Fig.11 It can be seen that the three protein indicators CD9, CD63 and CD81 were all expressed in the extracted samples, which is consistent with the characteristics of extracellular vesicle proteins;

[0236] Step (3), determining the effect of seminal plasma EVs of rats exposed to different lead concentrations on normal rat sperm:

[0237] EVs from seminal plasma of rats exposed to different lead concentrations were extracted using the same extraction method as step (1), and they were co-cultured with normal sperm of male rats;

[0238] 3.1 Determine the effect of seminal plasma EVs of rats exposed to different lead concentrations on sperm motility of normal rats;

[0239] Sperm from the cauda epididymis of healthy rats was extracted by the same extraction method as in 2.1 of Example 1. The mixture was liquefied in a 37°C water bath for 20 min. 3 mL of the prepared BWW medium was placed at the bottom of a 15 mL sterile centrifuge tube. 2 mL of liquefied semen was slowly added along the tube wall. The mixture was centrifuged at 900 × g for 5 min to separate the seminal plasma from the sperm. The upper liquid was discarded, and the sperm mass was resuspended in 2 mL of BWW medium to prepare a sperm suspension. 5 μL of the sperm was dripped onto a disposable sperm analysis standard slide (4 warehouses, Spain). The concentration of the sperm suspension was evaluated using the SSA-II sperm automatic detection and analysis system. The sperm suspension was adjusted with the BWW medium to make a sperm cell concentration close to 1 × 10 7 / mL, take two portions of 1mL sperm suspension each time in a 24-well plate, add rat seminal plasma EVs exposed to different lead concentrations and healthy male rat seminal plasma EVs, so that the content of rat seminal plasma EVs in 1mL sperm suspension is 10μg / μL, place incubator at 37°C, 5% CO2, 95% humidity, incubate, and detect sperm motility at 1h and 4h respectively. The detection index is the same as 2.2 in the analysis of semen quality in Example 1; the detection results of the effect of healthy male rat seminal plasma EVs on normal rat sperm motility are shown in Table 8:

[0240] Table 8

[0241]

[0242] Note: * indicates P < 0.05, ** indicates P < 0.01;

[0243] The test results of the effects of EVs from rat seminal plasma exposed to different lead concentrations on sperm motility of normal rats (incubated for 15 min) are shown in Table 9:

[0244]

[0245]

[0246] Table 9

[0247] The test results of the effects of seminal plasma EVs of rats exposed to different lead concentrations on the sperm motility of normal rats (incubated for 1 h) are shown in Table 10:

[0248] Table 10

[0249]

[0250] The test results of the effects of EVs from seminal plasma of rats exposed to different lead concentrations on the motility of sperm of normal rats (incubated for 2 hours) are shown in Table 11:

[0251] Table 11

[0252]

[0253]

[0254] The test results of the effects of EVs from seminal plasma of rats exposed to different lead concentrations on sperm motility of normal rats (incubated for 4 hours) are shown in Table 12:

[0255] Table 12

[0256]

[0257] From Table 8-12 and Fig.12It can be seen that at 15 minutes of incubation, no significant differences were found in the motility parameters of sperm co-cultured with EVs in the control group and the 0.20% PbAC-exposed group. However, after 1 hour of incubation, compared with the control group, the percentage of grade A sperm in the 0.20% PbAC-exposed group co-cultured with EVs was significantly reduced (P=0.047). After 2 hours of incubation, the percentage of grade A sperm in the 0.20% PbAC-exposed group co-cultured with EVs was significantly reduced (P=0.015), and the percentage of immotile sperm IM, i.e., the percentage of grade D sperm and the average curve velocity VCL were significantly increased (P=0.039). After 4 hours of incubation, the percentage of forward-moving sperm PR (P=0.022), the percentage of non-forward-moving sperm PRNP (P=0.044), the percentage of grade B sperm (P=0.020) and the percentage of grade C sperm (P=0.044) in the 0.20% PbAC-exposed group EVs co-cultured sperm were significantly reduced; the percentage of immotile sperm IM, i.e. the percentage of grade D sperm (P=0.044) was significantly increased. At the above four time points, when the sperm co-cultured with EVs in the seminal plasma of the 0.04% PbAC-exposed group rats was compared with the control group, no statistical differences were found in the various motility indicators between the two groups. Fig.12 Middle: A: Effect of extracellular vesicles of seminal plasma of healthy rats on sperm motility; B: Effect of extracellular vesicles of seminal plasma of lead-exposed rats on sperm motility after incubation for 1 hour; C: Effect of extracellular vesicles of seminal plasma of lead-exposed rats on sperm motility after incubation for 2 hours; D: Effect of extracellular vesicles of seminal plasma of lead-exposed rats on sperm motility after incubation for 4 hours;

[0258] 3.2 Determine the effect of seminal plasma EVs of rats exposed to different lead concentrations on sperm capacitation of normal rats;

[0259] Sperm capacitation can be evaluated by detecting the level of sperm tyrosine phosphorylation (P-Tvr) using Western Blot with rat anti-phosphotyrosine antibody clone 4G10 (Millipore) as follows:

[0260] 3.2.1 Sperm capacitation: Prepare sperm suspension according to the method in step 3.1. When culturing rat sperm, add 3 mg / mL bovine serum albumin (BSA) to the BWW medium, which is more conducive to sperm capacitation. Incubate in an incubator at 37°C and 5% CO2 for 4 hours to obtain capacitated sperm;

[0261] 3.2.2 Sperm protein lysis: Collect the capacitated sperm and centrifuge at 4°C, 12000xg for 5 min. A small amount of sperm sediment can be seen at the bottom of the EP tube. Carefully remove the supernatant and lyse the sperm protein according to the method in step 2.3.2. Add 50 μL of phosphatase inhibitor to the lysis buffer and operate on ice throughout the process;

[0262] 3.2.3 Western blotting: The remaining steps were the same as step 2.3, except that the PBS / PBST solution was replaced with TBS / TBST solution, and the cells were blocked with 5% BSA for 1 h at room temperature. The primary antibody was rat anti-phosphotyrosine 4G10 (1:1000 dilution; Merck, Germany), and the protein blot intensity was analyzed using ImageJ software;

[0263] Depend on Fig.14 It can be seen that compared with the blank group, the sperm protein tyrosine phosphorylation level of the healthy male rat seminal plasma EVs was significantly increased at around 70KD (P=0.028), and was significantly reduced at 40-55KD and 35-40KD (P=0.009, P=0.009); there was no significant difference in the sperm protein tyrosine phosphorylation level of the rats supplemented with the control group EVs and the 0.20% group EVs at 70KD, 40-55KD and 35-40KD, as shown in Figure 2. Fig.14 (C, D); Detection of Ca in sperm cells 2+ The calcium ion concentration in sperm of the EVs-supplemented group was significantly higher than that of the blank group (P=0.001); the calcium ion concentration in sperm of the control group supplemented with EVs was significantly higher than that of sperm of the 0.20% EVs-supplemented group (P<0.001); Fig.14 Middle: A: Western blotting to detect tyrosine phosphorylation of sperm proteins in the blank group and the group supplemented with EVs; B: Difference in tyrosine phosphorylation levels of sperm proteins in the blank group and the EVs group; C: Western blotting to detect tyrosine phosphorylation of sperm proteins in the rats supplemented with EVs in the control group and the 0.20% group; D: Difference in tyrosine phosphorylation levels of sperm proteins in the rats supplemented with EVs in the control group and the 0.20% group; E: Left: Ca2+ in sperm of rats in the blank group and the group supplemented with EVs 2+ Level difference, right: rat sperm Ca2+ supplemented with control group EVs and 0.20% group EVs 2+ Level differences;

[0264] 3.3 Determine the effect of seminal plasma EVs of rats exposed to different lead concentrations on the acrosome reaction of normal rat sperm;

[0265] The acrosome reaction test is a stable sperm function parameter, which is mainly evaluated by the structural integrity of the acrosome and the induction of the acrosome reaction. The operation steps are as follows:

[0266] 3.3.1 Sperm capacitation: Prepare sperm suspension according to the method in step 3.1, and incubate in an incubator at 37°C and 5% CO2 for 3 hours to obtain capacious sperm;

[0267] 3.3.2 Acrosome reaction: Ca2+ dissolved in DMSO was added to the capacitated sperm suspension. 2+ Carrier A23187, Ca2+ The final concentration of vector A23187 was 10 μmol / L and incubated in an incubator at 37°C and 5% CO2 for 1 h to induce acrosome reaction in sperm;

[0268] 3.3.3 Centrifugation and washing: The semen suspension after acrosome reaction was centrifuged at 600 x g for 5 min, the supernatant was removed, 1 mL of GENMED cleaning solution (Reagent A) was added, the particles were mixed, and the sperm cell count was performed on a disposable sperm analysis standard slide and adjusted to 2 × 10 7 / mL;

[0269] 3.3.4 Staining and fixation: Pipette 10 μL of sperm cells into a new 1.5 mL EP tube, add 10 μL of GENMED staining solution (Reagent B), mix well, incubate at room temperature in the dark for 30 min, then add 1 μL of GENMED fixation solution (Reagent C), mix well;

[0270] 3.3.5 Pushing and sealing: Immediately transfer 10 μL to one end of a clean adhesive slide, push the slide with another slide tilted 45°, add 20 μL of anti-fluorescence quenching sealing solution, and cover with a coverslip;

[0271] 3.3.6 Observation and counting: Immediately observe and count under a (confocal) fluorescence microscope (400X), observing green fluorescence - filter excitation wavelength 395nm, emission wavelength 510nm;

[0272] Under high-power microscope, the entire acrosome of sperm that has not undergone acrosome reaction shows uniform bright green fluorescence, and only the equatorial plane of the acrosome shows green fluorescence. The sperm head has no or low fluorescence, which is a reactive acrosome. At least 200 sperms should be randomly counted to calculate the rate of sperm acrosome reaction.

[0273] The results of the determination of the effect of healthy male rat seminal plasma EVs on the acrosome reaction of normal rat sperm are shown in Table 13:

[0274] Table 13

[0275]

[0276] The results of the determination of the effects of rat seminal plasma EVs exposed to different lead concentrations on the acrosome reaction of normal rat sperm are shown in Table 14:

[0277] Table 14

[0278]

[0279] From Table 13-14 and Fig.15It can be seen that compared with the blank group, the reactive acrosome (P=0.026) and acrosome reaction rate (12.65±2.62VS16.89±2.82, P=0.036) of sperm in the group supplemented with healthy rat seminal plasma EVs were significantly increased, indicating that extracellular vesicles may induce sperm to have acrosome reaction in advance. The analysis results of the effect of extracellular vesicles of seminal plasma of lead-exposed rats on sperm acrosome reaction showed that: compared with the control group, extracellular vesicles of seminal plasma of rats in the 0.20% PbAC-exposed group significantly increased the uncapacitated acrosome of sperm (P=0.002), and significantly decreased the reactive acrosome (P=0.001) and acrosome reaction rate (11.88±1.98VS 6.34±0.96, P<0.001), indicating that the extracellular vesicles in this group may have an inhibitory effect on the acrosome reaction of sperm. Fig.15 Middle: A: Acrosome reaction of rat sperm: CTC fluorescence staining, the uniform green fluorescence of the head in the left picture indicates uncapacitated acrosome, and the no fluorescence of the head in the right picture indicates reactive acrosome; B: The effect of extracellular vesicles in the seminal plasma of healthy rats on the acrosome reaction of rat sperm; C: The effect of extracellular vesicles in the seminal plasma of lead-exposed rats on the acrosome reaction of rat sperm;

[0280] 3.4 Determination of protein profiles of seminal plasma EVs in rats exposed to different lead concentrations

[0281] 3.4.1 Protein extraction and quantification: Prepare protein samples and determine protein concentration using the method in step 2.3 protein marker identification of Example 2;

[0282] 3.4.2 Protein reductive alkylation and enzymatic hydrolysis:

[0283] 3.4.2.1 Take 30 μg of protein solution sample from each sample and dilute to 100 μL with 25 mM ammonium bicarbonate aqueous solution to obtain a protein solution;

[0284] 3.4.2.2 Reduction alkylation: first add dithiothreitol (DTT) (Sigma) to the protein solution and mix well to make the final concentration of DDT to 10mM, and reduce at 95°C for 5min; add iodoacetamide (IAA) (Sigma) at a volume ratio of DDT:IAA = 1:5, mix well, and place in the dark at room temperature for 30min for alkylation; after the alkylation is completed, centrifuge at 20000xg for 10min to obtain the protein solution after reduction alkylation;

[0285] 3.4.2.3 The protein solution after reduction and alkylation was added to a 10 kD ultrafiltration tube, and washed three times with 200 μL of 8 M urea (13500 x g, centrifugation), and then washed twice with 200 μL of 50 mM ammonium bicarbonate aqueous solution (13500 x g, centrifugation), and the solution at the bottom of the ultrafiltration tube was discarded;

[0286] 3.4.2.4 Add the protein solution in the ultrafiltration tube to 150 μL of 50 mM ammonium bicarbonate aqueous solution, add trypsin (Promega) and Lys-C (intracellular protease) at a ratio of 1:50, and digest at 37°C for 16 h;

[0287] 3.4.2.5 After digestion is completed, centrifuge to collect the enzymatically digested peptide fragments: centrifuge at 13500xg to recover the peptide fragments into a new collection tube. To improve the recovery rate of the peptide fragments, wash the filter membrane twice with 200μL of 50mM ammonium bicarbonate aqueous solution, centrifuge and concentrate to dry to obtain the peptide fragments;

[0288] 3.4.3 Desalting with Monospin Desalting Column: Desalt the peptide fragments through Monospin desalting column, dry them and prepare for mass spectrometry analysis. The desalting method is as follows:

[0289] 3.4.3.1 Use 0.1% trifluoroacetic acid (TFA) solution to dissolve the dried peptide fragments to obtain a re-dissolved sample;

[0290] 3.4.3.2 Use 100% acetonitrile to activate the desalting column;

[0291] 3.4.3.3 Equilibrate the desalting column with 0.1% TFA solution;

[0292] 3.4.3.4 Add the reconstituted sample to the desalting column and centrifuge;

[0293] 3.4.3.5 Add 0.1% TFA solution to clean the desalting column;

[0294] 3.4.3.6 Add 50% acetonitrile solution, centrifuge, elute the peptide fragments, and collect the elution solution using a new EP tube;

[0295] 3.4.3.7 Centrifuge and concentrate the eluted solution to remove acetonitrile;

[0296] The dried peptide fragments were dissolved in 0.1% trifluoroacetic acid (TFA), desalted using a C-18 column, and concentrated by vacuum centrifugation;

[0297] 3.4.4 Liquid chromatography-tandem mass spectrometry (LC-MS / MS) detection:

[0298] 3.4.4.1 The polypeptide peptides concentrated by vacuum desalting were re-dissolved in mass spectrometry solution A, and then centrifuged at 13000 rpm for 5 min. The upper liquid was aspirated and slowly added to the loading bottle, and chromatographic separation was performed using the nanoliter flow rate HPLC liquid phase system EASY-nLC1200 (Thermo Scientific, USA);

[0299] 3.4.4.2 Analytical column (C-18, 1.9 μm, 75 μm×20 cm) was used to achieve gradient elution with 0.1% formic acid acetonitrile aqueous solution B (84% acetonitrile and 0.1% formic acid) at a flow rate of 300 nL / min;

[0300] 3.4.4.3 Orbitrap Fusion Lumos (Thermo Scientific, USA) mass spectrometer was used, positive ion detection was performed, primary mass spectrometry resolution was 70000, primary mass spectrometry scanning range was 300-1800 m / z, automatic gain control (AGC) was set to 1e6, maximum injection ion time was 50 ms, dynamic exclusion time (DE) was 60 s, secondary mass spectrometry resolution was 17500, isolation window was 2.0 m / z, higher energy collision dissociation (HCD) mode, and normalized collision energy (NCE) was set to 30 eV;

[0301] 3.4.5 Protein identification and quantitative analysis: The data were searched using Thermo Proteome Discoverer 2.5 to obtain protein ID sequences, and quality control analysis was performed using enzymatic efficiency. Protein and peptide characteristics were analyzed using: a. protein relative molecular mass distribution; b. peptide sequence length distribution; c. identified peptide number distribution; d. protein coverage distribution;

[0302] For relative quantification of polypeptide peptides, a more accurate primary mass spectrometry-related peptide peak intensity (PrecursorIntensity) is used as the label free quantitative parameter. When a protein is detected with multiple peptides in the search library, the peak intensities of all peptides detected for the protein are weighted to obtain the peak intensity (Abundance) of the protein expression. Fig.17 It can be seen that the relative molecular weight of proteins is mainly distributed in the range of 20-120KDa ( Fig.17 A); the number of proteins containing ≥2 unique peptides was 2954, accounting for 73.45% of the total number of proteins ( Fig.17 B); the longest peptide length is 9, and the average length is 12.63, which is in line with the reasonable range of peptide length ( Fig.17 C); the percentage of proteins with identification coverage in the range of [0,10%] was 38.59%, the percentage of proteins with coverage ≥20% accounted for 41.42% of the total proteins, and the average protein identification coverage was 20.14% ( Fig.17 D) Fig.17Middle: A: protein relative molecular weight distribution; B: unique peptide number distribution; C: peptide sequence length distribution; D: protein coverage distribution

[0303] Furthermore, the peak intensity of each protein in each peptide sample was normalized to obtain Abundance (Normalized), and the proteins in all samples were quantitatively analyzed by Abundance;

[0304] When comparing two groups, the normalized signal mean of all samples in each group was calculated to calculate the inter-group ratio Foldchange, and Student t-test was used to calculate the p-value of the two groups;

[0305] 3.4.5.1 For the difference statistics of biological replicates within the group that do not meet ≥3, proteins that meet the following two conditions are selected as differential proteins between groups: a. Fold change of the ratio between groups ≥4 or ≤0.25 (i.e. 1 / 4); b. #Unique Peptides ≥2;

[0306] 3.4.5.2 Statistics of differences in biological replicates ≥3 within the group Proteins that meet the following two conditions were selected as differential proteins between groups: a. Fold change between groups ≥1.2 or ≤0.8333 (i.e. 1 / 1.2); bp-value <0.05; The enzyme digestion efficiency of each sample was statistically analyzed through the Proteome Discoverer 2.4 database search results. The statistical results are shown in Table 15:

[0307] Table 15

[0308]

[0309] The total statistical results of mass spectrometry library search are shown in Table 16:

[0310] Table 16

[0311]

[0312]

[0313] The number of protein types of each sample obtained by searching the database is shown in Table 17:

[0314] Table 17

[0315]

[0316] 3.4.6 Bioinformatics analysis:

[0317] 3.4.6.1 Significant difference analysis: The data of peptide samples detected by mass spectrometry are statistically calculated by T test / U test between groups, and two parameter values, p-value and Foldchange, are obtained. Volcanoplot is drawn using these two parameters. The up-regulated proteins that meet certain Foldchange and p-value are represented by red dots, the down-regulated proteins are represented by green dots, and other proteins are represented by gray dots, such as Fig.18 and Fig.19 As shown;

[0318] 3.4.6.2 Cluster analysis: For differentially regulated proteins between groups, unsupervised hierarchical cluster analysis (Hierarchical cluster) was performed. The distances between multiple samples were calculated through protein expression data to form a distance matrix. The two classes with the closest distances were merged into a new class. The distances between the new class and the current classes were calculated. The new class was merged and calculated again until there was only one class. The expression of the selected differentially expressed proteins was used to calculate the direct correlation between the samples. In the cluster diagram, the horizontal axis represents the sample names between the groups, and the vertical axis represents the differentially expressed genes. In the diagram, red represents that the differentially expressed genes have high expression values ​​in the grouped samples, and blue represents that the differentially expressed proteins have low expression values ​​in the grouped samples. Fig. 20 and Fig.21 As shown;

[0319] 3.4.6.3GO enrichment analysis: GO has three ontologies, which respectively describe the molecular function, cellular location, and biological process of genes. GO analysis was performed on the differentially expressed proteins between groups. The 10 entries with the smallest p-value were selected to draw a barplot (all entries were displayed if there were less than 10 entries). In the barplot, the vertical axis is Numbers of Count (the number of genes matching the entry), and the horizontal axis is the entry. Figure 22-25 As shown;

[0320] 3.4.6.4 KEGG Pathway Enrichment Analysis: When performing pathway enrichment analysis, the differential proteins are first mapped to the pathways included in the KEGG database. Further, the probability of mapping the differential proteins to different pathways is calculated by the Fisher algorithm, which is the pathway enrichment analysis. P-value < 0.05 indicates that the pathway is significantly enriched and is not a low-probability event, but a pathway affected by the experimental treatment. Pathway analysis is performed on the differential proteins between groups, and the 15 entries with the smallest p-value are selected to draw a dotplot (all entries are displayed if there are less than 15 entries). In the dotplot, the horizontal axis is GeneRatio (the number of genes (Count) matched to the entry in the input list / the total number of genes identified in the corresponding category in the input list), and the vertical axis is the entry. The color of the dot indicates the p-value (the statistical significance level of the enrichment analysis), and the size of the dot indicates the Count (the number of genes matched to the entry). Figure 26-29 As shown;

[0321] The differential proteins in the extracellular vesicles of the epididymal fluid of lead-exposed rats and the control group are shown in Table 18:

[0322] Table 18

[0323]

[0324]

[0325] The differential proteins in the extracellular vesicles of the seminal plasma of lead-exposed rats and the control group are shown in Table 19:

[0326] Table 19

[0327]

[0328] As shown in Tables 18 and 19, compared with the control group, there were 397 differential proteins in the extracellular vesicles of the prostate fluid of the rats in the lead exposure group, of which 186 were up-regulated and 211 were down-regulated; there were 841 differential proteins in the extracellular vesicles of the seminal vesicle fluid, of which 341 were up-regulated and 500 were down-regulated; there were 37 differential proteins in the extracellular vesicles of the epididymal fluid, of which 14 were up-regulated and 23 were down-regulated; there were 7 differential proteins in the extracellular vesicles of the seminal plasma, of which 2 up-regulated proteins were very long chain acyl-CoA dehydrogenase (ACADVL) and cilium formation-related protein (TTC17), and 5 down-regulated proteins were non-specific serine / threonine protein kinase, choline transporter-like protein (CTL), Src kinase-associated phosphoprotein 2 (SKAP2), Ras-associated (RalGDS / AF-6) and pleckstrin homology domain 1 (RAPH1), heme binding protein 2 (HEBP2).

[0329] Example 9

[0330] This embodiment discloses a method for establishing a human sperm lead poisoning model, comprising the following steps:

[0331] Step (1): Extraction of human seminal plasma EVs

[0332] 1.1 Selection of experimental subjects (sperm donation volunteers)

[0333] Selection criteria: ① Age 18 years or older; ② No urogenital inflammation such as orchitis and epididymitis; ③ No reproductive system trauma; ④ No obvious abnormalities of reproductive organs such as testicles, epididymis and accessory glands (including cryptorchidism, spermatic cord torsion, epididymal nodules, varicocele, etc.); ⑤ No fertility-related genetic diseases;

[0334] Exclusion criteria: ① Abuse of tobacco and alcohol; ② Excessive and frequent staying up late; ③ Long-term high mental tension; ④ Insufficient secretion of sex hormones; ⑤ Recent use of drugs that damage the reproductive system;

[0335] The research in this invention was approved by the Ethics Committee of Xinxiang Medical College (Ethics Review Approval No.: XYLL-20170311);

[0336] Human semen donated by volunteers was frozen at -80°C;

[0337] 1.2 Extraction of EVs from human seminal plasma

[0338] 1.2.1 Thaw human semen stored at -80℃ naturally, transfer into sterile EP tubes, centrifuge at 4℃ and 13000g for 10min to remove sperm cells and other substances;

[0339] 1.2.2 Take the supernatant from the centrifugation, add it to the ultrafiltration tube, then add 10 mL of exosome diluent, and centrifuge it using a horizontal rotor centrifuge. The centrifugation conditions are 22°C and 3000g centrifugal force until the liquid volume in the ultrafiltration tube is 2 mL to remove small molecules, salts and other substances;

[0340] 1.2.3 Add 15 mL of exosome dilution solution to the ultrafiltration tube again and repeat the above steps until the liquid volume in the ultrafiltration tube is about 250 μL. Puff the ultrafiltration tube to wash out the liquid to obtain human seminal plasma EVs.

[0341] Human seminal plasma EVs were frozen at -80°C;

[0342] Step (2), identifying human seminal plasma EVs, the identification method is the same as the identification method for healthy male rat seminal plasma EVs in step (2) of Example 8;

[0343] Step (3), determining the effects of rat seminal plasma EVs exposed to different lead concentrations on human sperm;

[0344] 3.1 Determination of the effect of rat seminal plasma EVs exposed to different lead concentrations on human sperm motility: The determination method is the same as step 3.1 of Example 8;

[0345] The test results of the effect of human seminal plasma EVs on human sperm motility are shown in Table 20:

[0346] Table 20

[0347]

[0348] The test results of the effects of rat seminal plasma EVs exposed to different lead concentrations on human sperm motility (incubated for 1 h) are shown in Table 21:

[0349] Table 21

[0350]

[0351]

[0352] The test results of the effects of rat seminal plasma EVs exposed to different lead concentrations on human sperm motility (incubated for 4 hours) are shown in Table 22:

[0353] Table 22

[0354]

[0355] From Table 20-22 and Fig.13 It can be seen that compared with the control group, after incubation for 1 hour, the forward motility sperm PR (P=0.035), total motility percentage PR+NP (P=0.037), grade B sperm percentage (P=0.013) and average lateral swing amplitude ALH (P=0.022) of human sperm in the group supplemented with 0.20% extracellular vesicles were significantly reduced, and the immotile sperm percentage IM (P=0.034) or grade D sperm percentage (P=0.041) was significantly increased, and the difference was statistically significant. After incubation for 4 hours, the human sperm in the group supplemented with 0.20% extracellular vesicles had a significant The PR of sperm motility (P=0.005), the percentage of total motility (PR+NP) (P=0.025), the percentage of super-activated sperm (P=0.012), the percentage of grade B sperm (P=0.022), the average linear velocity (VSL) (P=0.032), the STR of motility (P=0.026), and the average whipping frequency (BCF) (P=0.028) were significantly decreased, and the percentage of immotile sperm (IM) (P=0.026), i.e. the percentage of grade D sperm (P=0.027), was significantly increased. Fig.13Middle: A: Effect of extracellular vesicles of spermatozoa from healthy males on sperm motility (incubation for 4 hours); B: Effect of extracellular vesicles of spermatozoa from lead-poisoned males on human sperm motility (incubation for 1 hour); C: Effect of extracellular vesicles of spermatozoa from lead-poisoned males on human sperm motility (incubation for 4 hours);

[0356] 3.2 The effects of rat seminal plasma EVs exposed to different lead concentrations on human sperm capacitation were determined as follows:

[0357] 3.2.1 Sperm capacitation: Prepare a sperm suspension according to the method of 3.1 in step (3) of Example 8. When culturing human sperm, add 3 mg / mL human serum albumin (HSA) to the BWW medium, which is more conducive to sperm capacitation. Incubate in an incubator at 37° C. and 5% CO 2 for 4 h to obtain capacitated sperm.

[0358] 3.2.2 Sperm protein lysis: the method is the same as step 3.2.2 of Example 8;

[0359] 3.2.3 Western Blotting: The method is the same as step 3.2.3 of Example 8; Fig.14 It can be seen that the detection of Ca in sperm cells 2+ The calcium ion concentration in sperm of the group supplemented with EVs was significantly higher than that of the blank group; the calcium ion concentration in sperm of the control group supplemented with EVs was significantly higher than that of sperm of the group supplemented with 0.20% EVs. Fig.14 Middle, F: Left: Ca in human sperm cells of blank group and group supplemented with EVs from healthy men 2+ Level difference, right: Human sperm Ca2+ supplemented with control EVs and 0.20% EVs 2+ Level differences;

[0360] 3.3 Determine the effect of seminal plasma EVs of rats exposed to different lead concentrations on the acrosome reaction of normal rat sperm;

[0361] The determination method is the same as step 3.3 of Example 2; the determination results of the effect of human seminal plasma EVs on human sperm acrosome reaction are shown in Table 23

[0362] Table 23

[0363]

[0364] The results of the determination of the effects of rat seminal plasma EVs exposed to different lead concentrations on the acrosome reaction of human sperm are shown in Table 24

[0365] Table 24

[0366]

[0367] From Table 23-24 and Fig.16It can be seen that compared with the blank group, the uncapacitated acrosomes of sperms supplemented with healthy male seminal plasma EVs (P=0.027) were significantly reduced, and the reactive acrosomes (P<0.001) and acrosome reaction rate (20.98±1.08VS 31.90±4.34, P=0.004) were significantly increased, indicating that extracellular vesicles may induce premature acrosome reaction in human sperms, as shown in Table 23, Fig.16 (B); Fig.16 (C) shows that compared with the control group, the uncapacitated acrosomes of human sperm in the seminal plasma EVs of rats in the group supplemented with 0.20% PbAC were significantly reduced (P=0.003), and the reactive acrosomes (P=0.001) and acrosome reaction rate (29.88±2.88VS20.32±2.54, P=0.001) were significantly increased, indicating that the lead-poisoned extracellular vesicles may pass through, and some mechanism leads to a decrease in the acrosome reaction rate of human sperm; Fig.16 Middle: A: acrosome reaction of human sperm; B: effect of extracellular vesicles of seminal plasma from healthy men on acrosome reaction of human sperm; C: effect of extracellular vesicles of seminal plasma from lead poisoning on acrosome reaction of human sperm.

[0368] Although the present invention has been disclosed as above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A preparation method of a preparation for optimizing sperm function by extracellular vesicle pathway, It is characterized in that Include the following steps: Step 1: Construct the plasmid; Amplified SKAP2-CDS sequence from PCR reaction of cDNA; The SKAP2-CDS sequence was inserted into the PHY-GFP plasmid between BamHI and EcoRI sites to obtain a recombinant plasmid; Step 2: Cell transfection and construction of cell lines; First, recombinant plasmid transfection was used to transfect reagent, and then HEK293T cells were transfected with recombinant plasmid products, purified, and supernatant was collected; HEK293T cells were cultured using the collected supernatant and fresh culture medium. After the culture was completed, the HEK293T cells were transferred to the culture medium containing puromycin for continued cultivation. After the continued cultivation, the HEK293T cells were transferred to the culture medium containing puromycin for subsequent cultivation to obtain the cell line; Step 3: Isolate exosomes; The cell line was expanded and cultured. After the amplification and culture was completed, the supernatant was washed, cultured, and the supernatant was collected; the supernatant was centrifuged, filtered, concentrated, and PBS was added to the concentrate and concentrated again to obtain an exosome suspension; The exosome suspension is a preparation for optimizing sperm function by the extracellular vesicle pathway.

2. The preparation method of a preparation for optimizing sperm function by an extracellular vesicle pathway according to claim 1, It is characterized in that In the step 1, the cDNA includes human cDNA and mouse cDNA; The human SKAP2-CDS sequence was obtained from the PCR amplification of human cDNA, and the mouse SKAP2-CDS sequence was obtained from the PCR amplification of mouse cDNA.

3. The preparation method of a preparation for optimizing sperm function by an extracellular vesicle pathway according to claim 2, It is characterized in that The sequence of the forward primer of the human SKAP2-CDS is shown in SEQ ID NO.1: 5’-TGATAAGGCCATTGCCGTGGATCCAATGCCCAACCCCAGCAGCAGCACC TCCT-3’; The sequence of the reverse primer of human SKAP2-CDS is shown in SEQ ID NO.2: 5’-CGCCGCTGCCGCCACCGCCGAATTCAATATCATATCATCTCCATTATGT AG-3’; The protein sequence of human SKAP2 is shown in SEQ ID NO.3: ATGCCCAACCCCAGCAGCACCTCCTCTCCCTACCCCCCTCCCTCCCTGAGGAAATTAGGAACCTGTTGGCAGATGTTGAAACATTTGTAGCAGATATACTGAAAGGAAAATTTATCCAAGAAAGCAAAGGAAAAGAGA GAATCCCTTATTAAGAAGATAAAAGATGTAAAAGTCTATCTATCTTCAGGAATTTCAAGACAAAGGTGATGCAGAAGATGGGGAAGAATATGATGACCCTTTTGCTGGGCCTCCAGACACTATTTCATTAGCCTCA GAACGATATGATAAAAGACGATGAAGCCCCCTCTGATGGAGCCCAGTTTCCTCCCAATTGCACAAGACCTTCCTTTTGTTCTAAAGGCTGGCTACCTTGAAAAACGCAGAAAAGATCACAGCTTTCTGGGATTT GAATGGCAGAAACGGTGGTGTGCTCTCAGTAAAACGGTTCTATTATTATGGAAGTGATAAAGACAAACAACAGAAAAGGTGAATTTGCAATAGATGGCTACAGTGTCAGAATGAATAACTCTAAGAAAAGGTGAATTTGCAATAGATGGCTACAGTGTCAGAATGAATAACTCTAAGAAAGGAT GGAAAGAAAGATTGCTGTTTTGAAATCTCTGCTCCCTGATAAACGTATATATCAGTTTACAGCAGCTTCTCCCAAAGATGCTGAAGAATGGGTACAGCTGAAATTTGTATGCAAGATCTGATATT ATTCCTGAGGATTATGATGAGAGAGGAGAATTATATGATGATGTTGATCATCCTCTACCAATAAGCAATCCACTAACAAGCAGTCAACCAATAGATGATGATGAAATTTATGAAGAACTTCCAGAAGAAGAAGAGGAC AGTGCTCCAGTGAAAGTGGAAGAACAAAGGAAGATGAGTCAGGATAGTGTCCATCACCTCAGGGGATAAGAGCACTGATTATGCTAATTTTTACCAGGGATTGTGGGATTGTACTGGAGCTTTTCTGATGAG TTGTCATTTAAGCGTGGTGATGTGATTTACATTCTTAGCAAGGAATACAATAGATATGGCTGGTGGTAGGAGAAATGAAGGGAGCCATTGGCTTGGTGCCTAAAGCCTACATAATGGAGATGTATGATTTGA; The sequence of mouse SKAP2-CDS forward primers is shown in SEQ ID NO.4: 5’-TGATAAGGCCATTGCCGTGGATCCAATGCCCAACCCCAGCTGTACCT CTT-3’; The sequence of mouse SKAP2-CDS reverse primer is shown in SEQ ID NO.5: 5’-CGCCGCTGCCGCCACCGCCGAATTCAATATCATATCATCTCCATTAGG TAG-3’; The protein sequence of mouse SKAP2 is shown in SEQ ID NO.6: ATGCCCAACCCCAGCTGTACCTCTTCTCCCCGGCCTCTCCCCTGAGGAAATTAGGAACCTGTTGGCAGATGTTGAAACATTTGTGGCAGACACTGAAAGGAAAATTTATCCAAGAAAGCCAAGGAAAAGAG AGAATCTCTCATTAAGAAGATAAAAGATGTAAAAGTCTGTCTATCTTCAGGAATTTCAAGACAAAGGTGATGCTGAGGACGGCGATGAATATGACGATCCCTTTGCTGGGCCTGCAGACACGATTTCCTTAGCCTC AGAGCGCTACGATAAAAGATGATGATGGCCCCCTCTGATGGAAACCAGTTTCCTCCATTGCAGCCCAGGACCTTCCTTTTGTCATAAAGGCTGGCTACCTGGAAAAACGCAGAAAAGATCACAGCTTTCTGGGGTT TGAATGGCAGAAACGGTGGTGTGCGCTCAGCAAAAACAGTGTTCTATTATTACGGGAGCGATAAAGACAAGCAACAGAAAAGGTGAATTTGCAATAGATGGCTATGTCAGAATGAACAACACCCCTTAGGAAGGAAGGA TGGAAAGAAAGATTGCTGTTTTGAAATCTGTGCTCCCCGACAAACGTATCTATCAGTTTACAGCAGCCTCTCCCCAAAGATGCTGAGGAATGGGTCCAGCAGCTGAAATTTATACAAGACCTGGGATCCGACG TTATTCCTGAGGATGATGAGGAAAGAGGAATTATATGATGACGTTGACCATCCTGCTGCCGTCAGCAGCCCGCAGAGGAGCCAGCCAATCGATGATGAGATTTATGAGGAGCTCCCAGAGGAGGAAGAGGACA CTGCTTCAGTGAAGATGGACGAGCAAGGGAAGGGAAGTCGGGACAGTGTGCATCACACCTCAGGAGATAAAAAGCACTGATTACGCTAATTTTTACCAGGGTCTGGGACTGCACTGGAGCTCTGTCTGATGAGT TGTCCTTTAAGCGTGGTGATGTGATTTACATTCTTAGCAAGGAATACAATAGATATGGCTGGTGGTAGGAGAGAGATGAAGGGAGCCATTGGCTTGGTGCCTAAAGCCTACCTAATGGAGATGTATGATTTGA.

4. The preparation method of a preparation for optimizing sperm function by an extracellular vesicle pathway according to claim 1, It is characterized in that In the first step, the PCR reaction system includes: 2×Phanta Max Master Mix, upstream primers, downstream primers, cDNA templates, DNA polymerase, deionized water, and the PCR reaction program includes: pre-deformation, denaturation, annealing, extension, circulation, and complete extension.

5. The preparation method of a preparation for optimizing sperm function by an extracellular vesicle pathway according to claim 1, It is characterized in that In the first step, the process of inserting the SKAP2-CDS sequence into the PHY-GFP plasmid between BamHI and EcoRI sites includes: using BamHI and EcoRI endonuclease to perform dual enzyme cleavage of SKAP2 PCR product and PHY-GFP plasmid, respectively, and using DNA ligase to connect the target gene fragment after the cleavage with the plasmid fragment to form a recombinant plasmid.

6. The preparation method of a preparation for optimizing sperm function by an extracellular vesicle pathway according to claim 1, It is characterized in that In the second step, the process of cell transfection specifically includes: (1) Use EZ trans transfection reagent for recombinant plasmid transfection: dilute the EZ Trans transfection reagent into serum-free high-saccharide DMEM culture medium, mix well, and obtain diluted transfection reagent; diluted reagent DNA into serum-free high-saccharide DMEM culture medium, mix well, add diluted transfection reagent, mix well, and place at room temperature to complete recombinant plasmid transfection to form EZTrans-DNA complex, that is, recombinant plasmid product; (2) Drop the EZ Trans-DNA complex into a culture dish containing HEK293T cells, disperse it evenly, and co-incubate the cells for transfection.

7. The preparation method of a preparation for optimizing sperm function by an extracellular vesicle pathway according to claim 1, It is characterized in that Include the following steps: Step (1) Extract milk source exosomes; The milk was centrifuged for the first time, and the supernatant for the first time was taken, the supernatant for the first time was centrifuged for the second time, and the supernatant for the second time was taken, and the supernatant for the second time was centrifuged for the supernatant for the third time, and the centrifugal pellet was collected, washed, and filtered to obtain an exosome suspension; The exosome suspension is milk-derived exosome; Step (2), exosomal protein coating; Milk-derived exosomes were loaded on SKAP2 protein by ultrasonic system: Milk-derived exosomes and SKAP2 protein were mixed in PBS at a mass ratio of 1:1, and after the ultrasonic treatment was completed, it was incubated to obtain SKAP2 protein coated with milk-derived exosomes; The SKAP2 protein coated with milk-derived exosomes is a preparation for optimizing sperm function by the extracellular vesicle pathway.

8. The preparation method of a preparation for optimizing sperm function by an extracellular vesicle pathway according to claim 7, It is characterized in that In the step (1): the conditions for the first centrifugation treatment are centrifuged at a temperature of 4°C for 25-35 minutes under 13000xg centrifugation force, the conditions for the second centrifugation treatment are centrifugation at a temperature of 4°C for 50-70 minutes under 100000xg centrifugation force, and the conditions for the third centrifugation treatment are centrifugation at a temperature of 4°C for 80-100 minutes under 145000xg centrifugation force; In the step (2): the ultrasonic treatment condition is to incubate at 20% amplitude for 30 s, cool for 2 min, cycle the ultrasonic-cooling process, and the number of cycles is 6 times; the incubation condition is to incubate at a temperature of 37 °C for 50-70 min.

9. A preparation method for the preparation of an extracellular vesicle pathway optimized sperm function as claimed in any one of claims 1-8. The preparation method for the extracellular vesicle pathway optimized sperm function prepared by the obtained extracellular vesicle pathway optimized sperm function.

10. The use of a formulation of an extracellular vesicle pathway optimized sperm function in a sperm injury repair system as claimed in claim 9.

Images