A high-throughput screening method for high-yield sophorolipid biosurfactant strains based on substrate modification and its application

Abstract

The present invention provides a high-throughput screening method and application of a high-yield sophorolipid biosurfactant strain based on substrate modification, the method comprising the following steps: inoculating a plurality of sophorolipid-producing strains into a screening medium for fermentation culture to obtain a mixed strain fermentation broth; diluting the mixed strain fermentation broth and applying it to a solid culture medium plate for culture, observing the colony ultraviolet irradiation at 254nm after the culture is completed, and the target strain is the one with a darker degree than the starting bacteria, and the solid culture medium contains a modified substrate. Wherein, the strain is Bombus staminamo yeast (also known as Bombus stamina Candida). The present invention incorporates a characteristic modified substrate into the high-throughput screening method, and the screening rate of the high-yield strain is increased to more than 50%. The high-yield sophorolipid biosurfactant strain HTZ-11 screened by mutagenesis has a final yield of 352g / L of sophorolipids obtained by fermentation in a 7L bioreactor, which is 1.1 times higher than the yield of the starting strain year-on-year.

Description

Technical Field

[0001] The present invention relates to the field of microbial high-throughput screening and fermentation technology, and in particular to a high-throughput screening method for a high-yield sophorolipid biosurfactant strain based on substrate modification and application thereof. Background Art

[0002] The metabolic network and regulatory mechanism of microorganisms are complex, and it is time-consuming and laborious to design and construct microbial factories by analyzing microbial physiological mechanisms and modifying microbial metabolic pathways. Therefore, on the basis of constructing a non-specific mutant library through multiple types of mutagenesis, a high-throughput screening method is established with specific screening indicators to efficiently and quickly screen high-yield strains, thereby comparing the differences between high-yield strains and wild-type strains through genome, transcriptome, and metabolome analysis, and finding the reasons for the high yield of mutants.

[0003] Sophorolipids are the main biosurfactants, which are non-toxic, sustainable and environmentally friendly, making them show advantages that chemical surfactants do not have in practical applications. Bombus stoloniferum, also known as Bombus stoloniferum (Starmerella bombicola), is the main strain for producing sophorolipids in existing reports. Glucose and hydroxylated fatty acids are mainly used to synthesize sophorolipids during fermentation. The fermentation process of sophorolipids is usually carried out in large-scale bioreactors, and after extraction and purification by downstream processes, it is applied to materials, biomedicine, agriculture, cosmetics and other fields. In practical applications, the production cost of sophorolipids is high, and the efficiency of screening high-yield strains by random mutation is low. Therefore, based on existing research, it is necessary to use efficient, rapid and high-positive mutation rate mutagenesis and high-throughput screening methods to obtain high-yield strains. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a high-throughput screening method and application of a high-yield sophorolipid biosurfactant strain based on substrate modification in view of the deficiencies in the prior art. By incorporating characteristic modified substrates into the high-throughput screening method, the screening rate of the high-yield strain is increased to more than 50%.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] The present invention provides a high-throughput screening method for a sophorolipid biosurfactant strain based on substrate modification, the method comprising the following steps:

[0007] A high-throughput screening method for a high-yield sophorolipid biosurfactant strain based on substrate modification comprises the following steps:

[0008] (1) inoculating multiple sophorolipid-producing strains into a screening medium for fermentation to obtain a mixed strain fermentation broth;

[0009] (2) diluting the fermentation liquid of the mixed strain and applying it on a solid culture medium plate for cultivation. After the cultivation, observing the ultraviolet irradiation of the colony at 254 nm, the one with a darker shade than the starting bacteria is the target strain (high-yield sophorolipid biosurfactant strain); wherein the solid culture medium comprises a carbon source and a fluorescent agent, the carbon source comprises a modified substrate, the modified substrate is a hydrophobic carbon source, preferably any one or a combination of benzyl stearic acid, benzyl palmitic acid, benzyl linolenic acid, benzyl oleic acid and benzyl erucic acid, further preferably, the synthesis of any one of the benzyl stearic acid, benzyl palmitic acid, benzyl linolenic acid, benzyl oleic acid and benzyl erucic acid comprises the following steps: mixing one of stearic acid, palmitic acid, linolenic acid, oleic acid and erucic acid with lithium diisopropylamide and benzyl chloride in sequence to obtain a mixed solution, and chromatographing and eluting the mixed solution to obtain the obtained solution; further preferably, the modified substrate is benzyl stearic acid.

[0010] Wherein, in step (1), the sophorolipid-producing strain is Starmerella bombicola. The multiple strains are more than two strains; the multiple sophorolipid-producing strains are mixed strains obtained by mutagenesis of the starting bacteria. Preferably, the starting bacteria is Starmerella bombicola XK-11, which is screened from the surface soil of Shengli Oilfield; the mutagenesis is chemical mutagenesis, and the mutagen is ethyl methanesulfonate. Further preferably, the mutagenesis treatment first activates and cultures the starting bacteria, that is, the glycerol bacteria preserved at -80°C are streaked on a YPD plate with an inoculation loop, placed upside down in a growth incubator at 25-30°C for culture, and after 24-48 hours, transferred to a liquid YPD culture medium with an inoculation amount of 2-5% v / v, and cultured at 25-30°C, 100-300r / min shaking for 12-24 hours to obtain an activated bacterial solution. Then, the activated bacterial solution is washed 2 to 4 times with sodium dihydrogen phosphate-disodium hydrogen phosphate buffer, and after the bacterial body is resuspended in the buffer, 1 to 6% v / v ethyl methanesulfonate reagent in different doses is added, and the reaction is carried out at 25 to 30° C. and 200 r / min on a shaking table for 10 to 60 minutes. After the reaction, 0.5 to 5% v / v sodium thiosulfate solution is immediately used to terminate the reaction and remove the toxicity, and the deionized water is washed and resuspended, and the reaction is repeated 2 to 4 times. The lethality rate of the strain after mutagenesis is 90%. Further preferably, the starting bacteria described in step (2) is the starting bacteria before mutagenesis, and is preferably Starmerella bombicola XK-11.

[0011] Wherein, in step (1), the screening medium is a YPD medium containing chlorpromazine, wherein the concentration of chlorpromazine is 10 to 50 mg / L; preferably 20 mg / L, and the chlorpromazine is related to the activity of P450 enzymes in the sophorolipid biosurfactant synthesis pathway.

[0012] The fermentation culture has a culture temperature of 25-30°C and a culture time of 12-72 hours, preferably 30°C for 72 hours.

[0013] Wherein, in step (2), the dilution is at a multiple of 10 to 10 6 times; the culture temperature is 25-30°C and the culture time is 48-120h. Preferably, the dilution is 10 4 times, and cultured at 30°C for 96h.

[0014] Wherein, in step (2), the carbon source further comprises glucose; the added mass ratio of the modified substrate to the glucose is 1:1 to 10, preferably 1:1.

[0015] Wherein, in step (2), the solid culture medium further comprises a nitrogen source, an inorganic salt and agar;

[0016] The carbon source concentration is 30 to 300 g / L, preferably 40 to 120 g / L, more preferably 60 to 100 g / L, and more preferably 80 g / L;

[0017] The nitrogen source concentration is 1-10 g / L, and the nitrogen source is any one or more combinations of ammonium sulfate, corn steep liquor, peptone and yeast extract. Preferably, the nitrogen source is yeast extract, and the nitrogen source concentration is 1-5 g / L, more preferably 3 g / L.

[0018] The inorganic salt concentration is 1-3 g / L, and the inorganic salt is KH 2 PO 4 、Na 2 HPO 4 MgSO 4 and CaCl 2 Any one or more combinations of; preferably, the inorganic salt is KH 2 PO 4 、Na 2 HPO 4 and MgSO 4 The combination of inorganic salts preferably has a concentration of 2 to 3 g / L.

[0019] The concentration of the fluorescent agent is 1-20 g / L, preferably 10-20 g / L. More preferably, the fluorescent agent is Zn 2 SiO 4-Mn, concentration is 10g / L; Zn 2 SiO 4 -Mn is used to observe green fluorescence under 254nm ultraviolet light. The modified substrate has a maximum absorption peak at 254nm, which can quench the fluorescence and form a light and dark contrast with the surrounding parts. When the strain uses one or more of benzyl stearic acid, benzyl palmitic acid, benzyl linolenic acid, benzyl oleic acid and benzyl erucic acid to synthesize sophorolipids in the cell, benzyl groups are connected to the structure of sophorolipids, and the cells themselves also have the effect of quenching fluorescence. The higher the content of sophorolipids, the darker ...

[0020] Further, the target strain obtained by screening in step (2) is rescreened, and the specific method is: the pure culture of the target strain is inoculated into a 96-well deep-well plate for culture and fermentation, and the one with a high concentration is a high-yield sophorolipid strain. Further, the deep-well plate fermentation includes the following steps: the deep-well plate uses a 96-well deep-well plate to culture the strain, with a depth of 2 to 3 cm; the 48-well deep-well plate is used for fermentation, with a depth of 4 to 5 cm, and the deep-well plate fermentation step includes: picking a single colony on the plate and inoculating it into a 96-well deep-well plate filled with YPD culture medium, culturing at 25 to 30°C on a shaking table for 12 to 24 hours, and then transferring the activated bacterial solution to a 48-well deep-well plate at a transfer volume of 2 to 5%, and fermenting at 25 to 30°C, 200r / min on a shaking table for 120 to 168 hours to detect the content of sophorolipids. The components of the 48-well plate fermentation medium are the same as the above solid medium except that the hydrophobic substrate is replaced by one or more of rapeseed oil, soybean oil, oleic acid, corn oil, and peanut oil, and agar and fluorescent agent are not present.

[0021] The efficiency of the high-throughput screening method was increased by about 55%.

[0022] In the second aspect, the present invention provides a high-yield sophorolipid biosurfactant strain obtained by the high-throughput screening method described in the first aspect, which is classified and named as Starmerella bombicola, the strain number is HTZ-11, the preservation number is CGMCC No.31397, and it is preserved in the General Microbiology Center of the China Microbiological Culture Collection Administration, and the preservation address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the preservation time is July 22, 2024.

[0023] In a third aspect, the present invention provides the use of the high-yield sophorolipid biosurfactant strain described in the second aspect in the production of sophorolipids.

[0024] Specifically, the strain is inoculated into a fermentation medium and fermented at 25-30°C for 120-168 hours, with a fermentation pH of 6-7. Preferably, the fermentation temperature is 30°C, the fermentation time is 168 hours, and the fermentation pH is 6-7.

[0025] Wherein, the fermentation medium comprises a carbon source, a nitrogen source and an inorganic salt;

[0026] The carbon source is a combination of rapeseed oil and glucose, the carbon source concentration is 30-300 g / L, the mass ratio of glucose to rapeseed oil is 1:1; the carbon source concentration is preferably 160 g / L;

[0027] The nitrogen source is any one or more of ammonium sulfate, corn steep liquor, peptone and yeast extract, and the nitrogen source concentration is 1-10 g / L; the nitrogen source concentration is preferably 3 g / L

[0028] The inorganic salt is KH 2 PO 4 、Na 2 HPO 4 MgSO 4 and CaCl 2 Any one or more combinations of the foregoing, wherein the inorganic salt concentration is 1-3 g / L, and the inorganic salt concentration is preferably 2.5 g / L.

[0029] Preferably, the fermentation is carried out in a 7 L bioreactor with a liquid volume of 2 to 5 L, preferably, a liquid volume of 3 to 5 L. Further preferably, the yield obtained by fermentation of the high-yield sophorolipid biosurfactant strain is 352 g / L.

[0030] Beneficial effects:

[0031] The present invention provides a high-throughput screening method and application of a high-yield sophorolipid-producing strain based on substrate modification. Sophorolipid is a difficult-to-separate mixture that has no absorption peak under ultraviolet light irradiation. The fermentation substrate component of the present invention contains one or more of benzyl stearic acid, benzyl palmitic acid, benzyl linolenic acid, benzyl oleic acid and benzyl erucic acid. The substrate has a maximum absorption peak at 254nm under ultraviolet light irradiation. Using it as a substrate component for synthesizing sophorolipids, the cells synthesizing sophorolipids can quench the fluorescence formed in the environment when facing 254nm ultraviolet irradiation. The higher the content of the synthetic sophorolipids, the stronger the darkness, thereby achieving efficient screening of high-yield strains by analyzing the light and dark degree of the cells themselves and the surroundings.

[0032] The present invention provides a high-throughput screening method for a high-yield sophorolipid-producing strain based on substrate modification. In the present invention, a mutant library is constructed by a traditional EMS mutagenesis method, which has the advantages of simple method, high efficiency, small side effects, and easy operation compared with other mutagenesis methods. By using a characteristic modified substrate as a carbon source, the appearance of high- and low-yield strains after fermentation and culture under fluorescence, deep well plates, fermentation verification of bioreactors, etc., reflects the situation that benzyl stearic acid, benzyl palmitic acid, benzyl linolenic acid, benzyl oleic acid and benzyl erucic acid are used by each strain to synthesize sophorolipids intracellularly. This situation shows the significant difference in the yield of different strains and improves the efficiency of screening.

[0033] The present invention obtains a high-yield sophorolipid biosurfactant strain Bombus staminosaccharomyces HTZ-11 by screening through the high-throughput screening method. The sophorolipid yield obtained by fermenting the strain HTZ-11 can reach 352 g / L, and the sugar consumption rate and the oil consumption rate are higher than those of the starting strain, and the productivity is higher. In addition, the strain HTZ-11 has stronger adaptability to the fermentation environment, faster growth rate, and better ability to synthesize lactone-type sophorolipids. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments, and the above and / or other advantages of the present invention will become more clear.

[0035] Figure 1 This is the irradiation result of dark box type UV analyzer;

[0036] Figure 2 This is the NMR scan result of crude benzyl stearic acid;

[0037] Figure 3 This is the full wavelength scanning result of crude benzyl stearic acid;

[0038] Figure 4 The colony growth at different dilution multiples;

[0039] Figure 5 It is the darkness of the colony under ultraviolet irradiation;

[0040] Figure 6 The results of sophorolipid content in mutant strains and starting strains are shown in FIG.

[0041] Figure 7 The results are the comparison of sophorolipid production by shake flask fermentation between mutant strain and starting strain;

[0042] Figure 8 The fermentation product content diagram of the high-yield sophorolipid biosurfactant strain obtained by screening and the starting strain in the fermentation tank;

[0043] Fig. 9Specific relevant data for the fermentation results of the starting strain and mutant strain A6. DETAILED DESCRIPTION

[0044] The present invention will be described in detail below in conjunction with the examples. The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Based on the examples in the present invention, all other embodiments obtained by those skilled in the art without making creative work are within the scope of protection of the present invention.

[0045] Example 1 Synthesis of Benzyl Stearic Acid

[0046] Stearic acid is also called octadecanoic acid, with a chemical formula of C 18 H 36 O 2 , molecular weight 284.48, produced by oil hydrolysis, can be used to synthesize sophorolipids. The synthesis method of benzyl stearic acid described in this specific embodiment refers to the document [Eur J Org Chem-2013-Kaku-A Method to Prepare Optically Active Acyclic-Benzyl Ketones byThermodynamically], which specifically includes the following steps:

[0047] First, diisopropylamine (2.28mmol) was dissolved in 4mL tetrahydrofuran, and n-butyl lithium (2.27mmol) was added dropwise to the mixture in a cold trap at 0°C using a syringe, and stirred for 40min to prepare the activator lithium diisopropylamide (LDA; 2.3mmol). Stearic acid (1.2mmol) was weighed and ultrasonically dissolved in 4mL tetrahydrofuran. After dissolution, LDA was added at -78°C. This step is the activation step of stearic acid. After 10min, the temperature was set to -20°C. When it was raised to this temperature, the reacted solution was placed at room temperature and stirred for 2h. After the stirring time was over, 1.13mmol of benzyl chloride (BnCl) was added to the reaction solution, and the reaction solution was placed at 35°C for reaction and stirred for 3h. After the stirring time was over, the temperature was cooled to 25°C and stirred overnight.

[0048] After stirring overnight, the reaction solution was concentrated under reduced pressure and 100 mL of ethyl acetate was added. The polarity of the solution was determined by thin layer chromatography. The prepared product was spotted on a plate and the results were as follows under the irradiation of a dark box UV analyzer: Figure 1 As shown, from Figure 1It can be seen that the left is the polarity point of the product obtained by the initial purification, as a control, and the right is the unpurified reaction liquid obtained by the second purification. The polarity of the two is consistent, which can prove the repeatability of the reaction. Pour the mixed liquid into a separatory funnel, add 200-400mL of saturated sodium chloride solution and anhydrous sodium sulfate, retain the upper liquid after stratification, and concentrate under reduced pressure. Add silica gel powder to the concentrated reactant until it fills 2 / 3 of the chromatography column, and add 50mL of ethyl acetate and dichloromethane, concentrate under reduced pressure, and repeat the operation until it is a light yellow dry powder. Fill the chromatography column with silica gel powder to 7 / 10 of the column height, and compact the silica gel powder so that it is evenly distributed in the chromatography column and the surface is horizontal. Pour the obtained light yellow dry powder, evenly spread it on the upper layer of silica gel powder, and then add another layer of silica gel powder to 9 / 10 of the column height. According to the polarity of α-benzyl stearic acid, one or more solvents with good solubility such as petroleum ether and ethyl acetate are added for elution, and the location of α-benzyl stearic acid is confirmed by continuous spotting during the elution process. The spotting developing liquid is ethyl acetate:petroleum ether with a volume ratio of 1:2.

[0049] When there is no product point in the sample after elution, all the benzyl stearic acid has been collected. The obtained liquid is dried in a vacuum oven overnight to a powder state, which is the crude benzyl stearic acid. The crude product NMR and full scan wavelength results are as follows Figure 2 , 3 As shown by Figure 2 , Figure 3 It can be seen that the results of H NMR spectrum show that the amount of H in the desired synthetic product is consistent with the actual product, and the wavelength scanning results show that the product has an absorption peak at 254nm, while the control group stearic acid has no absorption peak under ultraviolet irradiation.

[0050] Example 2 High-throughput screening method based on substrate modification

[0051] 1. Strain mutagenesis:

[0052] The strain used in this example is Starmerella bombicola XK-11 preserved in a glycerol tube at -80°C, which was screened from the surface soil of Shengli Oilfield. The ITS sequence of the strain is shown in SEQ ID NO.1, specifically: TTCCGTAGGTGAACCTGCGGAAGGATCATTTCTGAAGGCTACAC GCCAACATTGTGAAACGCACTTTCGGGTGCATTGAAAGAGTGCTCTCGGGCACACTTTTCTTTAACTTTTATTTTTTAATCTGACAACCAAGAAAATTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCAAAGCGCGATAGGTAATGCGAATTGCAGACGTGAGTCATTGAATCTTTGAACGCACATTG CGCTACTGGGCTATATGCTCAGTAGCATGCTTGTTGGAGCGCCGATCTTTCTCCTCTACCTGTTTCGACAGGCCTGAGGGTTCTGCTCCCACCGGGAGTGAAAGACATGGAAGTGCACACGTTAGATAACTCTGTGCAGTTACACTTTTACACTTTTGGCCCCCAATCAAGCAAGGCTACCCGCTGAACTTAAGCATATCAATAAGCGGA. Activate on YPD plate, place upside down in a growth incubator at 30°C for culture, transfer to YPD liquid culture medium at 5% v / v inoculation volume after 24 hours, and after growing for 24 hours, take the bacterial solution with an OD of 1 at 600nm after liquid dilution for the next step.

[0053] In this embodiment, the steps of using ethyl methanesulfonate (EMS) reagent for mutagenesis are as follows: dilute the bacterial solution with an OD of 1 at 600 nm to 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , spread on a YPD plate, and place it upside down in a 30°C growth incubator. After 48 hours, observe and record the number of colonies on the plate, and determine the dilution factor at which the number of colonies can be clearly observed (preferably 30 to 300), i.e. 10 -4 times, the growth of colonies at different dilutions is as follows Figure 4As shown. The bacterial solution diluted with the above appropriate multiples was rinsed with a pre-prepared and sterilized sodium dihydrogen phosphate-disodium hydrogen phosphate buffer solution with a pH of 7.4. After rinsing, centrifuged at 4000r / min for 10min, the precipitate was retained, the supernatant was discarded, and the rinsing and centrifugation were repeated 4 times, and the bacteria were resuspended with the buffer solution. EMS reagent and EMS reagent with different doses of 0, 1%, 2%, 3%, 4%, 5%, 6% and the like were added to the resuspended bacterial solution, and placed in a 30°C, 200r / min shaking table for 60min. After the incubation time, 2mL of a 5% v / v sodium thiosulfate aqueous solution sterilized in advance was immediately drawn into the induced bacterial solution to terminate the mutagenesis reaction and eliminate toxicity. The detoxified bacterial solution was centrifuged at 4000r / min for 10min, the supernatant was discarded, the bacteria were washed 3 to 5 times with sterilized deionized water, and resuspended to obtain a mutant strain mixture. Dilute the mutant strain mixture to an easily observable dilution multiple, transfer 50-100 μL of the liquid to a YPD plate, place it in a 30°C incubator for 48 hours, observe the number of colonies, and calculate the colony lethality compared with the blank control (Starmerella bombicola XK-11) to determine the optimal mutagenesis dose and mutagenesis time. Perform subsequent mutagenesis based on the optimal mutagenesis time and mutagenesis time.

[0054] In this specific embodiment, the optimal mutagenesis time after optimization is 30 min, and the mutagenesis dose used is 6%.

[0055] 2. Apply screening pressure to mutant strains

[0056] The mutant strain mixture obtained in step 1 was transferred to a 250 mL shake flask containing 50 mL of liquid YPD at an inoculum volume of 5% v / v. After the transfer, 20 mg / L of chlorpromazine reagent was added to the shake flask. The culture temperature was 30°C, the shaker speed was 200 r / min, and the culture period was 72 h.

[0057] 3. Construction of fluorescent environment and observation of strain appearance

[0058] Dilute the culture solution obtained in step 2 by 10 -4 Then, 50 μL was transferred and spread on the prepared solid culture medium fluorescent plate, and placed upside down in a 30°C growth incubator. After 96 hours, the appearance of the colonies on the plate was observed under 254nm ultraviolet irradiation.

[0059] The formula of the solid culture medium is as follows: the carbon source is glucose and benzyl stearic acid, the carbon source concentration is 80 g / L, and the mass ratio of glucose to benzyl stearic acid is 1:1; the nitrogen source is yeast extract, and the nitrogen source concentration is 3 g / L; the inorganic salt is KH 2 PO 4 、Na 2 HPO4 and MgSO 4 The added mass ratio is 2:2:1, and the total concentration of inorganic salt is 2.5g / L; the fluorescent agent is Zn 2 SiO 4 -Mn, dosage is 10g / L.

[0060] 4. Target strain activation and deep-well plate fermentation

[0061] Pick the single colony with strong darkness under UV irradiation in step 3, such as Figure 5 As shown by the arrow in the middle, the single colony of the activated starting strain without mutation was cultured on a new YPD plate and inoculated into a 96-well deep-well plate (depth of 2-3 cm) filled with liquid YPD medium at the same time. The activated bacterial solution was cultured at 30°C for 24 hours to obtain the activated bacterial solution; the activated bacterial solution was transferred to a 48-well deep-well plate (depth of 4-5 cm) filled with fermentation liquid medium for fermentation, the transfer volume was 5% v / v, and the content of sophorolipids was detected after fermentation at 30°C and 200r / min shaking for 120 hours.

[0062] The types and contents of the main components of the 48-well plate fermentation medium are the same as those described in step 3, except that rapeseed oil is used to replace benzyl stearic acid, and agar and fluorescent agent are not included. According to the detected sophorolipid content, the results were obtained by statistics: taking the yield of the unmutated starting strain as a reference, the total number of strains was 192, and the yield of about 55% showed a high yield.

[0063] Positive mutation rate = total number of strains with significantly higher yields / total number of strains*100%

[0064] =105 / 192*100%

[0065] =54.69%

[0066] The methods used in this specific example to detect the content of sophorolipids are the anthrone sulfuric acid method and the DNS method.

[0067] like Figure 6 The results show the comparison of the content of sophorolipids in 192 strains tested and the yield of the starting strain without mutation. According to the test results, several strains with high yield were selected from the dark strains to continue the shake flask fermentation, such as Figure 7 The results are shown for the detection of sophorolipid production in shake flask fermentation. The CK group is the starting strain, and the yields of the other mutant strains with strong darkness are all higher than those of the CK group.

[0068] Example 3 Determination of the ability of high-yield mutant strains and starting strains to produce sophorolipids in a 7L bioreactor

[0069] In this specific example, the starting strain of Bombus stamina yeast and the high-yield mutant strain A6 were activated, and the glycerol bacteria stored at -80°C were streaked on a YPD plate with an inoculation loop and incubated upside down in a growth incubator at 30°C for culture. After 20 hours, they were transferred to 175 mL of liquid YPD culture medium at an inoculum volume of 5% v / v, and after culturing at 30°C in a shaking incubator for 20 hours, seed liquids were obtained.

[0070] In the 7L bioreactor fermentation method described in this specific embodiment, the fermentation medium contains a carbon source, a nitrogen source and an inorganic salt, wherein the carbon source is glucose and rapeseed oil, the carbon source concentration is 160 g / L, and the mass ratio of glucose to rapeseed oil is 1:1; the nitrogen source is yeast extract, the nitrogen source concentration is 3 g / L; the inorganic salt is KH 2 PO 4 , concentration is 1g / L, Na 2 HPO 4 , concentration is 1g / L, MgSO 4 , concentration is 0.5g / L.

[0071] The seed liquid of the two strains was respectively inoculated into two 7L bioreactors. The actual liquid volume in the 7L bioreactor was 3.5L, the fermentation temperature was 30°C, the stirring speed was 500r / min, and the fermentation cycle was 168h. The initial pH was reduced to 4.8 by automatic acidification, and then the pH was adjusted to 3.5 by adding ammonia water. Rapeseed oil was continuously fed into the fermentation tank in a batch feeding manner and maintained at a level below 20g / L. Solid glucose was added every 24h to maintain the content level at 30g / L. The detection method in Example 2 was used to determine the content of sophorolipids in the solution during the fermentation process, as shown in FIG. Figure 8 As shown, the final yield of the microbiotin biosurfactant obtained by fermentation of the starting strain is 170 g / L, and the final yield of the microbiotin biosurfactant obtained by fermentation of the mutant strain A6 is 352 g / L. In addition, during the fermentation process, the growth condition of the mutant strain is better than that of the starting strain, and the sugar consumption rate and oil consumption rate are higher than those of the starting strain, with an average rate of about 50% higher, and it has a higher productivity. Under the condition of producing the same content of microbiotin biosurfactant, the fermentation cycle is greatly shortened, and the residual sugar content in the fermentation broth is almost 0, which is conducive to the downstream separation process. Fig. 9As shown, the relevant data of the fermentation results of the starting strain and mutant strain A6 are displayed respectively. Among them, the residual oil content in the fermentation broth of the starting strain at the end of fermentation was 28.03g / L, the cell dry weight was 18.07g / L, the lactone-type sophorolipid accounted for 20.59%, and the acid-type sophorolipid accounted for 79.41%; the residual oil content in the fermentation broth of the mutant strain A6 was 3.13g / L, the cell dry weight was 30.05g / L, the lactone-type sophorolipid accounted for 35.71%, and the acid-type sophorolipid accounted for 64.29%. The mutant strain A6 has a stronger adaptability to the fermentation environment, a faster growth rate, and a better ability to synthesize lactone-type sophorolipids.

[0072] The mutated high-yield strain A6 was renamed HTZ-11, and its classification name was Starmerella bombicola, with a preservation number of CGMCC No.31397. It was deposited in the General Microbiology Center of China Culture Collection Administration, and the preservation address was Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the preservation date was July 22, 2024.

Claims

1. A high-throughput screening method for high-yield sophorolipid biosurfactant strains based on substrate modification, characterized in that: The following steps are involved: (1) inoculating a plurality of sophorolipid-producing strains into a screening medium for fermentation to obtain a mixed strain fermentation liquid; (2) diluting the mixed strain fermentation liquid and applying it on a solid culture medium plate for cultivation. After the cultivation, observe the colony under ultraviolet irradiation at 254 nm. The colony with a darker intensity than the starting strain is the target strain; Wherein, the solid culture medium comprises a carbon source and a fluorescent agent, the carbon source comprises a modified substrate, and the modified substrate is any one or a combination of several of benzyl stearic acid, benzyl palmitic acid, benzyl linolenic acid, benzyl oleic acid and benzyl erucic acid.

2. The high-throughput screening method according to claim 1, characterized in that In step (1), the sophorolipid-producing strain is Starmerella bombicola, and the multiple strains are more than two strains; The multiple sophorolipid production strains are mixed strains obtained by mutagenesis of the starting bacteria.

3. The high-throughput screening method according to claim 1, characterized in that In step (1), the screening medium is a YPD medium containing chlorpromazine, wherein the concentration of chlorpromazine is 10 to 50 mg / L; The fermentation culture has a culture temperature of 25 to 30° C. and a culture time of 12 to 72 hours.

4. The high-throughput screening method according to claim 1, characterized in that In step (2), the dilution ratio is 10 to 10 6 times; the culture temperature is 25 to 30°C and the culture time is 48 to 120h.

5. The high-throughput screening method according to claim 1, characterized in that: In step (2), the carbon source includes glucose, and the added mass ratio of the modified substrate to the glucose is 1:1-10.

6. The high-throughput screening method according to claim 5, characterized in that: In step (2), the solid culture medium further comprises a nitrogen source, an inorganic salt and agar; Wherein, the concentration of the carbon source is 30-300 g / L, the concentration of the nitrogen source is 1-10 g / L, the concentration of the inorganic salt is 1-3 g / L, and the concentration of the fluorescent agent is 1-20 g / L; Preferably, the nitrogen source is any one or more combinations of ammonium sulfate, corn steep liquor, peptone and yeast extract; the inorganic salt is any one or more combinations of KH2PO4, Na2HPO4, MgSO4 and CaCl2; and the fluorescent agent is Zn2SiO4-Mn.

7. A high-producing sophorolipid strain obtained by screening using the high-throughput screening method according to any one of claims 1 to 6.

8. The high-yield sophorolipid biosurfactant strain according to claim 7, characterized in that Its classification name is Starmerella bombicola, the strain number is HTZ-11, the preservation number is CGMCC No.31397, and it is preserved in the General Microbiology Center of China Culture Collection Administration, and the preservation date is July 22, 2024.

9. Use of the high-yield sophorolipid biosurfactant strain according to claim 7 or 8 in producing sophorolipids.

10. The use according to claim 9, characterized in that: The high-yield sophorolipid biosurfactant strain is inoculated into a fermentation medium and fermented at 25-30° C. for 120-168 hours at a fermentation pH of 6-7; the fermentation medium comprises a carbon source, a nitrogen source and an inorganic salt; The carbon source is a combination of rapeseed oil and glucose, the carbon source concentration is 30-300 g / L, and the mass ratio of glucose to rapeseed oil is 1:1; The nitrogen source is any one or more of ammonium sulfate, corn steep liquor, peptone and yeast extract, and the concentration of the nitrogen source is 1-10 g / L; The inorganic salt is any one or more combinations of KH2PO4, Na2HPO4, MgSO4 and CaCl2, and the concentration of the inorganic salt is 1-3 g / L.

Images