Method for synthesizing extracellular polysaccharide (EPS)

Abstract

The invention discloses a method for synthesizing extracellular polysaccharide (EPS), which comprises the following steps: S1, producing the extracellular polysaccharide (EPS) so as to screen out bacillus subtilis for generating the extracellular polysaccharide (EPS); s2, a metabolic network model is established, and the metabolic network model of the bacillus subtilis generating the EPS in the S1 is manufactured through the KBASE technology; the substance and energy flow of the bacillus subtilis in the metabolic process is understood, and a direction is provided for genome optimization; s3, genome optimization: optimizing genome codons of the bacillus subtilis for generating the EPS in the step S1 so as to achieve the purpose of improving the yield of the EPS.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a method for synthesizing extracellular polysaccharide (EPS). Background Art

[0002] In the existing technology, microbial fermentation is the main method for producing extracellular polysaccharide EPS, but traditional fermentation conditions often cannot maximize the yield of extracellular polysaccharide EPS. In addition, the extraction and purification process of extracellular polysaccharide EPS also has the problems of low efficiency and high cost. In the existing technology, such as "Food and Fermentation Industry", the yield and purity of extracellular polysaccharide EPS are improved by optimizing fermentation parameters and extraction process. The disadvantages of this technology are that the yield of extracellular polysaccharide EPS is not high, the purification process is complicated and costly, and the fermentation process is sensitive to environmental conditions.

[0003] In addition, in the prior art, genetic engineering methods are also used to optimize the gene sequence of bacterial species. For example, Chinese patent application publication number CN110004166A discloses a recombinant Bacillus subtilis strain that efficiently expresses and secretes β-mannanase and a method for obtaining the same. Specifically, the codon-optimized β-mannanase gene is first cloned downstream of different signal peptide sequences in the pMA5 vector to secrete it to the extracellular space; secondly, the restriction factors involved in the secretion process are overexpressed on the host bacterial genome; and finally, the promoter on the expression vector is replaced to increase the production of β-mannanase at the protein synthesis level by enhancing the transcription and translation processes. This process is complex and costly.

[0004] Therefore, a method for synthesizing extracellular polysaccharide EPS is provided to solve the above technical problems. Summary of the invention

[0005] The object of the present invention is to provide a method for synthesizing extracellular polysaccharide EPS, and the fermentation process of the present invention cooperates with gene sequence optimization. In terms of gene sequence optimization, advanced gene editing tools, CRISPR / Cas9 technology, metabolic engineering and system biology methods are used to accurately regulate the genome of Bacillus subtilis. The application of these technologies not only improves the expression efficiency of the target gene, but also simultaneously regulates multiple related genes to optimize the entire metabolic pathway. The collaborative work with the fermentation process includes real-time monitoring and adjustment of gene expression during the fermentation process, and dynamically optimizing the metabolic activity of the strain according to changes in fermentation conditions, thereby achieving an increase in the production of extracellular polysaccharide EPS.

[0006] The object of the present invention is achieved in that: A method for synthesizing extracellular polysaccharide EPS comprises the following steps: S1. Production of extracellular polysaccharide EPS, to screen out Bacillus subtilis that produces extracellular polysaccharide EPS; S2. Establishment of metabolic network model: Use KBASE technology to create a metabolic network model of Bacillus subtilis that produces extracellular polysaccharide EPS in S1; to understand the flow of substances and energy in the metabolic process of Bacillus subtilis and provide direction for genome optimization; S3, genome optimization, optimize the genome codons of Bacillus subtilis that produces extracellular polysaccharide EPS in S1 to achieve the goal of increasing the production of extracellular polysaccharide EPS.

[0007] The specific operation of S1 is as follows: S1.1, strain screening and cultivation: select Bacillus subtilis strains with high extracellular polysaccharide EPS production capacity from nature, and initially cultivate them in LB medium; the preparation of LB medium is divided into 2.5g tryptone, 2.5g NaCl, 1.25g Yeast Extract, 250ml water, and the sterilization condition is high pressure sterilization at 121 degrees Celsius for 20 minutes to provide a suitable environment for the growth of Bacillus subtilis; select bacteria from the original colony group and put them into LB culture medium for cultivation; S1.2, inoculation of Bacillus subtilis: after ultraviolet disinfection on the clean bench, the Bacillus subtilis cultured in S1.1 was inoculated by coating; the bacterial solution was diluted into three different concentration gradients of 103, 105, and 107, and then plated and cultured in a 37°C constant temperature incubator for 24 hours to ensure that a single colony was obtained and a sufficient number of bacteria were cultured to prepare for subsequent fermentation; S1.3, fermentation of Bacillus subtilis: the cultured bacteria in S1.2 were inoculated into LB liquid culture medium, and the LB liquid culture medium was placed in a constant temperature shaking incubator at 30°C and fermented at 180 rpm for 36 hours to produce extracellular polysaccharide EPS.

[0008] S1.4. Identification and extraction of Bacillus subtilis extracellular polysaccharide EPS.

[0009] The specific operation of S1.4 is as follows: S1.4.1. Dilute the fermentation broth with three times the volume of distilled water and centrifuge at 4°C and 8000 rpm for 20 minutes in a high-speed refrigerated centrifuge to remove bacterial cells and calcium carbonate; S1.4.2. Use the Sevage method to remove proteins from the fermentation broth. The principle is to use the characteristic that organic solvents can denature proteins. Treat the supernatant with Sevage reagent to remove free proteins. The specific operation is: use an oscillator to fully shake and mix the fermentation broth and Sevage reagent, centrifuge at 4°C and 8000rpm for 30 minutes. After centrifugation, you can see three layers from top to bottom, namely the water layer, the protein layer, and the organic layer. The denatured protein is located at the junction of the sample liquid in the middle layer and the Sevage reagent. Repeat the above process until there is no white precipitate between the sample and the Sevage reagent. The Sevage reagent is mixed with chloroform and n-butanol in a volume ratio of 5:1. Use a pipette to aspirate the upper clear liquid for the next step. S1.4.3. Put the supernatant taken out in S1.4.2 into a UV-visible spectrophotometer for detection. A characteristic absorption peak is observed at 200 nm, indicating that the supernatant contains EPS. S1.4.4. Add three times the volume of anhydrous ethanol to the supernatant obtained in S1.4.2, and obtain a precipitate by centrifugation; S1.4.5. The precipitate obtained in S1.4.4 was freeze-dried for further experiments.

[0010] The specific operation of S2 is as follows: S2.1, obtain the Bacillus subtilis genome: obtain the Bacillus subtilis genome from NCBI, and use the RASTER plug-in in the software KBase to annotate the Bacillus subtilis genome and obtain a gene information table; obtain a genome table including permanent ID, full type, preserver, taxonomy, protein coding number, size, GC content, genetic code, CDS number and other detailed information. Gene information provides a gene-level basis for the subsequent construction of a metabolic network model; S2.2, construct a metabolic pathway based on a constraint-based modeling method: use a computer to convert the metabolic network into a mathematical model, automatically build a sketch model through ModelSEED2, set LB culture medium as the only culture medium and other carbon source output rates to zero, and then use OMEGGA to improve the filling metabolic model, and finally use the Escher viewer to find the metabolic pathway of D-glucose; the establishment of a metabolic pathway helps to understand the material and energy flow of Bacillus subtilis in the metabolic process and provide direction for genome optimization, because the purpose of optimizing the genome is to increase EPS production, and the understanding of metabolic pathways can guide us to find the key links that affect EPS anabolism.

[0011] The specific operation of S3 is as follows: Adjust the GC content: make the GC content of the optimized gene sequence within a suitable range, such as Figure 8, sequences with moderate GC content are more conducive to gene expression, and sequences with too high or too low GC content may affect expression efficiency.

[0012] Select appropriate synonymous codons: Based on the codon preference of the host (Bacillus subtilis), replace the codons in the original gene sequence. Select synonymous codons that are used more frequently in Bacillus subtilis to replace the original codons. For example, the codons before optimization are "ATGG TCTATCCGCG CGGGGGATTA ATGTGACGGA ATTTTCAGCATAGTAAAACGCTI AGTGCTCACAGAGTGGAGGAAAAAGTGGA CAGCCCCGGA ATCAGCCAAA", and the codons after optimization have changed accordingly.

[0013] The beneficial effects of the present invention are as follows: the fermentation process of the present invention cooperates with gene sequence optimization to improve the yield and purity of EPS, reduce production costs, and enhance the environmental adaptability of the strain, making the production process more stable and sustainable; gene sequence optimization uses advanced gene editing tools, CRISPR / Cas9 technology, metabolic engineering and systems biology methods to accurately regulate the genome of Bacillus subtilis. The application of these technologies not only improves the expression efficiency of the target gene, but may also involve the simultaneous regulation of multiple related genes to optimize the entire metabolic pathway. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is a result diagram of the Bacillus subtilis strain of the present invention; Figure 2 This is a fermentation diagram of the Bacillus subtilis strain of the present invention; Figure 3 This is an operation diagram of extracting extracellular polysaccharides and determining whether the extracellular polysaccharides are contained in the present invention; Figure 4 is a schematic diagram of the overall metabolic pathway of Bacillus subtilis of the present invention; Figure 5 A schematic diagram of a pathway for synthesizing D-glucose according to the present invention; Figure 6 The codon sequence diagram of the Bacillus subtilis gene before optimization of the present invention; Figure 7 This is the codon sequence diagram of the Bacillus subtilis gene after optimization of the present invention; Figure 8 This is a numerical comparison chart of adaptability and GC content before and after optimization of the present invention. DETAILED DESCRIPTION

[0015] The present invention is further described below in conjunction with the accompanying drawings and embodiments.

[0016] A method for synthesizing extracellular polysaccharide EPS comprises the following steps: S1. Production of extracellular polysaccharide EPS, to screen out Bacillus subtilis that produces extracellular polysaccharide EPS; The specific operations of S1 are as follows: S1.1, strain screening and cultivation: select Bacillus subtilis strains with high production of extracellular polysaccharides EPS from nature, and initially culture them in LB medium; the preparation of LB medium is divided into 2.5g of trypsin, 2.5g of NaCl, 1.25g of Yeast Extract and 250ml of water, and the sterilization conditions are high-pressure sterilization at 121 degrees Celsius for 20 minutes to provide a suitable environment for the growth of Bacillus subtilis; pick bacteria from the original colony and put them into LB culture medium for cultivation.

[0017] S1.2. Inoculation of Bacillus subtilis: Figure 1 As shown, after ultraviolet disinfection on the clean bench, the Bacillus subtilis cultured in S1.1 was inoculated by spreading; the bacterial solution was diluted into three different concentration gradients of 103, 105, and 107, and then spread on the plate and cultured in a constant temperature incubator at 37°C for 24 hours to ensure that a single colony was obtained and a sufficient number of bacteria were cultured to prepare for subsequent fermentation.

[0018] S1.3, Fermentation of Bacillus subtilis: Figure 2 As shown, the cultured bacteria of S1.2 were inoculated into LB liquid culture medium, and the LB liquid culture medium was placed in a constant temperature shaking incubator at 30° C. and fermented at 180 rpm for 36 hours to produce extracellular polysaccharide EPS.

[0019] S1.4. Identification and extraction of Bacillus subtilis extracellular polysaccharide EPS.

[0020] The specific operation of S1.4 is as follows: S1.4.1. Dilute the fermentation broth with three times the volume of distilled water and centrifuge it at 4°C and 8000 rpm for 20 minutes in a high-speed refrigerated centrifuge to remove bacterial cells and calcium carbonate.

[0021] S1.4.2. Use the Sevage method to remove proteins from the fermentation broth. The principle is to use the characteristic that organic solvents can denature proteins. Use Sevage reagent to treat the supernatant to remove free proteins. The specific operation is: use an oscillator to fully shake and mix the fermentation broth and Sevage reagent, centrifuge at 4°C and 8000rpm for 30 minutes, and after centrifugation, you can see three layers from top to bottom, namely water layer, protein layer, and organic layer. The denatured protein is located at the junction of the sample liquid in the middle layer and the Sevage reagent. Repeat the above process until there is no white precipitate between the sample and the Sevage reagent; Sevage reagent is mixed with chloroform and n-butanol in a volume ratio of 5:1, and the upper clear liquid is sucked out with a pipette for the next step.

[0022] S1.4.3, if Figure 3 As shown, the supernatant taken out from S1.4.2 was put into a UV-visible spectrophotometer for detection, and a characteristic absorption peak was found at 200 nm, indicating that the supernatant contained extracellular polysaccharide EPS.

[0023] S1.4.4. Add three times the volume of anhydrous ethanol to the supernatant obtained in S1.4.2, and obtain a precipitate by centrifugation.

[0024] S1.4.5. The precipitate obtained in S1.4.4 was freeze-dried for further experiments.

[0025] S2. Establishment of metabolic network model: Use KBASE technology to create a metabolic network model of Bacillus subtilis that produces extracellular polysaccharide EPS in S1; to understand the flow of substances and energy in the metabolic process of Bacillus subtilis and provide direction for genome optimization; the specific operations of S2 are as follows: S2.1. Obtain the Bacillus subtilis genome: Obtain the Bacillus subtilis genome from NCBI, and use the RASTER plug-in in the software KBase to annotate the Bacillus subtilis genome and obtain a gene information table; obtain a genome table including detailed information such as permanent ID, full type, preserver, taxonomy, protein coding number, size, GC content, genetic code, CDS number, etc., as shown in Table 1; the gene information provides a gene-level basis for the subsequent construction of a metabolic network model; S2.2. Construct metabolic pathways based on constraint-based modeling methods: Figure 4 As shown in the figure, the metabolic network was converted into a mathematical model by computer, and the sketch model was automatically constructed by ModelSEED2. LB culture medium was set as the only culture medium and the output rate of other carbon sources was zero. OMEGGA was used to improve the filling metabolic model, and finally the Escher viewer was used to find the metabolic pathway of D-glucose, as shown in the figure. Figure 5As shown; the establishment of metabolic pathways helps to understand the flow of substances and energy in the metabolic process of Bacillus subtilis and provide direction for genome optimization, because the purpose of genome optimization is to increase EPS production, and the understanding of metabolic pathways can guide us to find the key links that affect EPS anabolism.

[0026] Table 1

[0027] S3, genome optimization, e.g. Figure 6 and Figure 7 As shown in Figure 1, the genome codons of Bacillus subtilis that produces extracellular polysaccharide EPS in S1 were optimized to achieve the goal of increasing the production of extracellular polysaccharide EPS. In order to enhance the ability of this Bacillus subtilis strain to produce extracellular sugars, codons play an important role in translating gene information into protein sequence information during protein synthesis. Therefore, we optimized the codons of the Bacillus subtilis genome; considering the secondary structure of mRNA: using bioinformatics software to predict and analyze different codon combinations, and select sequences with lower secondary structure stability to avoid overly complex or stable mRNA secondary structures that hinder the binding of ribosomes to mRNA and the translation process.

[0028] The specific operation of S3 is as follows: Adjust the GC content: Make the GC content of the optimized gene sequence within an appropriate range. Generally speaking, Figure 8 , sequences with moderate GC content are more conducive to gene expression, while sequences with too high or too low GC content may affect expression efficiency.

[0029] Select appropriate synonymous codons: Replace the codons in the original gene sequence based on the codon preference of the host. Select synonymous codons that are frequently used in Bacillus subtilis to replace the original codons. For example, the codons before optimization are "ATGG TCTATCCGCG CGGGGGATTA ATGTGACGGA ATTTTCAGCATA GTAAAACGCTIAGTGCTCACAGAGTGGAGGAAAAAGTGGA CAGCCCCGGA ATCAGCCAAA", and the codons after optimization have changed accordingly; see the specific optimized codons for details. Figure 7 .

[0030] like Figure 8As shown in the figure, the performance of Bacillus subtilis was simulated and compared after optimization, and the RelativeAdaptiveness value and GC content before and after were compared, and it was found that the values ​​were improved. This shows that the relative adaptability of Bacillus subtilis and the ratio of guanine and cytosine have been improved, and it is less likely to be denatured by heat and alkali, and its ability to produce extracellular polysaccharides has been further improved.

[0031] Through the above series of experiments, in the early stage of the experiment, the EPS of Bacillus subtilis was cultured, fermented and extracted according to the conventional method. After genome optimization, the relative adaptability and GC content of Bacillus subtilis under the same fermentation conditions were improved, and the ability to produce extracellular polysaccharides was further improved. This means that in the subsequent fermentation production, compared with before optimization, a higher yield of extracellular polysaccharides can be obtained within the same fermentation time. This before-and-after comparison clearly shows the effect of the entire experimental process, that is, the EPS yield of Bacillus subtilis was successfully improved through steps such as screening suitable strains, establishing metabolic network model guidance and genome optimization. Example 1

[0032] Strain screening and cultivation: Bacillus subtilis strains with high EPS production capacity were screened from nature and initially cultured in optimized LB medium (2.5 g tryptone, 2.5 g NaCl, 1.25 g Yeast Extract, 250 ml water, autoclaved at 121 degrees Celsius for 20 minutes). The experimental process was started by picking bacteria from the original colony and culturing them in the culture medium.

[0033] Inoculation of Bacillus subtilis: After disinfection by ultraviolet irradiation on the clean bench, the bacterial solution was diluted into three different concentration gradients of 103, 105, and 107, spread on plates, and cultured in a constant temperature incubator at 37 degrees Celsius for 24 hours.

[0034] Fermentation of Bacillus subtilis: The cultured bacteria were inoculated into LB liquid culture medium and placed in a constant temperature shaking incubator at 30 degrees Celsius and 180 rpm for fermentation for 36 hours.

[0035] Identification and Extraction of EPS from Bacillus subtilis The fermentation broth was diluted with three times the volume of distilled water and centrifuged at 8000 rpm at 4 °C for 20 min to remove bacterial cells and calcium carbonate.

[0036] The protein was removed by Sevage method (chloroform and n-butanol were mixed in a volume ratio of 5:1 as Sevage reagent). After mixing on an oscillator, the mixture was centrifuged at 8000 rpm at 4 degrees Celsius for 30 minutes. The operation was repeated until there was no white precipitate, and the supernatant was collected.

[0037] The supernatant was detected by UV-visible spectrophotometer, and the characteristic absorption peak at 200 nm indicated the presence of EPS.

[0038] Three volumes of anhydrous ethanol were added to the supernatant, and the precipitate was obtained by centrifugation and freeze-dried for subsequent experiments.

[0039] Metabolic network model establishment Obtain the Bacillus subtilis genome: Obtain the Bacillus subtilis genome from NCBI and annotate it using the RASTER plugin in KBase to obtain a genome table containing information such as permanent ID, full type, depositor, taxonomy, number of protein codes, size, GC content, genetic code, number of CDS, etc.

[0040] Constraint-based modeling approach: ModelSEED2 was used to automatically construct a sketch model (with lb culture medium as the only culture medium and the output rate of other carbon sources was zero), OMEGGA was used to improve the filling metabolic model, and finally the Escher viewer was used to find the metabolic pathway of D-glucose.

[0041] Genome optimization method: The codons of the Bacillus subtilis genome were optimized, taking into account the secondary structure of mRNA (selecting sequences with low secondary structure stability), adjusting the GC content (to an appropriate range), and selecting synonymous codons based on host preference to replace the original codons. After optimization, the relative adaptability value and GC content were both improved.

[0042] Comparative Example 1 (fermentation only, no genome optimization) Strain screening and cultivation: Same as step 1 in Example 1.

[0043] Inoculation of Bacillus subtilis strains: Same as step 2 of Example 1.

[0044] Fermentation of Bacillus subtilis: Same as step 3 of Example 1.

[0045] Identification and extraction of Bacillus subtilis EPS: The same as step 4 of Example 1, but no subsequent genome optimization related operations were performed.

[0046] Comparative Example 2 (Genome optimization only, no fermentation) Obtaining the Bacillus subtilis genome: The same operation as in step 5 of Example 1 for obtaining the Bacillus subtilis genome.

[0047] Genome optimization method: the same as step 6 of Example 1, but without fermentation and previous operations.

[0048] Results Analysis EPS Production Comparison After fermentation and genome optimization, the EPS yield of Example 1 was significantly higher than that of Comparative Example 1 (fermentation only) and Comparative Example 2 (genomic optimization only). This shows that the synergistic effect of fermentation and genome optimization can effectively increase the EPS yield, and fermentation or genome optimization alone cannot achieve such a high yield level.

[0049] For example, the mass of the EPS precipitate finally obtained in Example 1 is 0.07 g, while that in Comparative Example 1 is only 0.05 g. In Comparative Example 2, since no fermentation process is performed, comparable EPS yields cannot be directly obtained.

[0050] EPS Purity Comparison The purity of EPS in Example 1 (determined by a specific purity detection method, such as high performance liquid chromatography, etc.) is higher than that in Comparative Example 1 and Comparative Example 2. In Example 1, after a series of optimization operations, the impurity content is relatively low, and the purity of EPS reaches 90%, while the purity in Comparative Example 1 is 80%.

[0051] By comparing Example 1 with Comparative Example 1 and Comparative Example 2, it can be seen that the synergistic effect of fermentation and genome optimization has a significant effect on improving the amount and purity of EPS produced by Bacillus subtilis. This synergistic effect overcomes the limitations of fermentation alone or genome optimization alone, and provides an effective technical solution for efficient and high-quality production of EPS.

Claims

1. A method for synthesizing extracellular polysaccharide EPS, characterized in that: The following steps are involved: S1. Production of extracellular polysaccharide EPS, to screen out Bacillus subtilis that produces extracellular polysaccharide EPS; S2. Establishment of metabolic network model: Use KBASE technology to create a metabolic network model of Bacillus subtilis that produces extracellular polysaccharide EPS in S1; to understand the flow of substances and energy in the metabolic process of Bacillus subtilis and provide direction for genome optimization; S3, genome optimization, optimize the genome codons of Bacillus subtilis that produces extracellular polysaccharide EPS in S1 to achieve the goal of increasing the production of extracellular polysaccharide EPS.

2. The method for synthesizing extracellular polysaccharide EPS according to claim 1, characterized in that: The specific operation of S1 is as follows: S1.1, strain screening and cultivation: screening Bacillus subtilis strains with high extracellular polysaccharide EPS production capacity from nature, and preliminarily culturing them in LB medium to provide a suitable environment for the growth of Bacillus subtilis; selecting bacteria from the original bacterial colony and culturing them in LB culture medium; S1.2, inoculation of Bacillus subtilis: after ultraviolet disinfection on the clean bench, the Bacillus subtilis cultured in S1.1 was inoculated by coating; the bacterial solution was diluted into three different concentration gradients of 103, 105, and 107, and then plated and cultured in a 37°C constant temperature incubator for 24 hours to ensure that a single colony was obtained and a sufficient number of bacteria were cultured to prepare for subsequent fermentation; S1.3, fermentation of Bacillus subtilis: inoculate the cultured bacteria in S1.2 into LB liquid culture medium, place the LB liquid culture medium in a constant temperature shaking incubator at 30°C and ferment at 180 rpm for 36 hours to produce extracellular polysaccharide EPS; S1.

4. Identification and extraction of Bacillus subtilis extracellular polysaccharide EPS.

3. The method for synthesizing extracellular polysaccharide EPS according to claim 2, characterized in that: The specific operation of S1.4 is as follows: S1.4.

1. Dilute the fermentation broth with three times the volume of distilled water and centrifuge at 4°C and 8000 rpm for 20 minutes in a high-speed refrigerated centrifuge to remove bacterial cells and calcium carbonate; S1.4.

2. Use the Sevage method to remove proteins from the fermentation broth. Use Sevage reagent to treat the supernatant to remove free proteins. The specific operation is as follows: Use an oscillator to fully shake and mix the fermentation broth and Sevage reagent, centrifuge at 4°C and 8000rpm for 30 minutes. After centrifugation, three layers can be seen from top to bottom, namely, water layer, protein layer, and organic layer. The denatured protein is located at the junction of the sample liquid and the Sevage reagent in the middle layer. Repeat the above process until there is no white precipitate between the sample and the Sevage reagent. Sevage reagent is mixed with chloroform and n-butanol in a volume ratio of 5:

1. Use a pipette to suck out the upper clear liquid for the next step. S1.4.3, place the supernatant obtained in S1.4.2 into a UV-visible spectrophotometer for detection; S1.4.4, add three times the volume of anhydrous ethanol to the supernatant obtained in S1.4.2, and obtain a precipitate by centrifugation; S1.4.

5. The precipitate obtained in S1.4.4 was freeze-dried for further experiments.

4. The method for synthesizing extracellular polysaccharide EPS according to claim 1, characterized in that: The specific operations of S2 are as follows: S2.1, obtaining the Bacillus subtilis genome: obtaining the Bacillus subtilis genome from NCBI, and using the RASTER plug-in in the software KBase to annotate the Bacillus subtilis genome and obtain a gene information table; the gene information provides a gene-level basis for the subsequent construction of a metabolic network model; S2.2, constructing a metabolic pathway based on a constraint-based modeling method: using a computer to convert the metabolic network into a mathematical model, automatically constructing a sketch model through ModelSEED2, setting LB culture medium as the only culture medium and the output rate of other carbon sources to zero, and then using OMEGGA to improve the filling metabolic model, and finally using the Escher viewer to find the metabolic pathway of D-glucose; the establishment of a metabolic pathway helps to understand the flow of substances and energy in the metabolic process of Bacillus subtilis and provide direction for genome optimization.

5. The method for synthesizing extracellular polysaccharide EPS according to claim 1, characterized in that: The specific operation of S3 is as follows: adjusting the GC content: making the GC content of the optimized gene sequence within a suitable range; Select appropriate synonymous codons: Based on the codon preference of the host Bacillus subtilis, replace the codons in the original gene sequence; select synonymous codons that are used more frequently in Bacillus subtilis to replace the original codons.

Images