Array for detecting spatial information of nucleic acid and detection method

Abstract

Methods of detecting spatial information of nucleic acids in a sample are provided, as well as nucleic acid arrays for use in the methods and methods of generating the nucleic acid arrays.

Description

[0001] This divisional application is a divisional application based on the original Chinese patent application with application number CN 202080036185.5, application date May 14, 2020, and invention name “Array and detection method for detecting spatial information of nucleic acids”. Technical Field

[0002] The present invention relates to the field of biological molecule spatial detection. Specifically, the present invention provides a method for detecting spatial information of nucleic acids in a sample, as well as a nucleic acid array used in the method and a method for generating the nucleic acid array. Background Art

[0003] The spatial position of cells in tissues significantly affects their functions. To explore this spatial heterogeneity, it is necessary to quantify and analyze the genome or transcriptome of cells with the spatial coordinates known. However, it is very laborious, expensive and inaccurate to collect smaller tissue regions or even single cells for genome or transcriptome analysis. Therefore, it is necessary to develop a method that can achieve single-cell or even subcellular level and high-throughput detection of spatial information (e.g., the location, distribution and / or expression of nucleic acids) of biological molecules (e.g., nucleic acids). Summary of the invention

[0004] In order to realize the spatial detection of nucleic acids, the prior art combines array technology with high-throughput DNA sequencing technology to capture and locate nucleic acids in labeled tissue samples, and sequence and analyze them. In order to obtain a chip capable of achieving the above purpose, the prior art fixes probes capable of capturing nucleic acids to the chip by spotting or microbead-mediated methods. However, the active area size of the chip obtained by spotting droplets on a plane using a microvolume spotting system is as high as 200 microns, and the cell observation accuracy is only 20 cells; the active area size of the chip obtained by the microbead method of plane spreading using microbeads with positioning markers is as high as 10 microns, and the cell observation accuracy can only reach a single cell, and the subcellular localization cannot be achieved. The present invention provides a new nucleic acid array for nucleic acid spatial detection and a preparation method thereof, as well as a nucleic acid spatial detection method based on the array, which can simultaneously achieve high-precision subcellular localization and high-throughput tissue localization, and has great application value.

[0005] Preparation of nucleic acid arrays

[0006] In a first aspect, the present invention provides a method for producing a nucleic acid array for detecting spatial information of nucleic acids in a biological sample, the method comprising the following steps:

[0007] (1) providing a plurality of vector sequences, each of which comprises a plurality of copies of a vector sequence, wherein the vector sequence comprises, from the 5' to the 3' direction: a positioning sequence and a first fixed sequence,

[0008] The positioning sequence has a unique nucleotide sequence corresponding to the position of the vector sequence on the array;

[0009] The first fixed sequence allows the nucleotide sequence complementary thereto to anneal and initiate an extension reaction;

[0010] (2) connecting the multiple vector sequences to the surface of a solid support (e.g., a chip);

[0011] (3) providing a first primer, and using the vector sequence as a template, performing a primer extension reaction, so that the first fixed sequence and the positioning sequence region of the vector sequence form a double strand, wherein the strand hybridized with the vector sequence is the first nucleic acid molecule, and the first nucleic acid molecule comprises the complementary sequence of the first fixed sequence and the positioning sequence from the 5' to the 3' direction; wherein the first primer comprises a first fixed sequence complementary region at its 3' end, the first fixed sequence complementary region comprises a complementary sequence of the first fixed sequence or a fragment thereof, and has a 3' free end.

[0012] In certain embodiments, the vector sequence, the first nucleic acid molecule is a single-stranded nucleic acid sequence. In certain embodiments, the vector sequence, the first nucleic acid molecule is a single-stranded DNA sequence.

[0013] In certain embodiments, in step (3), while the extension reaction is being performed, the vector sequence is sequenced to obtain the sequence information of the positioning sequence contained in the vector sequence.

[0014] In certain embodiments, in step (1), the plurality of vector sequences are provided by the following steps:

[0015] (i) providing a plurality of vector template sequences, wherein the vector template sequences comprise complementary sequences of the vector sequences;

[0016] (ii) performing a nucleic acid amplification reaction using each vector template sequence as a template to obtain an amplification product of each vector template sequence, wherein the amplification product comprises multiple copies of the vector sequence.

[0017] In certain embodiments, the amplification is selected from rolling circle replication (RCA), bridge PCR amplification, multiple strand displacement amplification (MDA), or emulsion PCR amplification.

[0018] In certain embodiments, rolling circle replication is performed to obtain DNBs formed by concatemers of the vector sequence. In such embodiments, a circular template sequence is provided in step (i). The method for preparing circular nucleic acid molecules is a conventional method in the art, and those skilled in the art can select as needed, for example, a linear nucleic acid template can be first obtained, and then the circularization of the linear nucleic acid template can be achieved by a ligase (e.g., DNA ligase).

[0019] In certain embodiments, bridge PCR amplification, emulsion PCR amplification, or multiple strand displacement amplification is performed to obtain a DNA cluster formed by a clonal population of the vector sequence.

[0020] In some embodiments, the method further comprises the following steps:

[0021] (4) providing a second nucleic acid molecule, wherein the second nucleic acid molecule comprises a capture sequence;

[0022] The capture sequence is capable of hybridizing with all or part of the nucleic acid to be captured, and includes: (a) an oligonucleotide sequence capable of capturing mRNA; and / or, (b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a specific target nucleic acid; and the capture sequence has a 3' free end so that the second nucleic acid molecule can serve as an extension primer,

[0023] (5) ligating the second nucleic acid molecule to the first nucleic acid molecule (eg, using a ligase to ligate the second nucleic acid molecule to the first nucleic acid molecule).

[0024] In certain embodiments, the second nucleic acid molecule is a single-stranded nucleic acid sequence. In certain embodiments, the second nucleic acid molecule is a single-stranded DNA sequence. In certain embodiments, the second nucleic acid molecule is a single-stranded RNA sequence.

[0025] In certain embodiments, the second nucleic acid molecule comprises a fixed region and a capture sequence from 5' to 3' direction, and the fixed region comprises a double-stranded nucleic acid sequence, such as a double-stranded DNA sequence. In certain embodiments, the capture sequence included in the second nucleic acid molecule is a single-stranded nucleic acid sequence, such as a single-stranded DNA sequence or a single-stranded RNA sequence. It is easy to understand that in such embodiments, the second nucleic acid molecule has a partial double-stranded structure, that is, its fixed region has a double-stranded structure, and the capture sequence is a single-stranded structure.

[0026] In certain embodiments, the length of the double-stranded nucleic acid sequence is 1 bp-50 bp, such as 10 bp-50 bp, 10 bp-40 bp or 10 bp-30 bp.

[0027] In other embodiments, the method further comprises the following steps:

[0028] (4) providing a second nucleic acid molecule, wherein the second nucleic acid molecule comprises a second fixed sequence complementary sequence and a capture sequence from the 5' to the 3' direction;

[0029] The second fixed sequence complementary sequence allows hybridization with a nucleotide sequence complementary thereto;

[0030] The capture sequence is capable of hybridizing with all or part of the nucleic acid to be captured, and includes: (a) an oligonucleotide sequence capable of capturing mRNA; and / or, (b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a specific target nucleic acid; and the capture sequence has a 3' free end so that the second nucleic acid molecule can serve as an extension primer;

[0031] (5) allowing the second fixed sequence complementary sequence to hybridize with the second fixed sequence under conditions that allow annealing, thereby connecting the second nucleic acid molecule to the vector sequence;

[0032] (6) Optionally, the first nucleic acid molecule and the second nucleic acid molecule respectively hybridized on the vector sequence are ligated (for example, the second nucleic acid molecule is ligated to the first nucleic acid molecule using a ligase).

[0033] In such embodiments, each carrier sequence further comprises a second fixed sequence at its 5' end, which allows annealing of a nucleotide sequence complementary thereto. In certain embodiments, the second fixed sequence allows annealing of a nucleotide sequence complementary thereto and initiates an extension reaction (e.g., can serve as a binding site for a bridge PCR primer).

[0034] In certain embodiments, the second nucleic acid molecule is a single-stranded nucleic acid sequence. In certain embodiments, the second nucleic acid molecule is a single-stranded DNA sequence. In certain embodiments, the second nucleic acid molecule is a single-stranded RNA sequence.

[0035] In certain embodiments, the second fixation sequence is contiguous with the positioning sequence.

[0036] In certain embodiments, the length of the second fixed sequence is 1 bp-50 bp, such as 10 bp-50 bp, 10 bp-40 bp, 10 bp-30 bp, or 10 bp-20 bp.

[0037] In some embodiments, in step (3), the first primer further comprises a unique molecular identifier (UMI) sequence at the 5' end of its first fixed sequence complementary region, so that the first nucleic acid molecule comprises the UMI sequence at the 5' end of its first fixed sequence complementary sequence; or, in step (4), the second nucleic acid molecule further comprises a UMI sequence, and the UMI sequence is located at the 5' end of the capture sequence;

[0038] The UMI sequence is a nucleotide sequence consisting of at least 1 (e.g., at least 2, at least 3, at least 4, or at least 5; e.g., 5-100, 5-50, 5-20, e.g., 10) N, and each N is independently any one of A, C, G and T.

[0039] In certain embodiments, when the first primer comprises a unique molecular identifier (UMI) sequence at the 5' end of its first fixed sequence complementary region, the first primer may further comprise an additional sequence at the 5' end of the UMI sequence.

[0040] In certain embodiments, the oligonucleotide sequence capable of capturing mRNA comprises a sequence capable of hybridizing with the poly-A tail of mRNA. In certain embodiments, the oligonucleotide sequence capable of capturing mRNA comprises a poly-T oligonucleotide sequence. In certain embodiments, the poly-T oligonucleotide sequence comprises at least 10 (e.g., at least 20) deoxythymidine residues.

[0041] In certain embodiments, the solid support is a chip. In certain embodiments, the solid support can be used as a sequencing platform, such as a sequencing chip. In certain embodiments, the solid support is a high-throughput sequencing chip, such as a high-throughput sequencing chip for Illumina, MGI or Thermo Fisher sequencing platforms.

[0042] In a second aspect, the present invention provides a method for producing a nucleic acid array for detecting spatial information of nucleic acids in a biological sample, the method comprising the following steps:

[0043] (1) providing a plurality of vector sequences, each vector sequence comprising a plurality of copies of a vector sequence, wherein the vector sequence comprises, from the 5' to the 3' direction: a capture template sequence, a positioning sequence and a first fixed sequence,

[0044] The capture template sequence comprises a complementary sequence of a capture sequence, and the capture sequence is capable of hybridizing with all or part of the nucleic acid to be captured, which includes: (a) an oligonucleotide sequence capable of capturing mRNA; and / or, (b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a specific target nucleic acid;

[0045] The positioning sequence has a unique nucleotide sequence corresponding to the position of the vector sequence on the array;

[0046] The first fixed sequence allows the complementary nucleotide sequence to anneal and initiate an extension reaction; and the first fixed sequence further comprises a cleavage site, and the cleavage can be selected from nicking enzyme cleavage, USER cleavage, photo-cleavage, chemical cleavage or CRISPR cleavage;

[0047] (2) connecting the multiple vector sequences to the surface of a solid support (e.g., a chip);

[0048] (3) providing a first primer (or probe primer), wherein the first primer comprises a binding region, a resection region and a first fixed sequence complementary region in the 5' to 3' direction, wherein the first fixed sequence complementary region comprises a complementary sequence of the first fixed sequence or a fragment thereof and has a 3' free end; the binding region comprises a linker capable of connecting to the surface of the solid support; and the resection region comprises a cleavage site;

[0049] Using the first primer as a primer and the vector sequence as a template, a primer extension reaction is performed, so that the first fixed sequence, the positioning sequence and the capture template sequence region of the vector sequence form a double strand, wherein the strand hybridized with the vector sequence is the first nucleic acid molecule, and the first nucleic acid molecule comprises a first fixed sequence complementary sequence, a positioning sequence complementary sequence and a capture sequence from the 5' to 3' direction; the first nucleic acid molecule can also be called a capture probe;

[0050] (4) connecting the first primer to the surface of the solid support; wherein steps (3) and (4) are performed in any order;

[0051] (5) Optionally, the cleavage site contained in the first fixed sequence of the vector sequence is cut to digest the vector sequence, so that the extension product in step (3) is separated from the template that forms the extension product (i.e., the vector sequence), thereby connecting the first nucleic acid molecule (capture probe) to the surface of a solid support (e.g., a chip).

[0052] Since the capture probe (i.e., the first nucleic acid molecule) is obtained by primer extension using the carrier sequence as a template, the capture probe comprises a unique positioning sequence complementary sequence corresponding to the position of the capture probe (the carrier sequence) on the array, and a capture sequence that can hybridize with all or part of the nucleic acid molecule to be captured. The position of the capture probe on the array can be determined by analyzing the positioning sequence complementary sequence.

[0053] Herein, the expression "each vector sequence" refers to vector sequences comprising the same localization sequence.

[0054] In certain embodiments, in step (1), the plurality of vector sequences are provided by the following steps:

[0055] (i) providing a plurality of vector template sequences, wherein the vector template sequences comprise complementary sequences of the vector sequences;

[0056] (ii) performing a nucleic acid amplification reaction using each vector template sequence as a template to obtain an amplification product of each vector template sequence, wherein the amplification product comprises multiple copies of the vector sequence.

[0057] In certain embodiments, the amplification is selected from rolling circle replication (RCA), bridge PCR amplification, multiple strand displacement amplification (MDA), or emulsion PCR amplification.

[0058] In certain embodiments, rolling circle replication is performed to obtain DNBs formed by concatemers of the vector sequence. In such embodiments, a circular template sequence is provided in step (i). The method for preparing circular nucleic acid molecules is a conventional method in the art, and those skilled in the art can select as needed, for example, a linear nucleic acid template can be first obtained, and then the circularization of the linear nucleic acid template can be achieved by a ligase (e.g., DNA ligase).

[0059] In certain embodiments, each vector sequence is a DNB formed from concatemers of multiple copies of the vector sequence.

[0060] In certain embodiments, step (1) comprises the following steps:

[0061] (1a) providing a circular nucleic acid template, wherein the circular nucleic acid template comprises a vector template sequence, wherein the vector template sequence comprises a complementary sequence to the vector sequence, that is, the vector template sequence comprises a first fixed sequence complementary sequence, a positioning sequence complementary sequence and a capture sequence in the 5' to 3' direction;

[0062] (1b) performing rolling circle amplification (RCA) using the circular nucleic acid template as a template to obtain a nanoball (DNB) formed by concatemers of the vector sequence.

[0063] In certain embodiments, bridge PCR amplification, emulsion PCR amplification, or multiple strand displacement amplification is performed to obtain a DNA cluster formed by a clonal population of the vector sequence.

[0064] In some embodiments, the cleavage site included in the first fixed sequence is a nicking enzyme cleavage site. In some embodiments, the nicking enzyme is selected from USER, BamHI, BmtI, etc. In some exemplary embodiments, the cleavage site is shown in SEQ ID NO:14.

[0065] In certain embodiments, the first fixed sequence further comprises a sequencing primer hybridization region and / or an amplification primer hybridization region; wherein the sequencing primer hybridization region allows the sequencing primer to anneal and initiate a sequencing reaction, and the amplification primer hybridization region allows the amplification primer to anneal and initiate an extension and amplification reaction.

[0066] In some embodiments, the length of the first fixed sequence is greater than 1 bp, such as greater than 10 bp, or greater than 20 bp. In some embodiments, the length of the first fixed sequence is 20-100 bp, such as 20-80 bp.

[0067] In certain embodiments, the length of the positioning sequence is greater than 1 bp, such as greater than 10 bp. In certain embodiments, the length of the positioning sequence is 10-100 bp, such as 10-50 bp, such as 10-30 bp, such as 20 bp.

[0068] In certain embodiments, the oligonucleotide sequence capable of capturing mRNA comprises a sequence capable of hybridizing with the poly-A tail of mRNA. In certain embodiments, the oligonucleotide sequence capable of capturing mRNA comprises a poly-T oligonucleotide sequence. In certain embodiments, the poly-T oligonucleotide sequence comprises at least 10 (e.g., at least 20) deoxythymidine residues.

[0069] In certain embodiments, the capture sequence is greater than 1 bp in length. In certain embodiments, the capture sequence is 1-100 bp in length, such as 10-50 bp, such as 10-30 bp.

[0070] In some embodiments, the carrier sequence further comprises a UMI complementary sequence (also referred to as a probe tag region) located downstream of the capture template sequence and upstream of the first fixed sequence, which is complementary to the UMI sequence, and the UMI sequence is a nucleotide sequence consisting of at least 1 (e.g., at least 2, at least 3, at least 4, or at least 5; for example, 5-100, 5-50, 5-20, for example, 10) N, each N independently being any one of A, C, G, and T. In some embodiments, the UMI complementary sequence is located between the positioning sequence and the capture template sequence. In other embodiments, the UMI complementary sequence is located between the first fixed sequence and the positioning sequence. In such embodiments, in step (3), when a primer extension reaction is performed using the carrier sequence as a template, the first nucleic acid molecule / capture probe hybridized with the carrier sequence will correspondingly comprise the UMI sequence (also referred to as a probe tag).

[0071] In some embodiments, to obtain the above-mentioned UMI sequence or its complementary sequence, the template sequence of the vector sequence (i.e., the vector template sequence) includes a UMI template sequence at a corresponding position, and the UMI template sequence is a sequence composed of modified bases, and the modified bases can form hydrogen bond complementary pairing with a variety of main bases (e.g., C, G, A, T, U), such as Inosine, which can complementarily pair with bases A, C, and U. Without being bound by theory, it is believed that when the vector template sequence includes the UMI template sequence, during the rolling circle replication process, each time the replication is performed, the base that can complementarily pair with the UMI template sequence is randomly combined, so that each replication product carries a unique randomly formed UMI sequence, and each replication product is distinguished, such as capturing different nucleic acid molecules for copy number quantification. In some embodiments, the UMI template sequence includes multiple Inosines (e.g., at least 10, such as 10-100). In some embodiments, the length of the UMI template sequence is greater than 1 bp. In some embodiments, the length of the UMI template sequence is greater than 5 bp. In certain implementations, the length of the UMI template sequence is 5-100 bp, such as 5-50 bp, such as 5-20 bp, such as 5-15 bp, such as 10 bp.

[0072] In certain embodiments, the solid support is a chip. In certain embodiments, the solid support can be used as a sequencing platform. In certain embodiments, the solid support is a sequencing chip (BGI), such as the sequencing chip of the BGISEQ-500 platform. In certain embodiments, the solid support is a high-density array chip, such as can be obtained by the method described in patent CN103180496B.

[0073] The carrier sequence (e.g., DNB) can be attached to the solid support surface by any suitable method known in the art. In certain embodiments, non-limiting examples of the method include nucleic acid hybridization, biotin-streptavidin binding, sulfhydryl binding, photoactivated binding, covalent binding, antibody-antigen, physical confinement via hydrogels or other porous polymers, etc., or any combination thereof.

[0074] In certain embodiments, the solid support is selected from the following materials: glass, silicon, poly-lysine coating material, nitrocellulose, polystyrene, cyclic olefin copolymers (COCs), cyclic olefin polymers (COPs), polypropylene, polyethylene or polycarbonate, etc.

[0075] In certain embodiments, in step (3), while performing the primer extension reaction, the vector sequence (eg, the positioning sequence contained therein) is sequenced to obtain the sequence information of the positioning sequence contained in the vector sequence.

[0076] In some embodiments, before step (3), the step of sequencing the vector sequence (eg, the positioning sequence contained therein) is also included. In some embodiments, after sequencing is completed, washing is performed to remove the dNTPs added to the synthetic chain due to sequencing.

[0077] In certain embodiments, the linker is a linker that can be coupled to an activating group (e.g., NH2). In such embodiments, the surface of the solid support is modified with an activating group (e.g., NH2). In certain embodiments, the linker includes -SH, -DBCO, or -NHS, etc. In certain exemplary embodiments, the linker is DBCO, and the surface of the solid support is connected with Azido- 8-NHS ester.

[0078]

[0079] In certain embodiments, the cleavage site included in the excision region of the first primer is a site that can be controlled by chemical, enzymatic or photochemical methods. In certain embodiments, the cleavage site is an enzyme cleavage site. In certain embodiments, the cleavage site is the enzyme cleavage site (UUU) of the USER enzyme.

[0080] In certain embodiments, the excision region of the first primer is different from the cleavage site contained in the first fixed sequence of the vector sequence.

[0081] In certain embodiments, the amplifying comprises PCR.

[0082] Nucleic acid arrays and kits

[0083] In a third aspect, the present invention provides a nucleic acid array for detecting spatial information of nucleic acids in a sample, comprising a solid support (e.g., a chip) having a plurality of carrier sequences connected to the surface, each carrier sequence occupying a different position in the array, each carrier sequence comprising a plurality of copies of the carrier sequence, and the carrier sequence comprising, from the 5' to the 3' direction: a positioning sequence and a first fixed sequence,

[0084] The positioning sequence has a unique nucleotide sequence corresponding to the position of the vector sequence on the array;

[0085] The first fixed sequence allows the nucleotide sequence complementary thereto to anneal and initiate an extension reaction.

[0086] In certain embodiments, the area occupied by each carrier sequence (i.e., carrier sequences comprising the same positioning sequence) on the surface of the solid support (i.e., active area) is less than 1 micron in diameter, e.g., about 900 nanometers, about 800 nanometers, about 700 nanometers, about 600 nanometers, or about 500 nanometers.

[0087] In certain embodiments, the nucleic acid array further comprises a first nucleic acid molecule, which comprises, from the 5' to the 3' direction: a first fixed sequence complementary sequence and a positioning sequence complementary sequence, and hybridizes with the first fixed sequence and the positioning sequence of the carrier sequence to form a double strand. It is easy to understand that only the first fixed sequence complementary sequence and the positioning sequence complementary sequence in the first nucleic acid molecule are complementary to the corresponding sequences of the carrier sequence to form a double strand, so the double strand formed by the first fixed sequence and the carrier sequence is an incomplete double strand, that is, a partial double strand structure.

[0088] In certain embodiments, each copy of each vector sequence comprises a first nucleic acid molecule hybridized thereto.

[0089] In certain embodiments, the vector sequence, the first nucleic acid molecule is a single-stranded nucleic acid sequence. In certain embodiments, the vector sequence, the first nucleic acid molecule is a single-stranded DNA sequence.

[0090] In some embodiments, the nucleic acid array further comprises a second nucleic acid molecule, the second nucleic acid molecule is linked to the first nucleic acid molecule, thereby being fixed to the nucleic acid array, the second nucleic acid molecule comprising a capture sequence;

[0091] The capture sequence is capable of hybridizing with all or part of the nucleic acid to be captured, and includes: (a) an oligonucleotide sequence capable of capturing mRNA; and / or, (b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a specific target nucleic acid; and, the capture sequence has a 3' free end so that the second nucleic acid molecule can serve as an extension primer.

[0092] In certain embodiments, each first nucleic acid molecule is linked to the second nucleic acid molecule.

[0093] In certain embodiments, the 5' end of the second nucleic acid molecule is linked to the 3' end of the first nucleic acid molecule.

[0094] In other embodiments, the nucleic acid array further comprises a second nucleic acid molecule, which is hybridized to a carrier sequence and thereby fixed to the nucleic acid array.

[0095] In such embodiments, each carrier sequence further comprises a second fixed sequence at its 5' end, which allows annealing of a nucleotide sequence complementary thereto; and,

[0096] The second nucleic acid molecule comprises a second fixed sequence complementary sequence and a capture sequence from 5' to 3'; the second fixed sequence complementary sequence hybridizes with the second fixed sequence of the carrier sequence to form a double strand;

[0097] The capture sequence is capable of hybridizing with all or part of the nucleic acid to be captured, and includes: (a) an oligonucleotide sequence capable of capturing mRNA; and / or, (b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a specific target nucleic acid; and, the capture sequence has a 3' free end so that the second nucleic acid molecule can serve as an extension primer.

[0098] In certain embodiments, each copy of the vector sequence in each vector sequence comprises a second nucleic acid molecule hybridized thereto.

[0099] In certain embodiments, the second fixed sequence allows a nucleotide sequence complementary thereto to anneal and initiate an extension reaction (eg, can serve as a binding site for a bridge PCR primer).

[0100] In certain embodiments, the second fixation sequence is contiguous with the positioning sequence.

[0101] In certain embodiments, the second nucleic acid molecule has a 5' end modification. In certain embodiments, the modification is phosphorylation or biotin modification.

[0102] In certain embodiments, the second nucleic acid molecule is a single-stranded nucleic acid sequence. In certain embodiments, the second nucleic acid molecule is a single-stranded DNA sequence. In certain embodiments, the second nucleic acid molecule is a single-stranded RNA sequence.

[0103] In certain embodiments, the multiple copies of the vector sequence are amplification products formed by amplification using the complementary sequence of the vector sequence as a template, and the amplification is selected from rolling circle replication (RCA), bridge PCR amplification, multiple strand displacement amplification (MDA) or emulsion PCR amplification.

[0104] In some embodiments, the plurality of copies of the vector sequence are DNBs formed by concatemers of the vector sequence. In some embodiments, the plurality of copies of the vector sequence are DNBs formed by rolling circle replication using the complementary sequence of the vector sequence as a template.

[0105] In certain embodiments, the multiple copies of the vector sequence are a DNA cluster formed by a clonal population of the vector sequence.

[0106] In certain embodiments, the multiple copies of the vector sequence are DNA clusters formed by bridge PCR amplification using the complementary sequence of the vector sequence as a template.

[0107] In certain embodiments, the multiple copies of the vector sequence are DNA clusters formed by emulsion PCR amplification using the complementary sequence of the vector sequence as a template.

[0108] In certain embodiments, the multiple copies of the vector sequence are DNA clusters formed by multiple strand displacement amplification using the complementary sequence of the vector sequence as a template.

[0109] In some embodiments, the first nucleic acid molecule further comprises a unique molecular identifier (UMI) sequence, and the UMI sequence is located at the 5' end of the complementary sequence of the first fixed sequence; or, the second nucleic acid molecule further comprises a UMI sequence, and the UMI sequence is located at the 5' end of the capture sequence;

[0110] The UMI sequence is a nucleotide sequence consisting of at least 1 (e.g., at least 2, at least 3, at least 4, or at least 5; e.g., 5-100, 5-50, 5-20, e.g., 10) N, and each N is independently any one of A, C, G and T.

[0111] In some embodiments, each first nucleic acid molecule comprises a UMI sequence that is different from one another.

[0112] In some embodiments, each second nucleic acid molecule comprises a UMI sequence that is different from one another.

[0113] In certain embodiments, the solid support is a chip. In certain embodiments, the solid support can be used as a sequencing platform, such as a sequencing chip. In certain embodiments, the solid support is a high-throughput sequencing chip, such as a high-throughput sequencing chip for Illumina, MGI or Thermo Fisher sequencing platforms.

[0114] In certain embodiments, the oligonucleotide sequence capable of capturing mRNA comprises a sequence capable of hybridizing with the poly-A tail of mRNA. In certain embodiments, the oligonucleotide sequence capable of capturing mRNA comprises a poly-T oligonucleotide sequence. In certain embodiments, the poly-T oligonucleotide sequence comprises at least 10 (e.g., at least 20) deoxythymidine residues.

[0115] In some embodiments, the length of the positioning sequence is greater than 1 nt, such as greater than 5 nt. In some embodiments, the length of the positioning sequence is 5-50 nt, such as 10-50 nt, 10-30 nt, or 20-30 nt. In some embodiments, the lengths of the positioning sequences contained in different vector sequences may be the same or different.

[0116] In certain embodiments, the capture sequence is greater than 1 nt in length. In certain embodiments, the capture sequence is 1-100 nt in length, such as 1-50 nt, such as 10-30 nt.

[0117] In some embodiments, the length of the first fixed sequence is greater than 1 nt, such as greater than 10 nt. In some embodiments, the length of the first fixed sequence is 10-200 nt. In some embodiments, the length of the first fixed sequence is 20-100 nt, such as 20-50 nt.

[0118] In some embodiments, the length of the second fixed sequence is greater than 1 nt, such as greater than 10 nt. In some embodiments, the length of the second fixed sequence is 10-200 nt, such as 10-100 nt, 10-50 nt, 10-30 nt, or 10-20 nt.

[0119] In a fourth aspect, the present invention provides a kit for detecting spatial information of nucleic acids in a sample, comprising: (i) the nucleic acid array of the third aspect, wherein the nucleic acid array does not comprise a second nucleic acid molecule; and, (ii) a second nucleic acid molecule, wherein the second nucleic acid molecule comprises a fixed region and a capture sequence from the 5' to the 3' direction;

[0120] The capture sequence is capable of hybridizing with all or part of the nucleic acid to be captured, and includes: (a) an oligonucleotide sequence capable of capturing mRNA; and / or, (b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a specific target nucleic acid; and, the capture sequence has a 3' free end so that the second nucleic acid molecule can serve as an extension primer.

[0121] In some embodiments, the kit comprises: (i) a nucleic acid array, comprising a solid support (e.g., a chip) having a plurality of vector sequences attached to its surface, each vector sequence occupying a different position in the array, each vector sequence comprising a plurality of copies of the vector sequence, and the vector sequence comprising, in the direction from 5' to 3': a positioning sequence and a first fixed sequence,

[0122] The positioning sequence has a unique nucleotide sequence corresponding to the position of the vector sequence on the array;

[0123] The first fixed sequence allows the nucleotide sequence complementary thereto to anneal and initiate an extension reaction;

[0124] The nucleic acid array further comprises a first nucleic acid molecule, which comprises, from 5' to 3', a first fixed sequence complementary sequence and a positioning sequence complementary sequence, and hybridizes with the first fixed sequence and the positioning sequence of the carrier sequence to form a double strand;

[0125] and, (ii) a second nucleic acid molecule, the fixed region of which comprises a double-stranded DNA sequence.

[0126] It is easy to understand that a ligase can be used to connect the second nucleic acid molecule described in (ii) to the first nucleic acid molecule contained in the nucleic acid array described in (i). Therefore, in certain embodiments, the kit further comprises a ligase.

[0127] In other embodiments, the kit comprises: (i) a nucleic acid array, comprising a solid support (e.g., a chip) having a plurality of vector sequences attached to its surface, each vector sequence occupying a different position in the array, each vector sequence comprising a plurality of copies of the vector sequence, and the vector sequence comprising, in the direction from 5' to 3': a second fixed sequence, a positioning sequence, and a first fixed sequence,

[0128] The second fixed sequence allows annealing to a nucleotide sequence complementary thereto;

[0129] The positioning sequence has a unique nucleotide sequence corresponding to the position of the vector sequence on the array;

[0130] The first fixed sequence allows the nucleotide sequence complementary thereto to anneal and initiate an extension reaction;

[0131] The nucleic acid array further comprises a first nucleic acid molecule, which comprises, from 5' to 3', a first fixed sequence complementary sequence and a positioning sequence complementary sequence, and hybridizes with the first fixed sequence and the positioning sequence of the carrier sequence to form a double strand;

[0132] and, (ii) a second nucleic acid molecule, the fixed region of the second nucleic acid molecule comprising a second fixed sequence complementary sequence.

[0133] In certain embodiments, the second fixation sequence is contiguous with the positioning sequence.

[0134] It is easy to understand that under conditions that allow annealing, the second nucleic acid molecule described in (ii) can hybridize with the complementary region of the vector sequence contained in the nucleic acid array described in (i), and then the second nucleic acid molecule can be connected to the first nucleic acid molecule using a ligase. Therefore, in certain embodiments, the kit further comprises a ligase.

[0135] On the other hand, the present invention also relates to the use of the nucleic acid array described in the third aspect or the kit described in the fourth aspect for detecting spatial information of nucleic acids in a sample, or in preparing a detection reagent for detecting spatial information of nucleic acids in a sample.

[0136] In certain embodiments, the spatial information of the nucleic acid includes the location, distribution and / or expression of the nucleic acid.

[0137] In certain embodiments, the sample is a tissue sample, such as a tissue sample containing cells. In certain embodiments, the sample is a tissue section. In certain embodiments, the tissue section is prepared from fixed tissue, such as, with formalin-fixed paraffin-embedded (FFPE) tissue or deep-frozen tissue.

[0138] In a fifth aspect, the present invention also relates to a nucleic acid array for detecting spatial information of nucleic acids in a sample, comprising a solid support (e.g., a chip) having a plurality of carrier sequences connected to the surface, each carrier sequence occupying a different position in the array, each carrier sequence comprising a plurality of copies of the carrier sequence, and the carrier sequence comprising, from 5' to 3', a capture template sequence, a positioning sequence, and a first fixed sequence, wherein:

[0139] The capture template sequence comprises a complementary sequence of a capture sequence, and the capture sequence is capable of hybridizing with all or part of the nucleic acid to be captured, which includes: (a) an oligonucleotide sequence capable of capturing mRNA; and / or, (b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a specific target nucleic acid;

[0140] The positioning sequence has a unique nucleotide sequence corresponding to the position of the vector sequence on the array;

[0141] The first fixed sequence allows the complementary nucleotide sequence to anneal and initiate an extension reaction, and the first fixed sequence further comprises a cleavage site, and the cleavage can be selected from nicking enzyme cleavage, USER cleavage, photo-cleavage, chemical cleavage or CRISPR cleavage;

[0142] The nucleic acid array further comprises a first nucleic acid molecule (also referred to as a capture probe), wherein the first nucleic acid molecule comprises, from the 5' to the 3' direction: a binding region, a resection region, and a region complementary to a vector sequence.

[0143] The binding region comprises a linker capable of connecting to the surface of the solid support;

[0144] The excision region comprises a cleavage site;

[0145] The vector sequence complementary region comprises a sequence that is complementary to the vector sequence, and comprises, from 5' to 3', a first fixed sequence complementary sequence, a positioning sequence complementary sequence and a capture sequence; and the capture sequence has a 3' free end so that the first nucleic acid molecule can serve as an extension primer;

[0146] Furthermore, the vector sequence complementary region of the first nucleic acid molecule hybridizes with the vector sequence to form a double strand.

[0147] In certain embodiments, the vector sequence, the first nucleic acid molecule is a single-stranded nucleic acid sequence. In certain embodiments, the vector sequence, the first nucleic acid molecule is a single-stranded DNA sequence.

[0148] In certain embodiments, each copy of each vector sequence comprises the first nucleic acid molecule described above hybridized thereto.

[0149] In certain embodiments, the linker of the first nucleic acid molecule is a linker capable of coupling to an activating group (e.g., NH2), and the surface of the solid support is modified with an activating group (e.g., NH2). In certain embodiments, the linker comprises -SH, -DBCO, or -NHS. In certain embodiments, the linker is (DBCO), the surface of the solid support is connected with (Azido- 8-NHSester).

[0150] In some embodiments, the cleavage site included in the first fixed sequence is a nicking enzyme cleavage site. In some embodiments, the nicking enzyme is selected from USER, BamHI, BmtI, etc. In some exemplary embodiments, the cleavage site is shown in SEQ ID NO:14.

[0151] In certain embodiments, the cleavage site included in the excision zone of the first nucleic acid molecule is a site that can be controlled by chemical, enzymatic or photochemical methods. In certain embodiments, the cleavage site is an enzyme cleavage site. In certain embodiments, the cleavage site is the enzyme cleavage site (UUU) of the USER enzyme.

[0152] In certain embodiments, the excision region of the first nucleic acid molecule is different from the cleavage site comprised by the first fixed sequence of the vector sequence.

[0153] In certain embodiments, the nucleic acid array is prepared by the method described in the second aspect.

[0154] In certain embodiments, the multiple copies of the vector sequence are amplification products formed by amplification using the complementary sequence of the vector sequence as a template, and the amplification is selected from rolling circle replication (RCA), bridge PCR amplification, multiple strand displacement amplification (MDA) or emulsion PCR amplification.

[0155] In some embodiments, the plurality of copies of the vector sequence are DNBs formed by concatemers of the vector sequence. In some embodiments, the plurality of copies of the vector sequence are DNBs formed by rolling circle replication using the complementary sequence of the vector sequence as a template.

[0156] In certain embodiments, the multiple copies of the vector sequence are a DNA cluster formed by a clonal population of the vector sequence.

[0157] In certain embodiments, the multiple copies of the vector sequence are DNA clusters formed by bridge PCR amplification using the complementary sequence of the vector sequence as a template.

[0158] In certain embodiments, the multiple copies of the vector sequence are DNA clusters formed by emulsion PCR amplification using the complementary sequence of the vector sequence as a template.

[0159] In certain embodiments, the multiple copies of the vector sequence are DNA clusters formed by multiple strand displacement amplification using the complementary sequence of the vector sequence as a template.

[0160] In some embodiments, the carrier sequence further comprises a UMI complementary sequence located downstream of the capture template sequence and upstream of the first fixed sequence, which is complementary to the UMI sequence, wherein the UMI sequence is a nucleotide sequence consisting of at least 1 (e.g., at least 2, at least 3, at least 4, or at least 5; e.g., 5-100, 5-50, 5-20, e.g., 10) N, each N being independently any one of A, C, G, and T;

[0161] Furthermore, the vector sequence complementary region of the first nucleic acid molecule further comprises a UMI sequence located upstream of the capture sequence and downstream of the first fixed sequence complementary sequence.

[0162] In certain embodiments, the UMI-complementary sequence is located between the localization sequence and the capture template sequence, or between the first fixed sequence and the localization sequence.

[0163] In some embodiments, each copy of the vector sequence in each vector sequence (i.e., a vector sequence comprising the same positioning sequence) has a different UMI complementary sequence from each other. Accordingly, the first nucleic acid molecule (capture probe) hybridized to each copy of the vector sequence also has a different UMI sequence from each other.

[0164] In certain embodiments, the carrier sequence is removed from the nucleic acid array by a cleavage site contained in the first fixed sequence of the carrier sequence. In such embodiments, the nucleic acid array includes a solid support (e.g., a chip) with a plurality of capture probes (first nucleic acid molecules) attached to the surface, each capture probe (first nucleic acid molecule) occupies a different position in the array and is oriented to have a 3' free end so that the capture probe (first nucleic acid molecule) can serve as an extension primer, wherein each capture probe (first nucleic acid molecule) comprises, from 5' to 3', a binding region, an excision region, a positioning sequence complementary sequence, and a capture sequence, wherein,

[0165] The binding region comprises a linker capable of connecting to the surface of the solid support;

[0166] The excision region comprises a cleavage site;

[0167] The positioning sequence corresponds to the position of the capture probe on the array;

[0168] The capture sequence is capable of hybridizing with all or part of the nucleic acid to be captured, and includes: (1a) an oligonucleotide sequence capable of capturing mRNA; and / or, (1b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a specific target nucleic acid.

[0169] In some embodiments, each capture probe in each capture probe (i.e., capture probes comprising the same localization sequence / localization sequence complement sequence) has a different UMI sequence from each other, and the UMI sequence is located upstream of the capture sequence and downstream of the excision region. In some embodiments, the UMI sequence is located at the 5' end of the capture sequence, for example, between the capture sequence and the localization sequence complement sequence. In other embodiments, the UMI sequence is located at the 5' end of the localization sequence complement sequence, for example, between the excision region and the localization sequence complement sequence.

[0170] In certain embodiments, the area occupied by each carrier sequence (i.e., carrier sequences comprising the same positioning sequence) or each capture probe (i.e., capture probes comprising the same positioning sequence / positioning sequence complementary sequence) on the surface of the solid support (i.e., active area) is less than 1 micron in diameter, such as about 900 nanometers, about 800 nanometers, about 700 nanometers, about 600 nanometers, or about 500 nanometers. In certain embodiments, the diameter of the active area of ​​each carrier sequence or each capture probe is about 500 nanometers.

[0171] In certain embodiments, the solid support is a chip. In certain embodiments, the solid support can be used as a sequencing platform. In certain embodiments, the solid support is a sequencing chip (BGI), such as the BGISEQ-500 platform. In certain embodiments, the solid support is a high-density array chip, such as can be obtained by the method described in patent CN103180496B.

[0172] In some embodiments, the length of the first fixed sequence is greater than 1 bp, such as greater than 10 bp, or greater than 20 bp. In some embodiments, the length of the first fixed sequence is 20-100 bp, such as 20-80 bp.

[0173] In certain embodiments, the length of the positioning sequence is greater than 1 bp, such as greater than 10 bp. In certain embodiments, the length of the positioning sequence is 10-100 bp, such as 10-50 bp, such as 10-30 bp, such as 20 bp.

[0174] In certain embodiments, the oligonucleotide sequence capable of capturing mRNA comprises a sequence capable of hybridizing with the poly-A tail of mRNA. In certain embodiments, the oligonucleotide sequence capable of capturing mRNA comprises a poly-T oligonucleotide sequence. In certain embodiments, the poly-T oligonucleotide sequence comprises at least 10 (e.g., at least 20) deoxythymidine residues.

[0175] In certain embodiments, the capture sequence is greater than 1 bp in length. In certain embodiments, the capture sequence is 1-100 bp in length, such as 10-50 bp, such as 10-30 bp.

[0176] Detection Methods

[0177] In a sixth aspect, the present invention provides a method for detecting spatial information of nucleic acids in a sample, comprising the following steps:

[0178] (1) Providing the nucleic acid array described in the third aspect, or obtaining the nucleic acid array by the method described in the first aspect; wherein:

[0179] The nucleic acid array comprises a plurality of vector sequences connected to the surface of a solid support (e.g., a chip), each vector sequence occupies a different position in the array, and each vector sequence comprises a plurality of copies of the vector sequence;

[0180] Each vector sequence comprises a first nucleic acid molecule and a second nucleic acid molecule hybridized thereto, and the first nucleic acid molecule and the second nucleic acid molecule are not linked to each other;

[0181] The first nucleic acid molecule comprises a complementary sequence to a positioning sequence corresponding to the position of the vector sequence on the array,

[0182] The second nucleic acid molecule comprises a capture sequence capable of capturing nucleic acid in a sample;

[0183] (2) contacting the nucleic acid array with a sample to be tested under conditions that allow annealing, so that the nucleic acid in the sample to be tested anneals with the capture sequence of the second nucleic acid molecule, thereby making the position of the nucleic acid correspond to the position of the carrier sequence on the nucleic acid array;

[0184] (3) (i) when the first nucleic acid molecule and the second nucleic acid molecule are not ligated to each other, ligating the first nucleic acid molecule and the second nucleic acid molecule hybridized to each vector sequence (for example, using a ligase);

[0185] Under conditions allowing primer extension, a primer extension reaction is performed using the connected first and second nucleic acid molecules as primers and the captured nucleic acid molecule as a template to produce an extension product, wherein the chain hybridized with the captured nucleic acid molecule has a complementary sequence to the positioning sequence contained in the first nucleic acid molecule as a spatial information marker; and / or,

[0186] Using the captured nucleic acid molecule as a primer and the connected first and second nucleic acid molecules as a template, a primer extension reaction is performed to produce an extended captured nucleic acid molecule, wherein the extended captured nucleic acid molecule has the positioning sequence as a spatial information marker;

[0187] Alternatively, (ii) when the first nucleic acid molecule and the second nucleic acid molecule are not connected to each other, under conditions that allow primer extension, a primer extension reaction is performed using the second nucleic acid molecule as a primer and the captured nucleic acid molecule as a template to produce an extended second nucleic acid molecule, wherein the extended second nucleic acid molecule comprises a complementary sequence to the captured nucleic acid; the first nucleic acid molecule hybridized on each carrier sequence and the extended second nucleic acid molecule are connected (for example, using a ligase), and the extended second nucleic acid molecule connected to the first nucleic acid molecule has a complementary sequence to the positioning sequence contained in the first nucleic acid molecule as a spatial information marker;

[0188] Alternatively, (iii) when the first nucleic acid molecule and the second nucleic acid molecule are linked to each other, a primer extension reaction is performed under conditions that allow primer extension, using the linked first and second nucleic acid molecules as primers and the captured nucleic acid molecule as a template to produce an extension product, wherein the chain hybridized with the captured nucleic acid molecule has a complementary sequence to the positioning sequence contained in the first nucleic acid molecule as a spatial information marker; and / or,

[0189] Using the captured nucleic acid molecule as a primer and the connected first and second nucleic acid molecules as a template, a primer extension reaction is performed to produce an extended captured nucleic acid molecule, wherein the extended captured nucleic acid molecule has the positioning sequence as a spatial information marker;

[0190] (4) releasing at least a portion of the spatial information labeled nucleic acid molecules from the array surface, wherein the portion includes the positioning sequence or its complementary strand and the captured nucleic acid molecules or its complementary strand; and

[0191] (5) directly or indirectly analyzing the sequence of the nucleic acid molecule released in step (4).

[0192] In such embodiments, prior to step (2) of capturing the target nucleic acid, the first nucleic acid molecule and the second nucleic acid molecule on the nucleic acid array are not linked.

[0193] In a seventh aspect, the present invention provides a method for detecting spatial information of nucleic acids in a sample, comprising the following steps:

[0194] (1) Providing the nucleic acid array described in the first aspect, or obtaining the nucleic acid array by the method described in the third aspect; wherein:

[0195] The nucleic acid array comprises a plurality of vector sequences connected to the surface of a solid support (e.g., a chip), each vector sequence occupies a different position in the array, and each vector sequence comprises a plurality of copies of the vector sequence;

[0196] Each vector sequence comprises a first nucleic acid molecule hybridized thereto, the first nucleic acid molecule being linked to a second nucleic acid molecule;

[0197] The first nucleic acid molecule comprises a complementary sequence to a positioning sequence corresponding to the position of the vector sequence on the array,

[0198] The second nucleic acid molecule comprises a capture sequence capable of capturing nucleic acid in a sample;

[0199] (2) contacting the nucleic acid array with a sample to be tested under conditions that allow annealing, so that the nucleic acid in the sample to be tested anneals with the capture sequence of the second nucleic acid molecule, thereby making the position of the nucleic acid correspond to the position of the carrier sequence on the nucleic acid array;

[0200] (3)(iii) under conditions that allow primer extension, using the linked first and second nucleic acid molecules as primers and the captured nucleic acid molecule as a template, a primer extension reaction is performed to produce an extension product, wherein the chain hybridized with the captured nucleic acid molecule has a sequence complementary to the positioning sequence contained in the first nucleic acid molecule as a spatial information marker; and / or,

[0201] Using the captured nucleic acid molecule as a primer and the connected first and second nucleic acid molecules as a template, a primer extension reaction is performed to produce an extended captured nucleic acid molecule, wherein the extended captured nucleic acid molecule has the positioning sequence as a spatial information marker;

[0202] (4) releasing at least a portion of the spatial information labeled nucleic acid molecules from the array surface, wherein the portion includes the positioning sequence or its complementary strand and the captured nucleic acid molecules or its complementary strand; and

[0203] (5) directly or indirectly analyzing the sequence of the nucleic acid molecule released in step (4).

[0204] In such embodiments, before capturing the target nucleic acid in step (2), the first nucleic acid molecule and the second nucleic acid molecule on the nucleic acid array have been linked.

[0205] In certain embodiments of the method of the sixth or seventh aspect, the multiple copies of the vector sequence are DNBs formed by concatemers of the vector sequence, or the multiple copies of the vector sequence are DNA clusters formed by clonal populations of the vector sequence.

[0206] In certain embodiments of the method of the sixth or seventh aspect, the vector sequence, the first nucleic acid molecule is a single-stranded DNA. In certain embodiments, the second nucleic acid molecule is a single-stranded DNA or a single-stranded RNA.

[0207] In an eighth aspect, the present invention provides a method for detecting spatial information of nucleic acids in a sample, comprising the following steps:

[0208] (1) Providing the nucleic acid array described in the fifth aspect, or obtaining the nucleic acid array by the method described in the second aspect; wherein the nucleic acid array comprises a plurality of vector sequences connected to the surface of a solid support (e.g., a chip), each vector sequence occupies a different position in the array, and each vector sequence comprises a plurality of copies of the vector sequence;

[0209] Each carrier sequence comprises a first nucleic acid molecule hybridized thereto, wherein the first nucleic acid molecule comprises a complementary sequence to a positioning sequence corresponding to the position of the carrier sequence on the array and a capture sequence capable of capturing nucleic acid in a sample;

[0210] (2) contacting the nucleic acid array with a sample to be tested under conditions that allow annealing, so that the nucleic acid in the sample to be tested anneals with the capture sequence of the first nucleic acid molecule, thereby making the position of the nucleic acid correspond to the position of the first nucleic acid molecule on the nucleic acid array;

[0211] (3) Under conditions that allow primer extension, using the first nucleic acid molecule as a primer and the captured nucleic acid molecule as a template, a primer extension reaction is performed to produce an extension product, wherein the chain hybridized with the captured nucleic acid molecule has a complementary sequence to the positioning sequence contained in the first nucleic acid molecule as a spatial information marker;

[0212] (4) releasing at least a portion of the spatial information labeled nucleic acid molecules from the array surface, wherein the portion includes the positioning sequence or its complementary strand and the captured nucleic acid molecules or its complementary strand; and

[0213] (5) directly or indirectly analyzing the sequence of the nucleic acid molecule released in step (4).

[0214] In certain embodiments, before step (2), the method further comprises cutting the cleavage site contained in the first fixed sequence of the carrier sequence to digest the carrier sequence, and at the same time connecting the first nucleic acid molecule (capture probe) to the surface of a solid support (e.g., a chip). In such embodiments, the nucleic acid array comprises a plurality of capture probes connected to the surface of a solid support (e.g., a chip), each capture probe occupies a different position in the array, and the capture probe comprises a complementary sequence to a positioning sequence corresponding to the position of the capture probe on the array and a capture sequence capable of capturing nucleic acids in a sample;

[0215] (2) contacting the nucleic acid array with a sample to be tested under conditions that allow annealing, so that the nucleic acid in the sample to be tested anneals with the capture sequence of the capture probe, thereby making the position of the nucleic acid correspond to the position of the capture probe on the nucleic acid array;

[0216] (3) Under conditions that allow primer extension, using the capture probe as a primer and the captured nucleic acid molecule as a template, a primer extension reaction is performed, wherein the generated extension product contains a complementary sequence of the positioning sequence as a spatial information marker and a complementary sequence of the captured nucleic acid molecule, thereby generating a DNA molecule marked with spatial information; optionally, generating a complementary chain of the DNA molecule marked with spatial information, and / or optionally, amplifying the DNA molecule marked with spatial information;

[0217] (4) releasing at least a portion of the spatial information labeled DNA molecules and / or their complementary strands or amplicons from the array surface, wherein the portion includes the spatial information label sequence or its complementary strand; and

[0218] (5) directly or indirectly analyzing the sequence of the nucleic acid molecule released in step (4).

[0219] In certain embodiments of the method of the eighth aspect, the first nucleic acid molecule and the capture probe are DNA molecules, such as single-stranded DNA.

[0220] In certain embodiments of the method of any one of aspects 6 to 8, the spatial information of the nucleic acid includes the location, distribution and / or expression of the nucleic acid.

[0221] In certain embodiments of the method of any one of the sixth to eighth aspects, the sample is a tissue sample, such as a tissue section. In certain embodiments, the tissue section is prepared from fixed tissue, such as, for example, with formalin-fixed paraffin-embedded (FFPE) tissue or deep-frozen tissue.

[0222] In certain embodiments of the method of any one of aspects 6 to 8, the method is for non-diagnostic use.

[0223] In certain embodiments of the methods described in any one of the sixth to eighth aspects, any nucleic acid analysis method can be used in step (5). In certain embodiments, this step can include sequencing. In certain embodiments, a sequence-specific analysis method can be used. For example, a sequence-specific amplification reaction can be implemented, such as by using primers, and the primers are specific to the localization domain and / or a specific target sequence (e.g., a specific target DNA to be tested). Therefore, in certain embodiments, this step can include a sequence-specific PCR reaction.

[0224] In certain embodiments of the method described in any one of the sixth to eighth aspects, the sequence analysis information obtained in step (5) can be used to obtain spatial information (i.e., position information) of nucleic acids in the sample. In certain embodiments, the spatial information can be inferred from the properties of the measured sequence analysis information, for example, it can reveal the presence of a specific nucleic acid, which may have spatial information significance in the environment of the measured sample, and / or the spatial information (e.g., spatial positioning) can be inferred by combining the position of the sample on the array and the sequencing information. Therefore, the method can only include the step of associating the sequence analysis information with a certain position of the sample, for example, using a positioning marker and its association with a certain position on the sample. In certain embodiments, spatial information can be conveniently obtained by associating sequence analysis data with a sample image. Therefore, in such embodiments, the method described in any one of the sixth to eighth aspects further includes step (6): associating the sequence analysis information obtained in step (5) with an image of the sample, wherein the sample is imaged before or after step (3). In certain embodiments, the imaging of the sample is performed using light, bright field, dark field, phase contrast, fluorescence, mirror image, interference or confocal microscopy or a combination thereof.

[0225] In certain embodiments of the method of the sixth aspect, the method is used to detect the transcriptome in a sample. In such embodiments, in step (3) (i), the first and second nucleic acid molecules connected are used as reverse transcription primers to synthesize cDNA molecules from the captured RNA molecules, wherein the cDNA molecules have a complementary sequence to the positioning sequence contained in the first nucleic acid molecule as a spatial information marker, and optionally, the cDNA molecules are amplified; or, in step (3) (ii), the second nucleic acid molecule is used as a reverse transcription primer to synthesize cDNA molecules from the captured RNA molecules, and the first nucleic acid molecule hybridized on each carrier sequence and the cDNA molecule are connected (for example, using a ligase) to produce a cDNA molecule having a complementary sequence to the positioning sequence contained in the first nucleic acid molecule as a spatial information marker, and optionally, the cDNA molecules are amplified; and, in step (4), at least a portion of the cDNA molecules and / or their amplicons are released from the array surface, wherein the released nucleic acid molecules can be the first and / or second chains of the cDNA molecules or their amplicons, and wherein the portion contains a spatial information sequence or its complementary chain. In certain embodiments, in step (1), the capture sequence comprises an oligonucleotide sequence capable of capturing mRNA.

[0226] In certain embodiments of the method of the seventh aspect, the method is used to detect the transcriptome in a sample. In such embodiments, in step (3)(iii), the first and second nucleic acid molecules connected are used as reverse transcription primers to synthesize cDNA molecules from the captured RNA molecules, wherein the cDNA molecules have a complementary sequence to the positioning sequence contained in the first nucleic acid molecule as a spatial information marker, and optionally, the cDNA molecules are amplified; and, in step (4), at least a portion of the cDNA molecules and / or their amplicons are released from the array surface, wherein the released nucleic acid molecules can be the first and / or second chains of the cDNA molecules or their amplicons, and wherein the portion contains the spatial information sequence or its complementary chain. In certain embodiments, in step (1), the capture sequence comprises an oligonucleotide sequence capable of capturing mRNA.

[0227] In certain embodiments of the method described in the eighth aspect, the method is used to detect the transcriptome in a sample. In such embodiments, in step (3), the capture probe is used as an RT primer to synthesize a cDNA molecule from the captured RNA molecule, the cDNA molecule having a spatial information marker, and optionally, the cDNA molecule is amplified; in such embodiments, in step (3), the first nucleic acid molecule is used as an RT primer to synthesize a cDNA molecule from the captured RNA molecule, the cDNA molecule having a complementary sequence to the positioning sequence contained in the first nucleic acid molecule as a spatial information marker, and optionally, the cDNA molecule is amplified. In step (4), at least a portion of the cDNA molecule and / or its amplicon is released from the array surface, wherein the released nucleic acid molecule can be the first and / or second chain of the cDNA molecule or its amplicon, and wherein the portion comprises a spatial information marker sequence or its complementary chain. In certain embodiments, in step (1), the capture sequence comprises an oligonucleotide sequence capable of capturing mRNA.

[0228] In certain embodiments of the method of any one of aspects 6 to 8, the complementary strand or the cDNA second strand is generated before or after the spatial information labeled nucleic acid molecule (eg, DNA molecule) or the spatial information labeled cDNA molecule is released from the array surface.

[0229] The synthesis step of the second strand DNA (e.g., cDNA) can be performed in situ on the array, either as a separate second strand synthesis step or as an initial step in an amplification reaction. Alternatively, the first strand of DNA (e.g., cDNA) (i.e., the strand generated using the captured nucleic acid molecule as a template) can be released from the array and then the second strand synthesis can be performed, for example, in solution, either as a separate step or as a step in an amplification reaction.

[0230] When the second strand synthesis is performed on the array (i.e., in situ), the method may include an optional step of removing the captured nucleic acid molecules (e.g., RNA) before the second strand synthesis, for example, using RNA nitrase (RNase), such as RNase H. The operation process of this step is well known and documented in the art. However, this step is generally unnecessary, and in most cases, RNA will naturally degrade. The step of removing the sample from the array generally also removes the RNA on the array.

[0231] In certain embodiments, the second strand of DNA (e.g., cDNA) is generated in a single reaction, and the second strand synthesis can be achieved by any suitable method known in the art. For example, the first strand of cDNA released from the array is then subjected to a DNA synthesis reaction using a random primer (e.g., a hexamer primer) and a DNA polymerase (e.g., a strand displacement polymerase) as a template. Therefore, in certain embodiments, the synthesis of the complementary strand or the second strand uses a random primer and a strand displacement polymerase.

[0232] In certain embodiments of the method described in any one of the sixth to eighth aspects, the step of amplifying the nucleic acid molecule (e.g., DNA molecule) or cDNA molecule labeled with the spatial information is further included before sequence analysis. In certain embodiments, the amplification step is implemented after the nucleic acid molecule (e.g., DNA molecule) or cDNA molecule labeled with the spatial information is released from the array, or the amplification step is implemented in situ on the array (i.e., when the first nucleic acid molecule and / or carrier sequence and / or capture probe is still connected to the surface of the solid support). In certain embodiments, the amplification step includes PCR.

[0233] In certain embodiments of the method of any one of aspects 6 to 8, in step (4), the molecules are released from the array surface by: (i) nucleic acid shearing; (ii) denaturation; and / or (iii) physical methods. In certain embodiments, the molecules are released by applying hot water or a buffer to the solid support.

[0234] In certain embodiments, the method further comprises a step of purifying the released molecules prior to sequencing.

[0235] In certain embodiments, after contacting the sample with the array and before step (3), a step of replenishing water to the sample is further included.

[0236] In certain embodiments, prior to step (4), the method further comprises a step of washing the array to remove residual sample (eg, tissue).

[0237] In certain embodiments, the array comprises at least one orientation mark to orient the samples on the array.

[0238] In certain embodiments, in step (5), the sequence analysis step comprises a sequencing step. In certain embodiments, the sequencing step comprises a sequencing reaction based on a reversible dye terminator.

[0239] The method for detecting nucleic acid spatial information described in any one of the sixth to eighth aspects of the present invention can be used for RNA detection and transcriptome analysis, DNA detection and genome analysis, etc. Spatial information is of great significance to transcriptomics and genomics related research, especially in the study of transcriptome or genome variation in different cells or regions of tissues, such as comparing normal and pathological cells or tissues, or studying transcriptome or genome changes in disease progression, etc.

[0240] For example, pathophysiological analysis of Alzheimer's disease shows that its pathological process involves the interaction between neurons and glial cells, and related transcriptome and epigenomic studies have also found that neuronal function in the brains of Alzheimer's patients is severely impaired and the innate immune response is abnormal. However, population-level studies are unable to reveal the complexity of changes between cells and within cell populations, especially for those rare cell types. Ordinary single-cell-level studies are also unable to distinguish between specific cell type characteristics in different tissue regions at the same time and changes in cellular components during neurodegenerative diseases. Therefore, in order to further reveal the pathogenic mechanism and development pattern of the disease, it is urgently necessary to obtain single-cell transcriptome information with a spatial dimension.

[0241] The method for detecting nucleic acid spatial information described in any one of the sixth to eighth aspects of the present invention can fix nucleic acid molecules in different regions of a brain tissue sample to a chip through a capture sequence with a position marker connected to the chip, and perform sequencing, thereby obtaining transcriptome results containing accurate position information, so as to detect changes in specific cell types in different regions during Alzheimer's disease. In particular, since the active area of ​​DNB or DNA clusters on the chip of the present invention is as low as nanometers, and the cell diameter is about 12um, the chip of the present invention can achieve spatial localization information with subcellular resolution.

[0242] The present invention also includes the following exemplary embodiments:

[0243] Item 1. A method for producing a nucleic acid array for detecting spatial information of biomolecules (e.g., nucleic acids) in a sample, the method comprising the following steps:

[0244] (1) providing a circular nucleic acid template, wherein the circular nucleic acid template comprises a template sequence of a capture probe, wherein the template sequence comprises a linker region, a spatial label region and a capture region in the 5' to 3' direction; wherein:

[0245] The linker region comprises a cleavage site, and the cleavage can be selected from nicking enzyme cleavage, USER cleavage, photoexcision, chemical excision or CRISPR excision;

[0246] The spatial tag region comprises a spatial tag sequence, and the spatial tag sequence corresponds to the position of the capture probe on the array;

[0247] The capture zone comprises a capture sequence capable of capturing biological molecules (e.g., nucleic acids) in a sample; wherein the capture sequence comprises: (1a) an oligonucleotide sequence capable of capturing mRNA; and / or, (1b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a specific target molecule (e.g., a target nucleic acid);

[0248] (2) performing rolling circle amplification (RCA) using the circular nucleic acid template as a template to obtain a nanoball (DNB) formed by a concatemer of a complementary sequence of the template sequence (i.e., a template complementary sequence);

[0249] (3) connecting the DNB to the surface of a solid phase carrier (e.g., a chip);

[0250] (4) Providing a probe primer, and using the template complementary sequence contained in the DNB as a template, performing a primer extension reaction to generate an extension product, wherein the chain hybridized with the template complementary sequence is the capture probe; optionally, amplifying the extension product; the probe primer comprises a binding region, a resection region and a primer linker region in the 5' to 3' direction; wherein,

[0251] The binding region comprises a linker capable of connecting to the surface of the solid support;

[0252] The excision region comprises a cleavage site;

[0253] The primer adapter region is complementary to all or part of the adapter region sequence of the template complementary sequence contained in the DNB (that is, the complementary sequence of the template sequence adapter region), and has a 3' free end so that the probe primer can be used as a primer to initiate an extension reaction; preferably, the primer adapter region comprises the sequence of the adapter region of the template sequence or a fragment thereof;

[0254] (5) connecting the probe primer to the surface of the solid phase carrier; wherein steps (4) and (5) are performed in any order;

[0255] (6) cutting the cleavage site contained in the linker region to digest the DNB, so that the extension product in step (4) is separated from the template DNB that forms the extension product, thereby connecting the capture probe to the surface of the solid phase carrier (e.g., chip);

[0256] Preferably, the circular nucleic acid template, DNB and capture probe are DNA;

[0257] Preferably, in step (1), a plurality of circular nucleic acid templates are provided, each of which contains a template sequence of a different capture probe, thereby obtaining a solid phase carrier (eg, a chip) having a plurality of capture probes attached to its surface.

[0258] Item 2. The method of Item 1, wherein the cleavage site contained in the linker region is a nicking enzyme cleavage site;

[0259] Preferably, the nicking enzyme is selected from USER, BamHI, BmtI.

[0260] Item 3. The method of Item 1 or 2, wherein the linker region further comprises a sequencing primer hybridization region and / or an amplification primer hybridization region; wherein the sequencing primer hybridization region allows the sequencing primer to anneal and initiate a sequencing reaction, and the amplification primer hybridization region allows the amplification primer to anneal and initiate an extension and amplification reaction.

[0261] Item 4. The method of any one of Items 1 to 3, wherein the oligonucleotide sequence capable of capturing mRNA comprises a sequence capable of hybridizing with the poly-A tail of mRNA;

[0262] Preferably, the oligonucleotide sequence capable of capturing mRNA comprises a poly-T oligonucleotide sequence;

[0263] Preferably, the poly-T oligonucleotide sequence comprises at least 10 (eg at least 20) deoxythymidine residues.

[0264] Item 5. The method of any one of Items 1 to 4, wherein the template sequence further comprises a probe tag region located upstream of the capture region and downstream of the linker region, the probe tag region comprising a probe tag complementary sequence composed of modified bases, and the modified bases are capable of forming hydrogen bond complementary pairs with a variety of primary bases (e.g., C, G, A, T, U);

[0265] Preferably, the probe label region is located between the spatial label region and the capture region, or between the linker region and the spatial label region;

[0266] Preferably, the probe tag complementary sequence comprises a plurality of (eg, at least 10) inosines.

[0267] Item 6. The method of any one of Items 1 to 5, which has one or more of the following features:

[0268] (i) the length of the linker region is greater than 1 bp, such as greater than 10 bp, or greater than 20 bp; preferably, the length of the linker region is 20-100 bp;

[0269] (ii) the length of the spatial tag region is greater than 1 bp, for example greater than 10 bp; preferably, the length of the spatial tag region is 10-100 bp;

[0270] (iii) the capture region is greater than 1 bp in length; preferably, the capture region is 1-100 bp in length;

[0271] (iv) The length of the probe tag region is greater than 1 bp, such as greater than 5 bp; preferably, the length of the probe tag region is 5-100 bp.

[0272] Item 7. The method of any one of Items 1 to 6, wherein the solid phase carrier is a chip;

[0273] Preferably, the solid phase carrier can be used as a sequencing platform, such as a sequencing chip.

[0274] Item 8. The method of any one of Items 1-7, wherein, in step (4), while performing the primer extension reaction, the complementary sequence of the spatial tag sequence is sequenced to obtain the sequence information of the spatial tag sequence contained in the corresponding capture probe.

[0275] Item 9. The method of any one of Items 1 to 7, wherein, before step (4), the method further comprises the step of sequencing the complementary sequence of the spatial tag sequence contained in the DNB;

[0276] Preferably, after sequencing is completed, washing is performed to remove dNTPs added to the synthesized chain due to sequencing.

[0277] Item 10. The method of any one of Items 1 to 9, wherein the linker is a linker group capable of coupling with an activating group (e.g., NH2), and the surface of the solid phase carrier is modified with an activating group (e.g., NH2);

[0278] Preferably, the linker comprises -SH, -DBCO or -NHS;

[0279]

[0280] Item 11. The method of any one of Items 1 to 10, wherein the cleavage site contained in the excision region is a site that can be controlled by chemical, enzymatic or photochemical methods;

[0281] Preferably, the cleavage site is an enzyme cleavage site;

[0282] Preferably, the excision region and the linker region comprise different cleavage sites.

[0283] Item 12. The method of any one of Items 1-11, wherein the amplification includes PCR.

[0284] Item 13. A nucleic acid array prepared by the method of any one of Items 1-12.

[0285] Item 14. A nucleic acid array for detecting spatial information of biological molecules (such as nucleic acids) in a sample, comprising a solid phase carrier (such as a chip) with a plurality of capture probes connected to the surface, each capture probe occupies a different position in the array and is oriented to have a 3' free end so that the capture probe can serve as an extension primer, wherein each capture probe comprises, from the 5' to the 3' direction: a binding region, an excision region, a spatial label sequence and a capture sequence, wherein,

[0286] The binding region comprises a linker capable of connecting to the surface of the solid support;

[0287] The excision region comprises a cleavage site;

[0288] The spatial tag sequence corresponds to the position of the capture probe on the array;

[0289] The capture sequence is capable of hybridizing with all or part of the biological molecule to be captured (e.g., nucleic acid), and includes: (1a) an oligonucleotide sequence capable of capturing mRNA; and / or, (1b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a specific target molecule (e.g., target nucleic acid).

[0290] Item 15. The nucleic acid array of Item 14, wherein each capture probe in each capture probe (i.e., capture probes comprising the same spatial label sequence) has a probe label sequence that is different from each other, and the probe label sequence is located upstream of the capture sequence and downstream of the cleavage region;

[0291] Preferably, the probe tag sequence is located between the capture sequence and the spatial tag sequence, or between the cleavage region and the spatial tag sequence.

[0292] Item 16. The nucleic acid array of Item 14 or 15, wherein the diameter of the area occupied by each capture probe (i.e., capture probes comprising the same spatial tag sequence) on the surface of the solid phase carrier (i.e., active area) is less than 1 micron;

[0293] Preferably, the active area of ​​each capture probe has a diameter of about 500 nanometers.

[0294] Item 17. The nucleic acid array of any one of Items 14 to 16, wherein the solid phase carrier is a chip;

[0295] Preferably, the solid phase carrier can be used as a sequencing platform, such as a sequencing chip.

[0296] Item 18. The nucleic acid array of any one of Items 14 to 17, wherein the nucleic acid array is prepared by the method of any one of Items 1 to 12.

[0297] Item 19. A method for detecting spatial information of biomolecules in a sample, comprising the following steps:

[0298] (1) Providing a nucleic acid array according to any one of items 13 to 18, or obtaining a nucleic acid array by the method according to any one of items 1 to 12; the nucleic acid array comprises a plurality of capture probes connected to the surface of a solid phase carrier (e.g., a chip), each capture probe occupies a different position in the array, and the capture probe comprises a spatial label sequence corresponding to the position of the capture probe on the array and a capture sequence capable of capturing biological molecules in a sample;

[0299] (2) contacting the nucleic acid array with a sample to be tested so that the capture sequence of the capture probe binds to the biomolecule in the sample to be tested, so that the position of the biomolecule is mapped to the position of the capture probe on the nucleic acid array, and a biomolecule labeled with a spatial tag is generated;

[0300] (3) releasing the spatially labeled biomolecules from the array surface; and

[0301] (4) directly or indirectly analyzing the sequence of the biomolecule released in step (3).

[0302] Item 20. A method for detecting spatial information of nucleic acid in a sample, comprising the following steps:

[0303] (1) Providing a nucleic acid array as described in any one of items 13 to 18, or obtaining a nucleic acid array by the method of any one of items 1 to 12; the nucleic acid array comprises a plurality of capture probes connected to the surface of a solid phase carrier (e.g., a chip), each capture probe occupies a different position in the array, and the capture probe comprises a spatial label sequence corresponding to the position of the capture probe on the array and a capture sequence capable of capturing nucleic acids in a sample;

[0304] (2) contacting the nucleic acid array with a sample to be tested under conditions that allow annealing, so that the nucleic acid in the sample to be tested anneals with the capture sequence of the capture probe, thereby making the position of the nucleic acid correspond to the position of the capture probe on the nucleic acid array;

[0305] (3) Under conditions that allow primer extension, using the capture probe as a primer and the captured nucleic acid molecule as a template, a primer extension reaction is performed, and the generated extension product contains the spatial tag sequence and the complementary sequence of the captured nucleic acid molecule, thereby generating a DNA molecule labeled with the spatial tag; optionally, generating a complementary chain of the DNA molecule labeled with the spatial tag, and / or optionally, amplifying the DNA molecule labeled with the spatial tag;

[0306] (4) releasing at least a portion of the spatially tagged DNA molecules and / or their complementary strands or amplicons from the array surface, wherein the portion includes the spatial tag sequence or its complementary strand; and

[0307] (5) directly or indirectly analyzing the sequence of the nucleic acid molecule released in step (4);

[0308] Preferably, the spatial information of the nucleic acid includes the location, distribution and / or expression of the nucleic acid;

[0309] Preferably, the capture probe is a DNA molecule;

[0310] Preferably, the sample is a tissue sample, such as a tissue section;

[0311] Preferably, the tissue sections are prepared from fixed tissue, for example, formalin-fixed paraffin-embedded (FFPE) tissue or deep-frozen tissue.

[0312] Item 21. The method of Item 20, wherein in step (5), the sequence analysis includes sequencing or sequence-specific PCR reaction.

[0313] Item 22. The method of Item 20 or 21, further comprising step (6): associating the sequence analysis information obtained in step (5) with the image of the sample, wherein the sample is imaged before or after step (3).

[0314] Item 23. The method of any one of Items 20-22, which is used to detect a transcriptome in a sample, wherein:

[0315] In step (3), the capture probe is used as an RT primer to synthesize a cDNA molecule from the captured RNA molecule, wherein the cDNA molecule is labeled with a spatial tag, and optionally, the cDNA molecule is amplified;

[0316] In step (4), at least a portion of the cDNA molecules and / or their amplicons are released from the array surface, wherein the released nucleic acid molecules may be the first and / or second strands of the cDNA molecules or their amplicons, and wherein the portion comprises a spatial tag sequence or its complementary strand;

[0317] Preferably, in step (1), the capture sequence comprises an oligonucleotide sequence capable of capturing mRNA.

[0318] Item 24. The method of any one of Items 20 to 23, wherein the complementary strand or the cDNA second strand is generated before or after the spatially labeled DNA molecule or the spatially labeled cDNA molecule is released from the array surface;

[0319] Preferably, the synthesis of the complementary or second strand uses random primers and a strand-displacing polymerase.

[0320] Item 25. The method of any one of Items 20-24, further comprising a step of amplifying the DNA molecule or cDNA molecule labeled with the spatial tag before sequence analysis;

[0321] Preferably, the amplification step is performed after the spatially labeled DNA or cDNA molecules are released from the array, or the amplification step is performed in situ on the array;

[0322] Preferably, the amplification step comprises PCR.

[0323] Item 26. The method of any one of Items 20-25, further comprising a step of purifying the released molecules (eg, nucleic acid molecules) prior to sequence analysis.

[0324] Item 27. The method of any one of Items 20-26, further comprising a step of washing the array to remove residual sample (eg, tissue) before step (4).

[0325] Item 28. The method of any one of Items 20-27, wherein in step (4), the molecule is released from the array surface by: (i) nucleic acid shearing; (ii) denaturation; and / or (iii) physical method;

[0326] Preferably, the molecule is released from the excision zone of the capture probe by enzymatic cleavage.

[0327] Item 29. The method of any one of Items 20-28, wherein in step (6), the imaging of the sample is performed using light, bright field, dark field, phase contrast, fluorescence, mirror image, interference or confocal microscopy or a combination thereof.

[0328] Beneficial Effects

[0329] The present invention provides a new array for detecting nucleic acid spatial information and a preparation method thereof. When the nucleic acid array is applied to nucleic acid spatial information detection, high-precision subcellular localization and high-throughput tissue localization can be achieved simultaneously. The array of the present invention and the detection method based on the array have great application value in cell localization, subcellular localization, organelle localization, cell interaction, organelle interaction, molecular pathway research, disease diagnosis and other aspects. BRIEF DESCRIPTION OF THE DRAWINGS

[0330] Figure 1 The schematic diagram of the structure of capturing mRNA and then synthesizing cDNA in Example 2 is shown.

[0331] Figure 2 A schematic diagram of the structure of the molecules released from the chip in Example 2 is shown.

[0332] Figure 3 The results of 2100 detection of cDNA fragment distribution in Example 2 are shown.

[0333] Figure 4 The figure shows the matching result between the first strand 25 bp sequence obtained by cDNA sequencing in Example 3 and the fq of the positioning sequence on the capture chip.

[0334] Figure 5 The graph shows the expression of mRNA in tissue sections in Example 3.

[0335] Figure 6 A schematic diagram of the structure of the vector sequence included in the probe primer and DNB according to an exemplary embodiment of Example 4 is shown.

[0336] Figure 7 A schematic diagram of the probe structure connected to the chip in Example 4 is shown.

[0337] Figure 8 A schematic diagram of the structure after cDNA synthesis of the captured nucleic acid molecule in Example 5 is shown.

[0338] Fig. 9 A schematic diagram showing the structure of the molecules released from the chip in Example 5 is shown.

[0339] Fig.10 The results of 2100 detection of cDNA fragment distribution in Example 5 are shown.

[0340] Fig.11 The figure shows the matching result between the 20 bp sequence of one strand obtained by cDNA sequencing in Example 6 and the fq of the positioning sequence on the capture chip.

[0341] Fig.12 The graph shows the expression of mRNA in tissue sections in Example 6. DETAILED DESCRIPTION

[0342] The invention will now be described with reference to the following examples which are intended to illustrate the invention rather than to limit the invention.

[0343] Unless otherwise specified, the experiments and methods described in the embodiments are basically carried out according to conventional methods well known in the art and described in various references. In addition, if specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer is not specified in the reagents or instruments used, they are all conventional products that can be obtained commercially. It is known to those skilled in the art that the embodiments describe the present invention by way of example and are not intended to limit the scope of the invention. All public cases and other references mentioned herein are incorporated herein by reference in their entirety.

[0344] Example 1. Preparation of capture chip-1

[0345] 1. Design and synthesize the following DNA library sequences. Entrust BGI Liuhe to perform sequence synthesis.

[0346] 5' phosphorylated-AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA (Linker A, SEQ ID NO: 1) NNNNNNNNNNNNNNNNNNNNNNNNNN (Positioning sequence complementary sequence, N represents any base, such as C, G, A or T) CTGATAAGGTCGCCA (Second fixed sequence complementary sequence, SEQ ID NO: 2) CAACTCCTTGGCTCACAGAACGACATGGCTACGATCCGACTT (Linker B, SEQ ID NO: 3) -3'. Wherein, Linker A comprises a partial sequence of the first fixed sequence complementary sequence and a cyclization site, and Linker B comprises another portion of the first fixed sequence complementary sequence, an enzyme cleavage site, and a cyclization site.

[0347] 2. Library in situ amplification

[0348] Preparation of DNA nanoballs (DNBs): 40ul of the following reaction system was prepared, and 80fmol of the above DNA library was added. The DNB primer sequence was GGCCTCCGACTTAAGTCGGATCGT (SEQ ID NO: 4), which was synthesized by BGI Liuhe.

[0349] Element Volume(ul) Final concentration DNA library sequences 80fmol(X) 10×phi29buffer (BGI self-produced) 4 1X DNB primer sequence 10uM 4 1uM Molecular water 32-x

[0350] The above reaction volume was placed in a PCR instrument for reaction under the following conditions: 95°C for 3 min, 40°C for 3 min; after the reaction, it was placed on ice, 40ul of the mixed enzyme I required for DNB preparation in the DNBSEQ sequencing kit, 2ul of the mixed enzyme II, and 1ul of ATP (mother solution 100mM, Thermo Fisher), 0.1ul of T4 ligase (BGI self-produced) were added, and after mixing, the above reaction system was placed in a PCR instrument at 30°C for reaction for 20 min to form DNB. The DNB was loaded onto the BGISEQ500 sequencing chip according to the method described in the BGISEQ500 SE50 kit.

[0351] 3. Sequencing and decoding of positioning sequences: According to the instructions of BGISEQ500 SE50 sequencing kit, decode and sequence the positioning sequences, and set the sequencing length to 25bp. The fq file generated by sequencing is stored for later use.

[0352] 4. Capture sequence fixation: Entrust BGI Liuhe to synthesize the following DNA sequence: 5'phosphorylated-CTGATAAGGTCGCCA (second fixed sequence complementary sequence, SEQ ID NO: 5) NNNNNNNNNN (UMI) TTTTTTTTTTTTTTTTTTTTTVN (capture sequence, SEQ ID NO: 6) -3', where N represents any base (e.g., C, G, A or T). Remove the sequencing chip from the sequencer, pump the excision reagent of well 7 in the BGISEQ500 SE50 kit into the chip (make sure the reagent covers the entire chip and no bubbles are generated), place the chip at 60°C, and react for 10 minutes. After the reaction, pump an appropriate amount of 5×SSC (purchased from Shanghai Bioengineering) into the sequencing chip to fully replace the previous reagent in the chip. Dilute the capture sequence to 1uM with 5×SSC, add an appropriate amount of the diluted capture sequence to the chip, and fill the chip with the capture sequence. Place the chip at room temperature for about 30 minutes to allow the capture sequence to fully hybridize to the DNB.

[0353] 5. Chip dicing: Cut the prepared chip into several small pieces. The size of the slices can be adjusted according to the experimental needs. Soak the chip in 50mM tris buffer (pH 8.0) and store at 4°C for use.

[0354] Example 2. Tissue mRNA capture and cDNA synthesis

[0355] 1. Frozen tissue sections. Prepare mouse cerebellum tissue sections according to the standard frozen section procedure.

[0356] 2. mRNA capture. According to the size of the sliced ​​tissue, take a chip prepared in Example 1 of appropriate size and place it at room temperature. After the liquid on the chip evaporates, use the temperature difference between the sliced ​​tissue and the chip in the slicer to stick the sliced ​​tissue on the capture chip. Place the stuck tissue slices at room temperature, add 5×SSC reaction solution to the chip (fully cover the area with the tissue stuck), react at 30°C for 30 minutes, and allow the mRNA in the tissue to fully hybridize with the capture area on the chip.

[0357] 3. cDNA synthesis. Wash the chip twice with 5×SSC at room temperature, prepare 200ul of the following reverse transcriptase reaction system, add the reaction solution to the chip, fully cover it, and react at 42°C for 90min-180min. The mRNA will be synthesized into cDNA using polyT as a primer. The 3 ends of the mRNA are labeled with TSO (AAGTCGGAGGCCAAGCGGTC / rG / / rG / / iXNA_G / ) (SEQ ID NO: 7) for the synthesis of cDNA complementary chains. The structural diagram of the above process is shown in the figure. Figure 1 shown.

[0358]

[0359] 4. Connect the spatial positioning area to the capture area. After cDNA synthesis, wash the chip twice with 5×SSC, prepare 1 ml of the following reaction system, pump an appropriate volume into the chip to ensure that the chip is filled with the following connection reaction solution, and Figure 1 Fill the nick shown in . Reaction was carried out at room temperature for 30 min. After the reaction, the chip was washed with 5×SSC at 55°C for 3 times, each time for 5 min.

[0360] Element Volume(ul) concentration 10× T4 ligase buffer (BGI self-produced) 100 1× T4 ligase (600U / ul, produced by BGI) 100 60u / ul Glycerin (Aladdin) 10 10％ Molecular water 790

[0361] 5. cDNA release. After the cDNA strand is synthesized on the chip, add an appropriate amount of formamide solution to the chip and react at 55°C for 10 minutes to release the cDNA strand from the chip. The released molecules have the following characteristics: Figure 2 The structure shown. The reaction solution released from the chip was collected, and the cDNA strand was purified using 2×XP magnetic beads, and finally the product was recovered using 45ul TE buffer (Thermofisher). The cDNA strand was quantitatively detected using the Qubit ssDNA detection kit.

[0362] 6. cDNA amplification. Prepare 100ul of the following reaction system:

[0363]

[0364] The above reaction system was placed in a PCR instrument and the following reaction program was set: 95°C for 3 min, 11 cycles (98°C for 20 s, 58°C for 20 s, 72°C for 3 min), 72°C for 5 min, and 4°C for ∞. After the reaction, XP beads were used for magnetic bead purification and recovery. The qubit kit was used to quantify the dsDNA concentration, and the 2100 was used to detect the distribution of cDNA fragments. The 2100 detection results are shown in Figure 2. Figure 3 As shown, the cDNA length was normal.

[0365] Example 3. cDNA library construction and sequencing

[0366] 1. Tn5 shearing. According to the cDNA concentration, take 20ng cDNA, add 0.5uM Tn5 shearing enzyme and corresponding buffer (Tn5 shearing enzyme coating method is in accordance with the stLFR library construction kit), mix to make a 20ul reaction system, react at 55℃ for 10min, add 5ul 0.1% SDS and mix at room temperature for 5min to end the Tn5 shearing step.

[0367] 2. PCR amplification. Prepare 100ul of the following reaction system:

[0368]

[0369] After mixing, place in PCR instrument and set the following program: 95℃3min, 11 cycles (98℃20s, 58℃20s, 72℃3min), 72℃5min, 4℃∞. After the reaction, XP beads were used for magnetic bead purification and recovery. The qubit kit was used to quantify the dsDNA concentration.

[0370] 3. Sequencing. Take 80 fmol of the amplified product after the above shearing and prepare DNB. Configure the following 40ul reaction system:

[0371]

[0372] The above reaction volume was placed in a PCR instrument for reaction under the following reaction conditions: 95°C for 3min, 40°C for 3min; after the reaction, it was placed on ice, and 40ul of the mixed enzyme I required for DNB preparation in the DNBSEQ sequencing kit, 2ul of the mixed enzyme II, and 1ul of ATP (mother solution 100mM, Thermo Fisher), 0.1ul of T4 ligase (BGI self-produced) were added, and after mixing, the above reaction system was placed in a PCR instrument at 30°C for reaction for 20min to form DNB. The DNB was loaded onto the sequencing chip of MGISEQ2000 according to the method described in the PE50 kit on MGISEQ2000, and sequenced according to the relevant instructions, and the PE50 sequencing model was selected, in which the sequencing of one chain was divided into two sections, 25bp was sequenced, and then a 15cycle dark reaction was performed, and then a 10bp UMI sequence was measured, and the second chain was set to 50bp.

[0373] Data analysis

[0374] 1. The 25 bp sequence obtained by sequencing the cDNA strand is matched with the fq sequence located on the capture chip (the sequencing result obtained in step 3 of Example 1). The matching result is as follows: Figure 4 As shown, the bright area is the area where the 25bp sequenced by cDNA completely matches the capture chip, and this area represents the area on the capture chip used for tissue capture, indicating that the capture chip can use the spatial positioning area to accurately locate the tissue capture area.

[0375] 2. Further analyze the DNBs that match the cDNA sequencing to the capture chip, and compare the second-strand sequencing results of these DNB reads (mRNA expression in the reaction tissue) with the mouse genome. The DNBs that match the mouse genome are matched to the capture chip through the 25bp sequencing results, such as Figure 5 As shown in the figure, the left side shows the overall expression of mRNA in the analyzed tissue sections, which shows that this capture chip can analyze the expression difference of mRNA in tissues. The right side of this figure shows the expression level of a gene expressed in the mouse cerebellum randomly selected in the tissue, indicating that this chip can analyze the expression difference of a gene in the tissue sample in the whole tissue.

[0376] Example 4. Preparation of capture chip-2

[0377] 1. Design and synthesize the following DNA library sequences. Entrust BGI Liuhe to perform sequence synthesis.

[0378] 5' phosphorylation-GAACGACATGGCTTTTTCCCGTAGCCATGTCGTTCTGCGCCTTC CCGATG (fixed sequence 1, SEQ ID NO: 12) NNNNNNNNNNNNNNNNNNNNNN (positioning sequence template sequence, N represents any base, for example, C, G, A or T) IIIIIIIIII (UMI template sequence, I is Inosine) TTTTTTTTTTTTTTTTTTTTTT (capture sequence, SEQ ID NO: 13) CCTCAG C (restriction site, SEQ ID NO: 14) CCTTGGCTCACA (fixed sequence 2, SEQ ID NO: 15). Wherein, fixed sequence 1 comprises a partial sequence of the complementary sequence of the first fixed sequence and a cyclization site, and fixed sequence 2 comprises a partial sequence of the complementary sequence of the first fixed sequence and a cyclization site.

[0379] 2. In situ amplification of the library

[0380] Preparation of DNA nanoballs (DNBs): 40ul of the following reaction system was prepared, and 80fmol of the above DNA library was added. The DNB primer sequence was GACATGGCTACGTGTGAGCCAAGG (SEQ ID NO: 16), which was synthesized by BGI Liuhe.

[0381] Element Volume(ul) Final concentration DNA library sequences 80fmol(×) 10×phi29buffer (BGI self-produced) 4 1× DNB primer sequence 10uM 4 1uM Molecular water 32-x

[0382] The above reaction volume was placed in a PCR instrument for reaction under the following conditions: 95°C for 3 min, 40°C for 3 min; after the reaction, it was placed on ice, 40ul of the mixed enzyme I required for DNB preparation in the DNBSEQ sequencing kit, 2ul of the mixed enzyme II, and 1ul of ATP (mother solution 100mM, Thermo Fisher), 0.1ul of T4 ligase (BGI self-produced) were added, and after mixing, the above reaction system was placed in a PCR instrument at 30°C for reaction for 20 min to form DNB. The DNB was loaded onto the BGISEQ500 sequencing chip according to the method described in the BGISEQ500 SE50 kit.

[0383] 3. Spatial information decoding

[0384] (1) Chip surface modification:

[0385] The surface of the BGISEQ-500 platform chip was connected to the Azido- 8-NHS ester, the structure is as follows:

[0386]

[0387] The chip surface was modified according to the following method: NHS-PEG8-Azido (564.58 g / mol) concentration was 45 μM, and 100 ml was prepared:

[0388] Reagents Dosage unit NHS-PEG8-Azido 2.54 mg 1×PBS (pH 7.4) 100 ml

[0389] Store at -20℃ and avoid repeated freezing and thawing.

[0390] The concentration of DBCO-primer is 1uM, diluted with PBS

[0391] (2) Primer-probe coupling:

[0392] BGI Liuhe custom synthesized the following primer and probe sequences:

[0393] DBCO (linker)-UUU (USER restriction site) TTTTTCCCGTAGCCATGTCGTTCTGCGCCTTCCCGATG (SEQ ID NO: 17, the sequence includes the first fixed sequence complementary sequence, PCR amplification site sequence, and intermediate sequence). 1uM of the above primer probe sequence was diluted with PBS and passed into the chip modified with azido, and reacted at room temperature for 1 hour or overnight.

[0394] (3) Spatial information decoding. According to the instructions of the BGISEQ500 SE50 sequencing kit, the spatial information sequence was decoded and sequenced, and the sequencing length was set to 30 bp (the first 20 bp was the spatial information sequence, and the last 10 bp was the probe label sequence). The fq file generated by sequencing was stored for later use.

[0395] (4) Capture zone synthesis:

[0396] A mixture of dTTP and Hifi polymerase was prepared, using DNB as a template, a probe sequence containing a spatial localization region as a primer, and dTTP as a substrate to extend the oligo dT sequence.

[0397] 4. Release of probes containing spatial information

[0398] Prepare 1uM Spatial_RNA_BbvCI primer (diluted with 5×SSC), the primer sequence CCTCAGCCAACTCCT (SEQ ID NO: 18) was synthesized by BGI Liuhe; hybridize at room temperature for 30min; prepare BbvCI excision system (1.5ml): 15ul RE+150ul 10×CS Buffer+1335ul ddH2O, pass into the chip after spatial localization region decoding, react at 37℃ for 1h or overnight, add WB2 in the sequencing kit (MGI) to wash twice, then use formamide to react at 55℃ for 15min, and finally rinse twice with WB2. The schematic diagram of the obtained probe is as follows Figure 7 The probe sequences are shown below:

[0399] UUU (excision region)TTTTTCCCGTAGCCATGTCGTTCTGCGCCTTCCCGATG (first fixed sequence complementary sequence, SEQ ID NO: 19)NNNNNNNNNNNNNNNNNNNN (positioning sequence complementary sequence, which is the same as the positioning sequence template sequence in the DNA library sequence in step one)NNNNNNNNNN (UMI sequence, which is the complementary sequence of the random base sequence obtained using the UMI template sequence in step one as a template)TTTTTTTTTTTTTTTTTTTTTT (capture sequence, SEQ ID NO: 20).

[0400] 5. Chip dicing

[0401] The prepared capture chip was cut into several small pieces. The size of the slices was adjusted according to the experimental needs. The chip was immersed in 50 mM tris buffer at pH 8.0 and kept at 4°C for use.

[0402] Example 5. Tissue mRNA capture and cDNA synthesis

[0403] 1. Frozen tissue sections. Prepare mouse cerebellum tissue sections according to the standard frozen section procedure.

[0404] 2. mRNA capture. According to the size of the sliced ​​tissue, take a chip of appropriate size prepared in Example 4 and place it at room temperature until the liquid on the chip evaporates. Then, use the temperature difference between the sliced ​​tissue and the chip in the slicer to stick the sliced ​​tissue on the capture chip. Place the stuck tissue slices at room temperature, add 5×SSC reaction solution to the chip (fully cover the area with the tissue stuck), react at 30°C for 30 minutes, and allow the mRNA in the tissue to fully hybridize with the capture area on the chip.

[0405] 3. cDNA synthesis. Wash the chip twice with 5×SSC at room temperature, prepare 200ul of the following reverse transcriptase reaction system, add the reaction solution to the chip, fully cover it, react at 42°C for 90min-180min, and use polyT as a primer for cDNA synthesis of mRNA. The 3 ends of the mRNA are labeled with TSO (CGTAGCCATGTCGTTCTGCG / rG / / rG / / iXNA_G / ) (SEQ ID NO: 21) for the synthesis of cDNA complementary chains. The structural diagram of the above process is shown in the figure. Figure 8 shown.

[0406]

[0407] 4. cDNA release. After the first strand of cDNA is synthesized on the chip, prepare the USER enzyme reaction system and perform the reaction according to the instructions for use of the USER enzyme. The released molecules have the following characteristics: Fig. 9 The reaction solution released from the chip was collected, and the cDNA strand was purified using 2×XP magnetic beads, and finally the product was recovered using 45ul TE buffer (Thermo Fisher).

[0408] 5. cDNA amplification. Prepare 100ul of the following reaction system:

[0409]

[0410] The above reaction system was placed in a PCR instrument and the following reaction program was set: 95°C for 3 min, 11 cycles (98°C for 20 s, 58°C for 20 s, 72°C for 3 min), 72°C for 5 min, and 4°C for ∞. After the reaction, XP beads were used for magnetic bead purification and recovery. The qubit kit was used to quantify the dsDNA concentration, and the 2100 was used to detect the distribution of cDNA fragments. The 2100 detection results are shown in Figure 2. Fig.10 As shown, the cDNA length was normal.

[0411] Example 6. cDNA library construction and sequencing

[0412] 1. Tn5 shearing. According to the cDNA concentration, take 20ng cDNA, add 0.5uM Tn5 shearing enzyme and corresponding buffer (Tn5 shearing enzyme coating method is in accordance with the stLFR library construction kit), mix to make a 20ul reaction system, react at 55℃ for 10min, add 5ul 0.1% SDS and mix at room temperature for 5min to end the Tn5 shearing step.

[0413] 2. PCR amplification. Prepare 100ul of the following reaction system:

[0414]

[0415]

[0416] After mixing, place in PCR instrument and set the following program: 95℃3min, 11 cycles (98℃20s, 58℃20s, 72℃3min), 72℃5min, 4℃∞. After the reaction, XP beads were used for magnetic bead purification and recovery. The qubit kit was used to quantify the dsDNA concentration.

[0417] 3. Sequencing. Take 80 fmol of the amplified product after the above shearing and prepare DNB. Configure the following 40ul reaction system:

[0418]

[0419] The above reaction volume was placed in a PCR instrument for reaction under the following reaction conditions: 95°C for 3min, 40°C for 3min; after the reaction, it was placed on ice, and 40ul of the mixed enzyme I required for DNB preparation in the DNBSEQ sequencing kit, 2ul of the mixed enzyme II, and 1ul of ATP (mother solution 100mM, Thermo Fisher), 0.1ul of T4 ligase (BGI self-produced) were added, and after mixing, the above reaction system was placed in a PCR instrument at 30°C for reaction for 20min to form DNB. The DNB was loaded onto the sequencing chip of MGISEQ2000 according to the method described in the PE50 kit on MGISEQ2000, and sequenced according to the relevant instructions, and the customer sequencing mode was selected, in which the first-strand sequencing was divided into two sections of 20bp sequencing and then 10bp probe tag sequence sequencing was performed, and the second-strand was set to 50bp.

[0420] Data analysis

[0421] 1. Match the 20 bp sequence obtained by sequencing the cDNA strand with the fq of the spatial information sequence on the chip (the sequencing result obtained in step 3 of Example 4). The matching result is as follows: Fig.11 As shown, the bright area is the area where the 20 bp sequenced by cDNA completely matches the capture chip, and this area represents the area on the capture chip used for tissue capture, indicating that the capture chip can use the spatial positioning area to accurately locate the tissue capture area.

[0422] 2. Further analyze the DNBs that match the cDNA sequencing to the capture chip, and compare the second-strand sequencing results of these DNB reads (reflecting the mRNA expression in the tissue) with the mouse genome. The DNBs that match the mouse genome are matched to the capture chip through the 20bp sequencing results, such as Fig.12As shown in the figure, the left side shows the overall expression of mRNA in the analyzed tissue sections, which shows that this capture chip can analyze the expression difference of mRNA in tissues. The right side of this figure shows the expression level of a gene expressed in the mouse cerebellum randomly selected in the tissue, indicating that this chip can analyze the expression difference of a gene in the tissue sample in the whole tissue.

[0423] Although the specific embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that various modifications and changes may be made to the details according to all the teachings that have been published, and these changes are within the scope of protection of the present invention. The entire invention is given by the attached claims and any equivalents thereof.

Claims

1. A method for producing a nucleic acid array, comprising the following steps: (1) providing a plurality of vector sequences on the surface of a solid support (e.g., a chip), each vector sequence comprising a plurality of copies of a vector sequence, wherein the vector sequence comprises: a capture template sequence, a positioning sequence, and a fixed sequence; Wherein, the capture template sequence comprises a complementary sequence of the capture sequence, and the capture sequence is capable of hybridizing with all or part of the nucleic acid to be captured; The positioning sequence has a unique nucleotide sequence corresponding to the position of the vector sequence on the solid support; The fixed sequence allows a nucleotide sequence complementary thereto (e.g., a primer) to anneal and initiate an extension reaction; (2) Providing a probe primer, and using the vector sequence as a template, performing a primer extension reaction to generate a capture probe, wherein the capture probe includes: a complementary sequence to the capture template sequence (eg, a capture sequence), and a complementary sequence to the positioning sequence.

2. The method of claim 1, wherein: The fixed sequence is selected from a first fixed sequence and / or a second fixed sequence; wherein the first and second fixed sequences allow a nucleotide sequence complementary thereto (eg, a primer) to anneal and initiate an extension reaction; Preferably, the vector sequence comprises, from 5' to 3', a positioning sequence and a first fixed sequence; Preferably, the vector sequence comprises, from 5' to 3', a capture template sequence, a positioning sequence and a first fixed sequence; wherein the first fixed sequence allows a nucleotide sequence complementary thereto to anneal and initiate an extension reaction.

3. The method according to claim 1 or 2, wherein The method comprises one or more selected from the following: (1) providing a probe primer, wherein the probe primer binds to the fixed sequence and uses the carrier sequence as a template to perform a primer extension reaction to generate a first nucleic acid molecule, wherein the first nucleic acid molecule comprises a complementary sequence to the fixed sequence, a complementary sequence to the positioning sequence, and a capture sequence; (2) The vector sequence includes, from 5' to 3', a capture template sequence, a positioning sequence and a fixed sequence; a probe primer is provided, and a primer extension reaction is performed using the vector sequence as a template, so that the fixed sequence (e.g., the first fixed sequence) and the positioning sequence region of the vector sequence form a double strand, wherein the strand hybridized with the vector sequence is the first nucleic acid molecule, and the first nucleic acid molecule includes, from 5' to 3', a complementary sequence of the fixed sequence (e.g., the first fixed sequence), a complementary sequence of the positioning sequence and a capture sequence; (3) the probe primer comprises a fixed sequence (e.g., first fixed sequence) complementary region at its 3' end, the fixed sequence complementary region (e.g., first fixed sequence complementary region) comprises a complementary sequence of the fixed sequence (e.g., first fixed sequence) or a fragment thereof, and has a 3' free end; (4) the diameter of the area occupied by each vector sequence containing multiple copies of the same positioning sequence on the surface of the solid support is less than 1 micron; Preferably, the area occupied by each carrier sequence (i.e., each carrier sequence comprising multiple copies of the same positioning sequence) or each capture probe (i.e., each capture probe comprising the same positioning sequence / a sequence complementary to the positioning sequence) on the surface of the solid support (i.e., the active area) is less than 1 micron in diameter.

4. The method according to any one of claims 1 to 3, wherein The method is used to detect the spatial information of nucleic acids in biological samples; Preferably, the capture sequence comprises: (a) an oligonucleotide sequence capable of capturing mRNA; and / or, (b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a particular target nucleic acid.

5. The method according to any one of claims 1 to 4, wherein While performing the primer extension reaction, sequencing the vector sequence or a portion thereof, thereby obtaining sequence information of the positioning sequence contained in the vector sequence; Preferably, the primer extension reaction is sequencing by synthesis (SBS), and the capture probe is generated based on the SBS, and the sequence information of the positioning sequence contained in the vector sequence is obtained.

6. The method according to any one of claims 1 to 4, wherein Prior to the primer extension reaction, the vector sequence or a portion thereof (eg, a positioning sequence) is subjected to nucleic acid analysis (eg, the vector sequence or a portion thereof is sequenced).

7. The method according to any one of claims 1 to 6, wherein The vector sequence further comprises a unique molecular identifier (UMI) sequence, wherein the UMI sequence is located at the 3' end of the capture template sequence; Preferably, the UMI sequence is located at the 5' end of the complementary sequence of the fixed sequence (e.g., the first fixed sequence); Preferably, the UMI sequence is a nucleotide sequence consisting of at least 1 (e.g., at least 2, at least 3, at least 4, or at least 5; e.g., 5-100) N, and each N is independently any one of A, C, G and T.

8. The method according to any one of claims 3 to 6, wherein The first nucleic acid molecule further comprises a unique molecular identifier (UMI) sequence, wherein the UMI sequence is located at the 5' end of the complementary sequence of the fixed sequence (e.g., the first fixed sequence); The UMI sequence is a nucleotide sequence consisting of at least 1 (e.g., at least 2, at least 3, at least 4, or at least 5; e.g., 5-100) N, and each N is independently any one of A, C, G and T.

9. The method according to any one of claims 1 to 8, wherein The fixed sequence of the vector sequence (for example, the first fixed sequence) further comprises a cleavage site, and the cleavage can be selected from nicking enzyme cleavage, USER cleavage, photoexcision, chemical excision or CRISPR excision; Optionally, after obtaining the first nucleic acid molecule, the cleavage site contained in the first fixed sequence of the vector sequence is cleaved to digest the vector sequence; Optionally, the nucleic acid array further comprises a first nucleic acid molecule, wherein the first nucleic acid molecule comprises, from the 5' to the 3' direction: a binding region, an excision region, and a region complementary to a vector sequence, The binding region comprises a linker capable of connecting to the surface of the solid support; The excision region comprises the cleavage site.

10. The method of claim 9, wherein: The linker is a linker group that can be coupled to an activating group (e.g., NH2), and the surface of the solid support is modified with an activating group (e.g., NH2); Preferably, the linker comprises -SH, -DBCO or -NHS; Preferably, the linker is (DBCO), the surface of the solid support is connected with (Azido- 8-NHS ester).

11. The method of claim 9, wherein: The cleavage site contained in the excision region of the first nucleic acid molecule is a site that can be controlled by chemical, enzymatic or photochemical methods; Preferably, the cleavage site contained in the excision region of the first nucleic acid molecule is an enzyme cleavage site; Preferably, the excision region of the first nucleic acid molecule is different from the cleavage site contained in the fixed sequence (eg, the first fixed sequence) of the vector sequence.

12. The method according to any one of claims 1 to 11, further comprising before step (1): (i) providing a plurality of vector template sequences, wherein the vector template sequences comprise complementary sequences of the vector sequences; (ii) performing a nucleic acid amplification reaction using each vector template sequence as a template to obtain an amplification product of each vector template sequence, wherein the amplification product comprises multiple copies of the vector sequence; Wherein, the nucleic acid amplification reaction is selected from rolling circle replication (RCA), bridge PCR amplification, multiple strand displacement amplification (MDA) or emulsion PCR amplification.

13. The method according to any one of claims 1 to 11, wherein The plurality of copies of the vector sequence are DNBs formed by concatemers of the vector sequence; Preferably, the nucleic acid amplification reaction is selected from rolling circle replication (RCA) and / or multiple strand displacement amplification (MDA); Preferably, the DNBs formed by concatemers of said vector sequences are obtained by rolling circle replication.

14. The method according to any one of claims 1 to 11, wherein The plurality of copies of the vector sequence is a DNA cluster formed by a clonal population of the vector sequence; Preferably, the nucleic acid amplification reaction is selected from bridge PCR amplification and / or emulsion PCR amplification; Preferably, a DNA cluster formed by a clonal group of the vector sequence is obtained by bridge PCR amplification or emulsion PCR amplification or multiple strand displacement amplification.

15. The method according to any one of claims 1 to 14, wherein the plurality of vector sequences are immobilized on the surface of a solid support (e.g., a chip); Preferably, in step (1), the plurality of vector sequences are randomly fixed on the surface of a solid support (e.g., a chip); Preferably, in step (1), the multiple vector sequences are connected to the surface of a solid support (e.g., a chip) to obtain a solid support having multiple vector sequences fixed on the surface; Preferably, in step (1), the plurality of vector sequences are randomly linked to the surface of a solid support (e.g., a chip) to obtain a solid support having a plurality of vector sequences fixed on the surface; Preferably, in step (1), the multiple vector sequences are loaded onto the surface of a solid support (e.g., a chip) to obtain a solid support having multiple vector sequences fixed on the surface; Preferably, in step (1), the plurality of vector sequences are randomly loaded onto the surface of a solid support (eg, a chip) to obtain a solid support having a plurality of vector sequences fixed on the surface.

16. The method according to any one of claims 1 to 15, wherein The solid support is a chip; Preferably, the solid support is a sequencing chip; Preferably, the solid support is a high-throughput sequencing chip, such as a high-throughput sequencing chip used in Illumina, MGI or Thermo Fisher sequencing platforms.

17. The method according to any one of claims 4 to 16, wherein: The oligonucleotide sequence capable of capturing mRNA includes a sequence capable of hybridizing with the poly-A tail of mRNA; Preferably, the oligonucleotide sequence capable of capturing mRNA comprises a poly-T oligonucleotide sequence; Preferably, the poly-T oligonucleotide sequence comprises at least 10 (eg at least 20) deoxythymidine residues.

18. The method according to any one of claims 1 to 12, 14 to 17, wherein Prior to the extension reaction in step (2), performing nucleic acid analysis on the vector sequence or a portion thereof (e.g., a positioning sequence) (e.g., sequencing the vector sequence or a portion thereof); Preferably, there are one or more sequencing adapters on the surface of the solid support and / or in the carrier sequence, such as P5, P7 and / or P9 adapters of the Illumina sequencing platform; Preferably, the fixed sequence further comprises a sequencing primer hybridization region and / or an amplification primer hybridization region; wherein the sequencing primer hybridization region allows the sequencing primer to anneal and initiate a sequencing reaction, and the amplification primer hybridization region allows the amplification primer to anneal and initiate an extension and amplification reaction; Preferably, in step (1), the plurality of copies of the vector sequence is a DNA cluster formed by a clonal group of the vector sequence, and the DNA cluster is obtained by bridge PCR amplification; Preferably, before the extension reaction in step (2), the DNA cluster is sequenced to obtain the positioning sequence information; Preferably, before the extension reaction in step (2), the DNA cluster is sequenced by synthesis using the sequencing adapter on the surface of the solid support as a primer to generate a sequencing chain, obtain the positioning sequence information, and then remove the sequencing chain.

19. A nucleic acid array prepared by the method according to any one of claims 1 to 18.

20. A kit comprising the nucleic acid array of claim 19; Preferably, the kit further comprises a reverse transcription reagent, a nucleic acid amplification reagent, a nucleic acid library preparation reagent and / or a sequencing reagent.

21. A method for spatial information labeling of nucleic acid molecules in a sample to be tested, comprising the following steps: (1) Providing the nucleic acid array according to claim 19, or the kit according to claim 19, or the nucleic acid array obtained by the method according to any one of claims 1 to 18; (2) contacting the nucleic acid array with a sample to be tested under conditions that allow annealing, so that the nucleic acid or its complementary sequence in the sample to be tested is attached (e.g., linked and / or hybridized) to the capture probe or its complementary sequence, thereby corresponding the position of the nucleic acid to the position of the capture probe on the nucleic acid array, and obtaining a nucleic acid molecule labeled with spatial information; wherein the nucleic acid molecule labeled with spatial information has a positioning sequence or its complementary sequence as a spatial information marker; Preferably, in step (2), the nucleic acid array is contacted with the sample to be tested under conditions that allow annealing, so that the nucleic acid or its complementary sequence in the sample to be tested is attached (e.g., connected and / or hybridized) to the first nucleic acid molecule or its complementary sequence; under conditions that allow primer extension, a primer extension reaction is performed using the first nucleic acid molecule as a primer and the captured nucleic acid molecule as a template to produce an extension product, thereby obtaining a nucleic acid molecule labeled with spatial information, so that the position of the nucleic acid is corresponded to the position of the first nucleic acid molecule on the nucleic acid array, wherein the nucleic acid molecule labeled with spatial information has a positioning sequence or its complementary sequence as a spatial information marker; Preferably, in step (1), the nucleic acid array comprises a plurality of vector sequences connected to the surface of a solid support (e.g., a chip), each vector sequence occupies a different position in the solid support, and each vector sequence comprises a plurality of copies of the vector sequence; Each carrier sequence comprises a first nucleic acid molecule hybridized thereto, wherein the first nucleic acid molecule comprises a complementary sequence to a positioning sequence corresponding to the position of the carrier sequence on the array and a capture sequence capable of capturing nucleic acid in a sample. Preferably, in step (2), the nucleic acid array is contacted with the sample to be tested under conditions that allow annealing, so that the nucleic acid in the sample to be tested anneals with the capture sequence of the first nucleic acid molecule, so that the position of the nucleic acid is corresponded to the position of the first nucleic acid molecule on the nucleic acid array; Under conditions allowing primer extension, a primer extension reaction is carried out using the first nucleic acid molecule as a primer and the captured nucleic acid molecule as a template to produce an extension product, in which the chain hybridized with the captured nucleic acid molecule has a complementary sequence to the positioning sequence contained in the first nucleic acid molecule as a spatial information marker.

22. The method of claim 21, wherein: (1) The sample is a tissue sample; (2) The sample is a sample containing cells (e.g., a tissue sample containing cells); (3) The sample is a tissue section; (4) The sample is a formalin-fixed paraffin-embedded (FFPE) tissue sample, a deep-frozen tissue sample and / or a fresh tissue sample.

23. A method for detecting spatial information of nucleic acid in a sample to be tested, the method further comprising the following steps: 1) obtaining a nucleic acid molecule labeled with spatial information by the method of claim 21 or 22; II) directly or indirectly analyzing the nucleic acid molecules labeled with the spatial information; Optionally, after step I) and before step II), at least a portion of the nucleic acid molecules labeled with spatial information are released from the surface of the solid support, wherein the nucleic acid molecules labeled with spatial information include the positioning sequence or its complementary chain and the captured nucleic acid molecules or its complementary chain.

24. The method of claim 23, wherein: The method has one or more characteristics selected from the following: (1) The spatial information of the nucleic acid includes the location, distribution and / or expression of the nucleic acid; (2) at least a portion of the spatial information labeled nucleic acid molecules are released from the surface of the solid support by: (i) nucleic acid shearing; (ii) denaturation; and / or (iii) physical methods; (3) In step (II), the analysis includes sequencing or sequence-specific PCR reaction.

Images