U1-snRNA for correcting F9 gene abnormal mRNA splicing and application thereof

Abstract

The invention relates to U1-snRNA for correcting F9 gene abnormal mRNA splicing and application of the U1-snRNA. The invention provides a U1-snRNA (ribonucleic acid) expression vector, a U1snRNADEL (ribonucleic acid DEL) vector, a specific U1-snRNA vector pU1Ex5 aiming at a fifth exon of an F9 gene, a splicing analysis report vector F9-E5-WT plasmid of the fifth exon of the F9 gene, and F9-E5-c.520 + 13Agt. The invention relates to a construction method of an F9-E5-c.520 + 13Agt splicing report vector, and further provides a construction method of the F9-E5-c.520 + 13Agt splicing report vector. After the construction of the F9-E5-c.520 + 13Agt is successful, a human embryonic kidney 293T cell is used for expression research of a mini-gene, or the F9-E5-c.520 + 13Agt; the G splicing report vector is used for preparing medicines or kits for treating various diseases caused by mRNA splicing abnormity. On the basis of the action mechanism of small nuclear RNA in mRNA splicing, U1-snRNA for a specific mutation site is accurately designed through a site-directed mutagenesis technology, an innovative solution is provided for the abnormal splicing problem caused by gene mutation according to the principle, and the method has wide application prospects and is suitable for popularization and application. Particularly in gene therapy of hereditary hemorrhagic diseases such as hemophilia B and the like.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular relates to a U1-snRNA for correcting abnormal mRNA splicing of an F9 gene and an application thereof. Background Art

[0002] Hemophilia B is an X-linked recessive bleeding disease caused by a deficiency in coagulation factor IX (FIX) encoded by the F9 gene. Due to insufficient FIX content or function, hemophilia B patients are prone to bleeding of varying degrees, especially in joints and muscles. Repeated bleeding can lead to joint damage, arthritis and disability, and even minor trauma can cause uncontrollable bleeding. In severe cases, patients may suffer from internal bleeding or cerebral hemorrhage, which is life-threatening. As the disease progresses, the patient's quality of life declines significantly and their daily activities are limited. The incidence of hemophilia B in men is about 1 / 3000, and the patient's clinical manifestations and severity of the disease are closely related to the mutation type of the F9 gene. The mutation forms of the F9 gene include missense mutations, nonsense mutations, synonymous mutations, intron mutations, gene deletions, duplications and insertion mutations. Currently, more than 1,600 F9 gene mutations have been reported in the database, among which intron mutations may lead to abnormal mRNA splicing, seriously affecting the content or function of FIX.

[0003] Currently, the main treatment for hemophilia B is FIX replacement therapy, but this therapy cannot directly solve the problem that the patient's own FIX content or activity cannot return to normal. Long-term use of replacement therapy is not only costly, but may also induce the production of anti-FIX antibodies in the patient's body, reducing the therapeutic effect. Traditional factor infusion therapy also faces similar problems, often accompanied by the production of inhibitors, further affecting the therapeutic effect. In recent years, non-factor drugs (such as emicizumab antibodies) have been used to help control bleeding, and gene therapy has also made some progress, especially the delivery of cDNA with high expression of FIX through AAV vectors, which can provide longer-term therapeutic benefits. However, these existing treatments still cannot completely solve the problem of long-term deficiency of FIX protein in patients.

[0004] For abnormal splicing caused by intron mutations, normal FIX expression can be restored by correcting the splicing abnormality. With the development of RNA technology, new treatments for hemophilia B and other inherited coagulation factor deficiencies are gradually emerging, especially the use of U1-snRNA to repair the abnormal expression of target genes. U1-snRNA regulates the correct splicing of mRNA by specific base pairing with the 5' splice donor site.

[0005] However, there is still no good solution to the problem of abnormal mRNA splicing caused by mutations in exon 5 of the F9 gene and its donor splicing site (such as c.520+13A>G). Summary of the invention

[0006] In view of the problem of abnormal mRNA splicing caused by the existing mutations in exon 5 of the F9 gene and its donor splicing site (such as c.520+13A>G), the present invention provides a U1-snRNA for correcting the abnormal mRNA splicing of the F9 gene and its application.

[0007] U1-snRNA regulates the correct splicing of mRNA by specific base pairing with the 5' splicing donor site. Mutations may interfere with this process, but by modifying the 5' end sequence of U1-snRNA, its binding with the donor site can be enhanced, thereby effectively correcting abnormal mRNA splicing and restoring normal protein expression. The present invention is based on this strategy.

[0008] The present invention provides a U1-snRNA molecule for repairing or inhibiting abnormal splicing of F9 gene, specifically comprising a basic vector plasmid for constructing specific U1-snRNA, a mini-gene splicing plasmid expression frame, an expression vector and application thereof in preparing a drug for treating hemophilia B.

[0009] The U1-snRNA vector of the present invention can effectively restore the normal mRNA splicing of the F9 gene and increase the expression level of FIX, thereby providing a new gene therapy strategy for patients with moderate and mild hemophilia B. By targeting the abnormal splicing donor site, the disease phenotype caused by non-classical splicing site mutations can be directly solved, which has potential clinical application value.

[0010] The purpose of the present invention can be achieved by the following technical solutions:

[0011] The present invention first provides a U1-snRNA expression vector, which is a wild-type U1-snRNA expression vector obtained by inserting a U1-snRNA fragment into a pSP64 vector through a BamH I restriction site, wherein the nucleotide sequence of the U1-snRNA gene target fragment is shown in SEQ ID NO.3.

[0012] The U1-snRNA expression vector includes a complete cDNA sequence of human U1-snRNA and can effectively express wild-type U1-snRNA.

[0013] The present invention further provides a U1snRNADEL vector, which is a new vector obtained by using the U1-snRNA expression vector as a template and removing the sequence between the Bcl I and Bgl II restriction sites of the U1-snRNA plasmid by site-directed mutagenesis, and the sequence of the U1snRNADEL vector is shown in SEQ ID NO. 6. Compared with U1-snRNA, it has a sequence of more than a dozen nucleotides less, making it more convenient to construct a specific vector.

[0014] The U1snRNADEL vector of the present invention can rapidly construct a specific U1-snRNA expression vector by simplifying the site-directed mutagenesis operation, overcomes the shortcomings of the traditional method of complex and inefficient multiple site-directed mutagenesis operations, and is widely applicable to the field of gene therapy and regulation research.

[0015] The present invention further provides a method for constructing a U1snRNADEL vector, comprising the following steps:

[0016] Using the wild-type U1-snRNA plasmid as a template, a site-directed mutagenesis kit was used to perform site-directed mutagenesis, and the sequence between the Bcl I and Bgl II restriction sites of the U1-snRNA plasmid was removed to obtain the U1snRNADEL vector, wherein the site-directed mutagenesis primers are shown in SEQ ID NO.4 and SEQ ID NO.5, respectively.

[0017] The present invention also provides a specific U1-snRNA vector (pU1Ex5) for exon 5 of the F9 gene, using the U1snRNADEL vector as a template and using a site-directed mutagenesis kit to perform site-directed mutagenesis, and the binding sequence (F9-Ex5-WT-U1snRNA, TATGACCTG ) was inserted between the Bcl I and Bgl II restriction sites of the U1snRNADEL vector to obtain the pU1Ex5 plasmid.

[0018] The present invention also provides a method for constructing a specific U1-snRNA vector (pU1Ex5) targeting exon 5 of the F9 gene, comprising the following steps:

[0019] Using the U1snRNADEL vector as a template, a site-directed mutagenesis kit was used to perform site-directed mutagenesis. The binding sequence (F9-Ex5-WT-U1snRNA, TATGACCTG ) was inserted between the Bcl I and BglII restriction sites of the U1snRNADEL vector to obtain the pU1Ex5 plasmid, wherein the site-directed mutagenesis primers are shown in SEQ ID NO.7 and SEQ ID NO.8, respectively.

[0020] The pU1Ex5 of the present invention specifically targets the conserved sequence near the splicing donor site of the F9 gene. Its preparation can be prepared by vector expression, in vitro transcription, chemical synthesis and other methods, providing researchers with multiple options to improve the efficiency of splicing repair.

[0021] The present invention also provides a method for constructing a F9 gene exon 5 splicing analysis reporter vector F9-E5-WT plasmid, using a plasmid pTB template, inserting a target fragment of the F9 gene into the Ndel I restriction site of the plasmid pTB to obtain the F9-E5-WT plasmid, wherein the sequence of the target fragment of the F9 gene is as shown in SEQ ID NO.11, which includes a portion of intron 4 of the F9 gene, a complete exon 5 and a portion of intron 5.

[0022] The present invention also provides a method for constructing an F9-E5-c.520+13A>G splicing reporter vector. The wild-type F9-E5-WT plasmid is used as a template for site-directed mutagenesis, and a site-directed mutagenesis kit is used to perform site-directed mutagenesis to obtain the F9-E5-c.520+13A>G splicing reporter vector, wherein c.520 indicates that this is a nucleotide number, which is the 520th nucleotide position relative to the coding region of the reference gene F9 gene, the position of the coding region is counted from the ATG start codon, and each nucleotide number in the coding sequence increases sequentially, +13 refers to the 13th intron base after the 5th exon of the mutation, and this mutation is located in the post-E5 intron region, A>G indicates that the adenine A originally at the c.520+13 position is replaced by guanine G, and when the site-directed mutagenesis kit is used to perform site-directed mutagenesis to obtain the F9-E5-c.520+13A>G splicing reporter vector, the primers are respectively as shown in SEQ ID NO.12 and as shown in SEQ ID NO.13.

[0023] The present invention also provides the use of a F9-E5-c.520+13A>G splicing reporter vector. After the F9-E5-c.520+13A>G splicing reporter vector is successfully constructed, human embryonic kidney 293T cells are used to study the expression of the minigene.

[0024] The present invention also provides the use of a F9-E5-c.520+13A>G splicing reporter vector, and the F9-E5-c.520+13A>G splicing reporter vector is used to prepare drugs or kits for treating various diseases caused by abnormal mRNA splicing.

[0025] The present invention provides a nucleic acid therapeutic vector for treating various diseases caused by abnormal mRNA splicing. Correct splicing of mRNA is a key step in gene expression regulation, and any mutation that affects this process may cause disease. The therapeutic vector is particularly suitable for abnormal mRNA splicing caused by intron splicing site mutations, such as classic donor or acceptor splicing site mutations, or mutations in regulatory regions near non-classical splicing sites. Such mutations often lead to abnormal mRNA splicing products, thereby causing protein dysfunction or loss. By correcting these splicing errors, the vector of the present invention can restore the normal mRNA splicing process, and is expected to provide an effective gene therapy method for related diseases.

[0026] The U1-snRNA of the present invention can partially repair abnormal mRNA splicing caused by intron mutations by introducing a base sequence that is completely complementary to the splicing donor site of the F9 gene, thereby providing an effective approach for gene therapy methods based on the "mRNA splicing correction" strategy, thereby correcting congenital defects at the mRNA and protein levels, and has broad application prospects.

[0027] The present invention is derived from an in-depth study of the molecular mechanism of hemophilia B and its related gene mutations. Hemophilia B is a coagulation factor IX (FIX) deficiency caused by F9 gene mutations, and its main clinical manifestation is bleeding tendency. Studies have shown that splicing site mutations at the junction of introns and exons of the F9 gene may cause abnormal splicing of mRNA, thereby affecting the normal production and function of FIX. However, the current repair technology for this type of abnormal splicing is still relatively limited, especially the precise repair method based on the mutated splicing site.

[0028] Based on this problem, the present invention proposes a gene splicing repair strategy mediated by U1-snRNA. U1-snRNA is a small nuclear RNA naturally present in cells, which is responsible for recognizing and binding to the 5' splicing donor site, thereby initiating the splicing process of the mRNA precursor. By designing U1-snRNA that is highly complementary to a specific mutation site, the present invention aims to supplement the function of the mutation site, restore the normal splicing process, and repair the abnormal mRNA splicing defect caused by the mutation.

[0029] Specifically, the present invention uses a specific U1-snRNA vector (such as pU1Ex5), which can recognize and bind to the donor splicing site near the mutation c.520+13A>G in exon 5 of the F9 gene, thereby effectively restoring normal mRNA splicing. In addition, the present invention simplifies the construction process of U1-snRNA by improving the U1snRNADEL vector, thereby improving the efficiency of experimental operations.

[0030] The principle of the invention is based on the mechanism of action of small nuclear RNA in mRNA splicing, especially the recognition function of U1-snRNA for 5' splice donor sites. Through site-directed mutagenesis technology, the present invention can accurately design U1-snRNA for specific mutation sites, thereby achieving repair of abnormal splicing. This principle provides an innovative solution to the problem of abnormal splicing caused by gene mutations, and has broad application prospects, especially in gene therapy for hereditary bleeding diseases such as hemophilia B.

[0031] Compared with the prior art, the advantages and beneficial effects of the present invention are embodied in the following aspects:

[0032] Accurately repair abnormal mRNA splicing: The present invention can accurately identify and repair the F9 gene mutation site (such as c.520+13A>G) by designing specific U1-snRNA, and restore normal mRNA splicing. This method overcomes the limitation of traditional gene therapy that cannot effectively solve splicing abnormalities, and improves the repair effect of mutation splicing defects.

[0033] Simplified operation process: The present invention improves the construction method of U1-snRNA and adopts the U1snRNADEL vector, making the design and synthesis of specific U1-snRNA more convenient and can be completed with only one site-directed mutagenesis operation, greatly reducing the complexity and time cost of the experiment.

[0034] Wide applicability: This technology is not only suitable for the repair of abnormal splicing of the F9 gene, but also has potential for broad application. It can be extended to other genetic diseases involving splicing site mutations, providing a new treatment idea for abnormal splicing caused by multiple gene mutations.

[0035] Lower treatment costs: Compared with traditional FIX replacement therapy, the present invention can fundamentally restore the normal expression and function of FIX by repairing the splicing defects of autologous genes, which is expected to reduce patients' dependence on exogenous coagulation factor replacement therapy and reduce long-term treatment costs.

[0036] Potential commercial value: This invention provides a new tool for gene therapy based on mRNA splicing repair, which has obvious application prospects and commercialization potential, especially in the treatment of hereditary bleeding diseases such as hemophilia B, and can provide technical support for the development and patent application of related gene therapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 It is a schematic diagram of the structure of the U1-snRNA plasmid vector of the present invention.

[0038] Figure 2 Schematic diagram of the construction of the F9 splicing plasmid of the present invention.

[0039] FIG3 is a minigene splicing analysis performed in HEK293T cells to evaluate the effect of the F9 intron variant c.520+13A>G on mRNA splicing; FIG3 includes Figure 3a , Figure 3b , Figure 3c , Figure 3d .

[0040] in, Figure 3a The schematic diagram of the construction of the wild-type minigene splicing plasmid, the specific primers for splicing product analysis are indicated by black arrows, and the exon and intron sequences are indicated by blue and gray boxes, respectively;

[0041] Figure 3b The results of in vitro mini-gene splicing experiments and splicing pattern diagram of the c.520+13A>G mutation in intron 5 of the F9 gene;

[0042] Figure 3c The sequence diagrams are of the abnormal mRNA splicing product with exon 5 deletion, 12 bases inserted into intron 5, and the normal mRNA splicing product of exon 5;

[0043] Figure 3d The capillary electrophoresis results show the relative proportions of different mRNA splicing products of the intronic mutant minigene (F9-E5-c.520+13A>G) and the corresponding wild-type minigene plasmid. The X-axis is the size of the amplified product (bp), and the Y-axis is the fluorescence intensity (FUs). Each peak area represents the relative proportion of each product.

[0044] FIG4 is the electrophoresis result of U1-snRNA correcting abnormal splicing of exon 5 of F9 gene; FIG4 includes Figure 4a , Figure 4b , Figure 4c .

[0045] in, Figure 4a The diagram is a schematic diagram of the construction of specific U1snRNA (pU1Ex5), where the exon sequence and intron sequence are represented by uppercase and lowercase letters, respectively, the mRNA sequence that binds to the specific U1snRNA is marked with a box, and the mutation site is marked in red bold;

[0046] Figure 4b The electrophoresis results show the mRNA splicing products after co-transfection of F9-E5-c.520+13A>G with pU1Ex5, and the right side shows the splicing pattern diagram;

[0047] Figure 4c It is the ratio of different mRNA splicing products detected by fluorescence co-amplification PCR combined with capillary electrophoresis. DETAILED DESCRIPTION

[0048] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0049] Example 1

[0050] Method for constructing wild-type U1-snRNA expression vector.

[0051] Human genomic DNA was used as a template and the Q5 high-fidelity PCR amplification kit from NEB (New England Biolabs, USA) was used to amplify a 596 bp U1-snRNA fragment.

[0052] Among them, BamHI restriction enzyme cleavage site bases and corresponding protective bases (BamHI: CGC^GGATCC^GCG, that is, CGC at the head and GCG at the tail are protective bases, and the GGATCC sequence in the middle is the restriction enzyme cleavage site recognition sequence) are added to both the forward primer and the reverse primer. The base sequences of the designed amplification primers are as follows:

[0053] F: CGCGGATCCGCGTAAGGACCAGCTTCTTTTGGGA (SEQ ID NO. 1)

[0054] R: CCGGGATCCGCGTTAGCGTACAGTCTACTTTTGAAA (SEQ ID NO. 2)

[0055] The amplified U1-snRNA gene target fragment was subjected to 2% agarose gel electrophoresis to identify the purity and brightness of the band, and was sent to BGI for sequencing to verify the fragment sequence. The nucleotide sequence of the U1-snRNA gene target fragment is shown in SEQ ID NO.3, and the BamH I restriction site and the 5' tail sequence of U1-snRNA are represented by capital letters.

[0056] taaggaccagcttctttggggagaacagacgcaggggcgggagggaaaaagggagaggcagacgtcacttccccttggcggctctggcagcagattggtcggttgagtggcagaaaggcagacggggactgggcaaggcactgtcggtgacatcacggacagggcgacttctatgtagatgaggcagcgcag aggctgacgtcttcgccacttgctgcttcaccacgaaggagttcccgtgccctgggagcgggttcaggaccgctgatcggaagtgagaatcccagc tgtgtgtcagggctggaaagggctcgggagtgcgcggggcaagtgaccgtgtgtgtaaagagtgaggcgtatgaggctgtgtcggggcagaggccca agatct cATACTTACCTGgcaggggagatacca tgatca cgaaggtggttttcccagggcgaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctgactttctggagtttcaaaagtagactgtacgctaa (SEQ ID NO. 3).

[0057] The amplified U1-snRNA fragment is inserted into the pSP64 vector through the BamH I restriction site to obtain a wild-type U1-snRNA expression vector, which specifically includes the following steps:

[0058] (1) Purification of PCR amplification products by gel tapping: A gel tapping purification kit (Kangwei Century, China) was used to perform gel tapping purification on agarose gel to obtain the target PCR product according to the instructions.

[0059] (2) Enzyme digestion reaction: In a 50 μL reaction system, add 1 μL BamH I enzyme, 1 μg pSP64 plasmid or gel-cleaved purified PCR product (1 μg pSP64 plasmid or gel-cleaved purified PCR product was added to two separate reaction tubes respectively), and 5 μL NEB buffer (buffer corresponding to the restriction endonuclease) and incubate at 37°C for 30 min.

[0060] (3) Purification of enzyme digestion products: The enzyme digestion products were purified using the SanPrep column-based PCR product purification kit (Sangon Biotechnology, China) according to the instructions.

[0061] (4) Ligation reaction: The plasmid and the insert fragment were prepared at a molar ratio of 1:3, and T4 DNA ligase and other components were added: the total volume was 20 μL, including 50 ng of the digested plasmid vector, 2 μL of 10×T4 DNA ligase buffer (NEB, USA), an appropriate amount of the insert DNA fragment product (its molar concentration was 3 times that of the digested plasmid vector) and 1 μL of T4 DNA ligase (NEB, USA), and ddH2O was added to 20 μL. Incubate at 37°C for 30 min to obtain the ligation reaction solution.

[0062] (5) Transformation: 3 μL of the ligation reaction solution was added to 50 μL of Trans1-T1 competent bacteria (Quanshijin, China), placed on ice for 30 min, heat-shocked at 42°C for 90 s, and spread on an ampicillin plate after 45 min of recovery, and incubated at 37°C overnight.

[0063] (6) Shaking: Small shaking: Pick 20 monoclonal colonies and inoculate them into 2 mL of LB culture medium containing ampicillin, shake at 37°C and 250 rpm for 18 h, and send for sequencing. Large shaking: After sequencing and identification, inoculate 400 μL of the small shaking solution into 400 mL of LB culture medium containing ampicillin, and shake at 37°C and 250 rpm for 18 h.

[0064] (7) Plasmid extraction: Use The Xtra Midi kit (MACHEREY-NAGEL, Germany) was used to extract plasmids from the bacterial suspension for subsequent experiments. The bacterial suspension obtained in step (6) that was identified as correct by sequencing was selected for bacterial suspension amplification and plasmid extraction, and the extracted plasmids were stored in a -20°C refrigerator for later use.

[0065] The wild-type U1-snRNA plasmid map is as follows Figure 1 shown. Figure 1 In the expression, Ori is the origin of replication, which is required for plasmid replication; AmpR is the ampicillin resistance gene, which is used for screening; Lac Promoter is the lactose operon promoter, which controls gene expression; CAPBinding Site is the CAP protein binding site, which is used to regulate transcriptional activity; M13rev is the M13 reverse primer binding site, which is used for sequencing; Lac Operator is the LacI protein binding site, which is used to regulate transcriptional inhibition; SP6 Promoter refers to the SP6 RNA polymerase promoter, which is used for in vitro transcription.

[0066] Example 2

[0067] Construction method of U1snRNADEL vector

[0068] The wild-type U1-snRNA plasmid was used as a template to perform site-directed mutagenesis using the Quickchange Lightning site-directed mutagenesis kit from Agilent Technologies Biotechnology Co., Ltd., USA. The sequence between the Bcl I and Bgl II restriction sites of the U1-snRNA plasmid was removed to obtain the U1snRNADEL vector. https: / / www.agilent.com.cn / store / primerDesignProgram.jsp ) prompts the operation to design primers. The sequences of site-directed mutagenesis primers are as follows:

[0069] F: 5'-GCAGAGGCCCAAGATCTCATGCAGGGGAGATA-3' (SEQ ID NO.4)

[0070] R: 5'-TATCTCCCCTGCATGAGATCTTGGGCCTCTGC-3' (SEQ ID NO.5)

[0071] The specific operation of the above site-directed mutagenesis is as follows:

[0072] (1) Site-directed mutagenesis reaction system 50 μL: including 5 μL 10× Raction Buffer, 1 μL DNA template (U1-snRNA wild-type vector, 20 ng / μL), 1.25 μL each of forward and reverse primers (10 μM), 1.5 μL Quick Solution Reagent, 1 μL QuickChange Lightning Enzyme, and 39 μL ddH2O.

[0073] (2) The PCR reaction program was as follows: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 20 s, annealing at 60°C for 10 s, and extension at 68°C for 5 min, for a total of 18 cycles.

[0074] (3) After the reaction, add 2 μL of Dpn I restriction endonuclease (Agilent Technologies, USA) to the reaction product, gently mix the liquid in the tube with a pipette, and place it in a 37°C metal bath for enzyme digestion for 30 min to remove the site-directed mutagenesis template plasmid.

[0075] (4) Take 4 μL of the site-directed mutagenesis PCR product and add it to 50 μL of competent medium, then transform and plate. After overnight culture, select several monoclonal colonies for bacterial amplification and sequencing identification. Select the correct site-directed mutagenesis bacterial solution identified by sequencing (i.e., the plasmid with the sequence between the Bcl I and Bgl II restriction sites removed) for bacterial solution amplification and plasmid extraction, and store the extracted U1snRNADEL vector in a -20°C refrigerator for future use.

[0076] The sequence of the U1snRNADEL vector obtained in this example is as follows (SEQ ID NO.6):

[0077] taaggaccagcttctttggggagagaacagacgcaggggcgggagggaaaaagggagaggcagacgtcacttccccttggcggctctggcagcagattggtcggttgagtggcagaaaggcagacggggactgggcaaggcactgt cggtgacatcacggacagggcgacttctatgtagatgaggcagcgcagaggctgacgtcttcgccacttgctgcttcaccacgaaggagttcccgtgccctgggagcgggttcaggaccgctgatcggaagtgagaatcccagctg tgtgtcagggctggaaagggctcgggagtgcgcggggcaagtgaccgtgtgtgtaaagagtgaggcgtatgaggctgtgtcggggcagaggcccaagatctcatgcaggggagataccatgatcacgaaggtggttttcccagggc gaggcttatccattgcactccggatgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttgtggtagtgggggactgcgttcgcgctttcccctgactttctggagtttcaaaagtagactgtacgctaa

[0078] Example 3

[0079] A method for constructing a specific U1-snRNA vector (pU1Ex5) targeting exon 5 of the F9 gene.

[0080] Using the U1snRNADEL vector as a template, the Quickchange Lightning site-directed mutagenesis kit of Agilent Technologies Biotechnology Co., Ltd. was used for site-directed mutagenesis. The binding sequence (F9-Ex5-WT-U1snRNA, TATGACCTG ) was inserted between the Bcl I and Bgl II restriction sites of the U1snRNADEL vector to obtain the pU1Ex5 plasmid. The sequences of the site-directed mutagenesis primers are as follows:

[0081] F: 5'-GCAGAGGCCCAAGATCTCATTATGACCTGGCAGGGGAGATA-3' (SEQ ID NO.7)

[0082] R: 5'-TATCTCCCCTGCCAGGTCATAATGAGATCTTGGGCCTCTGC-3'(SEQID NO.8)

[0083] The specific operation of site-directed mutagenesis is the same as that in Example 2.

[0084] Example 4: Method for constructing the F9 gene exon 5 splicing analysis reporting vector (F9-E5-WT plasmid).

[0085] Using plasmid pTB template (a vector for studying in vitro mRNA splicing), a mini gene vector named F9-E5-WT plasmid was constructed to study normal and mutant F9 splicing. To this end, the gene tissue DNA of part of intron 4, the entire exon 5, and part of intron 5 of the F9 gene was inserted into plasmid pTB, including the following steps:

[0086] (1) Amplification primers were designed at about 100-200 bp upstream and downstream of exon 5 of the F9 gene where the mutation was located (including part of intron 4 of the F9 gene, the complete exon 5, and part of intron 5), and the amplified fragment size was 667 bp. The NdeⅠ restriction enzyme site base and the corresponding protective base (NdeⅠ: GGAATTC^CATATG) were added to both the forward primer and the reverse primer. The base sequence of the amplification primer is as follows:

[0087] F:GGAATTC^CATATGGTGGAATGATTGGGAGG(SEQ ID NO.9)

[0088] R:GGAATTC^CATATGGGAAGCAGATTCAAGTAGGA(SEQ ID NO.10)

[0089] (2) The PCR reaction system was as follows: 16.7 μL ddH2O, 2.5 μL 10× PCR buffer (Bocai Biotechnology, China), 2 μL 2.5 mM deoxyribonucleoside triphosphate (dNTP) (Takara, Japan), 1.25 μL each of forward and reverse primers (10 μM), 1 μL DNA, and 0.3 μL Taq DNA polymerase (5 U / μL) (Bocai Biotechnology, China).

[0090] (3) The PCR amplification program was as follows: pre-denaturation at 95°C for 5 min; then denaturation at 95°C for 30 s, annealing at 66°C for 30 s, and extension at 72°C for 2 min, for a total of 35 cycles; and finally extension at 72°C for 10 min. The PCR instrument model was Proflex (Thermo Fisher Scientific, USA).

[0091] (4) The amplified F9 gene target fragment was subjected to 2% agarose gel electrophoresis to identify the purity and brightness of the band, and was sent to BGI for sequencing to verify the fragment sequence. The sequence of the amplified F9 gene target fragment is shown in (SEQ ID NO.11):

[0092] (F9 gene target fragment, SEQ ID NO.11)

[0093] Lowercase letters represent intron sequences, and uppercase letters represent exon sequences.

[0094] The PCR fragment (amplified F9 gene target fragment) was inserted into the NdeI restriction site of the pTB vector to obtain the F9-E5-WT plasmid. Other operations were consistent with Example 1.

[0095] The sequencing map of F9-E5-WT plasmid is as follows Figure 2 shown. Figure 2 In the expression, Ori is the origin of replication, the starting point required for plasmid self-replication, which determines the replication efficiency and copy number of the plasmid in the host cell. AmpR is the ampicillin resistance gene, which encodes β-lactamase, confers resistance to ampicillin to the host cell, and is used to screen successfully transformed cells. AmpR Promoter is the AmpR gene promoter, which is used to control the transcription of the ampicillin resistance gene and provide a basis for resistance expression for screening. SV40 Promoter is the SV40 virus promoter, which comes from the simian virus SV40. It is a strong promoter used to drive the efficient expression of exogenous genes in eukaryotic cells. pTB-Exon1 represents Exon1 on the original plasmid.

[0096] Example 5F9-E5-c.520+13A>G method for constructing a splicing reporter vector.

[0097] The wild-type F9-E5-WT plasmid (i.e., the F9-E5-WT plasmid obtained in Example 4) was used as a template for site-directed mutagenesis, and a site-directed mutagenesis kit was used to perform site-directed mutagenesis to obtain the F9-E5-c.520+13A>G splicing reporter vector, where c.520 indicates that this is a nucleotide number, which is the 520th nucleotide position of the F9 gene coding region (codingDNA) relative to the reference gene. This position is located within the 5th exon (E5). The position of the coding region is counted from the ATG start codon, and the number of each nucleotide in the coding sequence increases sequentially. +13 refers to the 13th intronic base of the mutation after the 5th exon. This mutation is located in the post-E5 intron region (i.e., 13 bases downstream of the splicing donor site of exon 5). A>G indicates that the adenine (A) originally at the c.520+13 site is replaced by guanine (G). When using the site-directed mutagenesis kit to perform site-directed mutagenesis to obtain the F9-E5-c.520+13A>G splicing reporter vector, the designed primer sequences are as follows:

[0098] F: 5'-gtgaaccagcaggtcataatctgagtaagattttttaaagaaaatctgta-3' (SEQ IDNO.12)

[0099] R: 5'-tacagattttctttaaaaaatcttactcagattatgacctgctggttcac-3' (SEQ IDNO.13)

[0100] The specific operation of site-directed mutagenesis is the same as that in Example 2.

[0101] Example 6 In vitro minigene mRNA splicing analysis

[0102] After the F9-E5-c.520+13A>G splicing reporter vector obtained in Example 5 was successfully constructed, human embryonic kidney 293T cells (HEK293T) were used to study the expression of the minigene. HEK293T eukaryotic cells are an ideal cell model for mRNA splicing.

[0103] The specific steps of cell transfection include:

[0104] (1) Cell recovery: The frozen HEK293T cells were quickly thawed in a 37°C water bath, resuspended in Dulbeccos modified eagle's medium (DMEM) (Gibco, USA) containing 10% fetal bovine serum (FBS) (Gibco, USA), centrifuged, replaced with medium, and cultured in a 10 cm culture dish at 37°C under 5% CO2.

[0105] (2) Cell passaging: When the cells reached an appropriate density, they were washed with 1× phosphate buffered saline (PBS), digested with 0.25% trypsin (Gibco, USA), centrifuged and resuspended after termination, and then passaged into a 12-well cell culture plate and cultured at 37°C with 5% CO2.

[0106] (3) Plasmid transfection: When the cell confluence reaches 70-80%, 500 ng of plasmid (wild-type F9-E5-WT plasmid and F9-E5-c.520+13A>G splicing reporter vector) is mixed with 100 μL Opti-MEM Medium (ThermoFisher Scientific, USA). 2 μL of Lipofectamine 2000 (ThermoFisherScientific, USA) transfection reagent is mixed with 100 μL Opti-MEM. After standing for 5 minutes, mix again and stand for 30 minutes. Then add dropwise to the cell culture plate and mix gently. After 6 hours, replace the culture medium and continue culturing.

[0107] The specific steps for cell collection and mRNA extraction include:

[0108] (1) Cell collection: After the plasmid was transfected into the cells, the cells were cultured for 24 h, the DMEM complete culture medium was discarded, 500 μL of sterile 1×PBS was added, the residual culture medium was washed away, 500 μL of 0.25% trypsin was added to digest the cells, and then an equal volume of DMEM complete culture medium was added to terminate the digestion. The digested cell suspension was placed in a 15 mL sterile centrifuge tube, centrifuged at 1000 g for 5 min, and the supernatant was discarded with a pipette to obtain the HEK293T cell pellet. 1 mL of Trizol (ThermoFisher Scientific, USA) was added to the cell pellet and the cells were resuspended and mixed by pipetting.

[0109] (2) mRNA extraction: In a clean bench, transfer the Trizol-treated cell suspension to an RNase-free centrifuge tube (Corning, USA), add chloroform, shake and mix, and then centrifuge. After stratification, aspirate the upper aqueous phase, add an equal volume of isopropanol to precipitate RNA, centrifuge and wash the precipitate, and discard the ethanol residue. Dissolve the RNA in the precipitate with RNase-free water, detect the RNA quality by agarose electrophoresis, and determine the concentration and purity by NanoDrop.

[0110] The sequence and ratio detection steps of mRNA splicing products include:

[0111] (1) mRNA reverse transcription: After testing the RNA quality, the mRNA was reverse transcribed into cDNA using a reverse transcription kit (Takara, Japan). The genomic DNA was removed, and the reverse transcription reagent was added according to the steps. The mRNA was reverse transcribed into cDNA in a PCR instrument and diluted for storage.

[0112] (2) PCR amplification of cDNA: cDNA was amplified by PCR using specific primers, with a reaction system of 25.5 μL. PCR was cycled 30 times, and the product was analyzed by agarose electrophoresis. The primer sequences are as follows:

[0113] F: 5'-CAACTTCAAGTCCCTAAGCCACTGC-3' (SEQ ID NO.14)

[0114] R: 5'-TGATTTAACCAACTTCCTGGTGACC-3'(SEQ ID NO.15)

[0115] (3) TA cloning to verify the mRNA shearing product: After purifying the PCR product, TA cloning was ligated to pMD19-T

[0116] Vector (Takara, Japan) was used according to the instructions. Competent bacteria were transformed and single clones were selected for sequencing to verify the sheared products.

[0117] (4) Fluorescence co-amplification PCR combined with capillary electrophoresis to detect the relative proportion of sheared products: In order to detect the relative proportion of different mRNA sheared products after transfection of different mini-gene sheared plasmids, the mRNA sheared products were analyzed by amplification fluorescence PCR combined with capillary electrophoresis. The 5' end of the co-amplification fluorescence PCR forward primer was labeled with carboxyfluorescein (FAM), and capillary electrophoresis was used after PCR amplification to detect. The relative proportion of different mRNA sheared products was calculated by peak area.

[0118] The results are shown in Figure 3. The mini-gene test results show that the c.520+13A>G mutation of the F9 gene leads to the insertion of 12 bases in intron 5, that is, the mutation c.520+13A>G activates the hidden 5' splice donor site located at c.520+12, and the scores of the hidden 5' splice donor site are higher than the original 5' splice donor site. The transcript of the 12 base insertion of intron 5 (c.520_521insGTCATAATCTGA) will be translated into the frameshift mutant FIX protein p.V174delinsGHNLM.

[0119] The capillary electrophoresis results showed that all the splicing products in F9 WT were normal, while the insertion of 12 bases in intron 5 and the proportion of normal splicing products in F9-c.520+13A>G were 96.92% and 3.08%, respectively, as shown in Figure 3. As can be seen from Figure 3, the F9-c.520+13A>G mutation significantly affected the normal splicing of mRNA, resulting in abnormal splicing products as the main form, which may further affect the normal functional expression of the F9 gene.

[0120] Example 7 Detection of the repair efficiency of U1-snRNA on abnormal splicing

[0121] (1) Cell recovery: For detailed operation steps, see Example 6 - Cell recovery.

[0122] (2) Cell passaging: For detailed operation steps, please refer to Example 6 - Cell passaging.

[0123] (3) Plasmid co-transfection: The minigene splicing plasmid (F9-E5-c.520+13A>G splicing reporter vector) and the corresponding specific U1 snRNA (U1-snRNA-FIXWT) were co-transfected (molar ratio 1:1.5). Other specific operation steps are detailed in Example 6 - Plasmid transfection.

[0124] (4) The subsequent mRNA shearing analysis operation is detailed in Example 6. The specific operation of mRNA shearing analysis is detailed in Example 6, including cell collection, mRNA extraction, and sequence and ratio detection of shearing products.

[0125] Design a specific U1snRNA (U1-snRNA-FIXWT, the construction method is as follows: 1. Construct U1-snRNA plasmid: use the designed U1snRNADEL vector as the basis. 2. Insert base sequence: insert a 9-nucleotide base sequence that completely matches the splicing donor site of exon 5 of the F9 gene into the U1snRNADEL vector. 3. Verification and functional testing: After the successful construction is verified by sequencing, the plasmid is transfected into cells to observe its effect on the splicing of the F9 gene mRNA.) to increase the definition of exon 5 by being completely complementary to the base sequence of the original 5' splicing donor site located at c.520. When the F9-E5-c.520+13A>G minigene was co-transfected with U1-snRNA-FIXWT, the proportion of normal mRNA splicing products increased to about 50%, as shown in Figure 4. The results showed that modification of specific U1snRNA can effectively repair the abnormal splicing caused by the F9-c.520+13A>G mutation, providing an important basis for restoring the function of mutant genes using splicing regulation strategies.

[0126] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. A U1-snRNA expression vector, characterized in that: The wild-type U1-snRNA expression vector is obtained by inserting the U1-snRNA fragment into the pSP64 vector through the BamH I restriction site, wherein the nucleotide sequence of the target fragment of the U1-snRNA gene is shown in SEQ ID NO.

3.

2. A U1snRNADEL vector, characterized in that: The new vector is obtained by using the U1-snRNA expression vector as a template and removing the sequence between the Bcl I and Bgl II restriction sites of the U1-snRNA plasmid by site-directed mutagenesis. The sequence of the U1snRNADEL vector is shown in SEQ ID NO.

6.

3. A method for constructing the U1snRNADEL vector according to claim 2, characterized in that: The following steps are involved: Using a wild-type U1-snRNA plasmid as a template, the wild-type U1-snRNA plasmid is the U1-snRNA expression vector according to claim 1, and performing site-directed mutagenesis using a site-directed mutagenesis kit to remove the sequence between the Bcl I and Bgl II restriction sites of the U1-snRNA plasmid to obtain the U1snRNADEL vector, wherein the site-directed mutagenesis primers are shown in SEQ ID NO.4 and SEQ ID NO.5, respectively.

4. A specific U1-snRNA vector pU1Ex5 targeting exon 5 of the F9 gene, characterized in that: Using the U1snRNADEL vector of claim 2 as a template, a site-directed mutagenesis kit was used to perform site-directed mutagenesis, and the binding sequence TATGACCTG was inserted between the Bcl I and Bgl II restriction sites of the U1snRNADEL vector to obtain the pU1Ex5 plasmid.

5. A method for constructing a specific U1-snRNA vector pU1Ex5 targeting exon 5 of the F9 gene as claimed in claim 4, characterized in that: Using the U1snRNADEL vector of claim 2 as a template, site-directed mutagenesis was performed using a site-directed mutagenesis kit, and the binding sequence TATGACCTG was inserted between the Bcl I and Bgl II restriction sites of the U1snRNADEL vector to obtain the pU1Ex5 plasmid, wherein the site-directed mutagenesis primers are shown in SEQ ID NO.7 and SEQ ID NO.8, respectively.

6. A method for constructing a F9 gene exon 5 splicing analysis reporting vector F9-E5-WT plasmid, characterized in that: Using plasmid pTB as template, the target fragment of F9 gene was inserted into the NdeI restriction site of plasmid pTB to obtain F9-E5-WT plasmid, wherein the sequence of the target fragment of F9 gene is shown in SEQ ID NO.11, which includes part of intron 4, complete exon 5 and part of intron 5 of F9 gene.

7. A F9 gene exon 5 splicing analysis reporting vector F9-E5-WT plasmid, characterized in that: The method according to claim 6 is used to prepare the product.

8. A method for constructing a F9-E5-c.520+13A>G splicing reporter vector, characterized in that: The wild-type F9-E5-WT plasmid was used as a template for site-directed mutagenesis, and a site-directed mutagenesis kit was used to perform site-directed mutagenesis to obtain the F9-E5-c.520+13A>G splicing reporter vector, wherein c.520 indicates that this is a nucleotide number, which is the 520th nucleotide position relative to the coding region of the reference gene F9 gene. The position of the coding region is counted from the ATG start codon, and each nucleotide number in the coding sequence increases sequentially. +13 refers to the 13th intron base after the 5th exon of the mutation. This mutation is located in the intron region after exon 5. A>G indicates that the adenine A originally at the c.520+13 position is replaced by guanine G. When the site-directed mutagenesis kit is used to perform site-directed mutagenesis to obtain the F9-E5-c.520+13A>G splicing reporter vector, the primers are shown in SEQ ID NO.12 and SEQ ID NO.13, respectively.

9. A F9-E5-c.520+13A>G splicing reporter vector, characterized in that: The method according to claim 8 is used to prepare the product.

10. A use of the F9-E5-c.520+13A>G splicing reporter vector as claimed in claim 9, characterized in that: The F9-E5-c.520+13A>G splicing reporter vector is used to prepare drugs or kits for treating various diseases caused by abnormal mRNA splicing.

Images