Method for sequencing polynucleotides

Abstract

A method for determining the sequence of a target single-stranded polynucleotide is provided, comprising monitoring the sequential incorporation of nucleotides complementary to the target single-stranded polynucleotide, wherein the nucleotides are each attached to a chemiluminescent marker that induces a different luminescence kinetics or luminescence type, wherein each incorporated nucleotide is identified by detecting the luminescence kinetics or luminescence type of the chemiluminescent reaction in which the chemiluminescent marker participates and subsequently removing the chemiluminescent marker.

Description

[0001] This application is a divisional application of the Chinese patent application with application number 201880095214.8. Field of the Invention

[0002] The present invention relates to a method for sequencing polynucleotides by monitoring the sequential incorporation of nucleotides labeled with chemiluminescent markers, wherein the monitoring comprises detecting the luminescence kinetics or luminescence type of the chemiluminescent reaction in which the chemiluminescent marker of each incorporated nucleotide participates. Background of the Invention

[0003] In the past 10 years, the second-generation gene sequencing technology has gradually developed from an emerging technology to a mainstream sequencing method, and has gradually become an important detection tool in the clinical field, playing an increasingly important role in the prevention and control of infectious diseases, diagnosis of genetic diseases, non-invasive prenatal screening and other fields. In order to further expand the sequencing market and make sequencers more popular, the development of low-cost miniaturized sequencers has gradually become a development trend in the sequencing field. As a classic method of second-generation sequencing technology, the three sequencing methods based on four channels, two channels and single channels have their own advantages, but compared with the three, single-channel sequencing has gradually become a development trend in the sequencing field with its advantages of fewer consumables, lower cost, and easier to achieve instrument miniaturization and portability. At present, the products based on single-color channels on the market mainly include ion torrent series sequencers, 454 sequencers and Illumina's latest Iseq100.

[0004] Among the current single-channel sequencing technologies, the ion torrent series of instruments have limited their scope of use due to the high error rate of polymer structure sequencing. Similarly, Roche's 454 instrument has gradually withdrawn from the sequencing market due to its low sequencing accuracy and high sequencing costs. Illumia's Iseq100 is based on monochrome fluorescence technology and semiconductor technology, which realizes a miniaturized sequencer and maintains a high sequencing quality. However, because its optical signal is excited by a laser, the instrument needs to be equipped with an additional laser, which increases the size of the instrument. In addition, in order to avoid the background value generated by the excitation light, the semiconductor chip needs to be specially processed to filter out the background generated by the excitation light. This processing will result in high costs, thereby increasing the sequencing cost.

[0005] Therefore, there is still a need in the art for improved sequencing technology with lower sequencing cost and higher sequencing quality. SUMMARY OF THE INVENTION

[0006] The present invention relates to labeling nucleotides with chemiluminescent markers and sequencing polynucleotides by monitoring the sequential incorporation of such labeled nucleotides. More specifically, the present invention relates to monitoring the sequential incorporation of nucleotides by detecting the luminescence kinetics or luminescence type of the chemiluminescent reaction in which the chemiluminescent marker of each incorporated nucleotide participates.

[0007] In one aspect, the present invention relates to a method for determining the sequence of a target single-stranded polynucleotide, which comprises monitoring the sequential incorporation of nucleotides complementary to the target single-stranded polynucleotide, wherein the nucleotides are each attached to a chemiluminescent marker that induces different luminescence kinetics, wherein each incorporated nucleotide is identified by detecting the luminescence kinetics of a chemiluminescent reaction in which the chemiluminescent marker participates and subsequently removing the chemiluminescent marker.

[0008] In specific embodiments, the ribose or deoxyribose moiety of each nucleotide comprises a protecting group attached via the 2' or 3' oxygen atom, wherein the protecting group is modified or removed after incorporation of each nucleotide so as to expose the 3'-OH group.

[0009] In specific embodiments, the chemiluminescent label and the protecting group are removed under the same conditions.

[0010] In specific embodiments, the nucleotides are selected from the nucleotides A, G, C and T or U.

[0011] In a specific embodiment, the detection of the luminescence kinetics of a chemiluminescent reaction in which a chemiluminescent marker participates comprises contacting the chemiluminescent marker with a suitable substrate to trigger the chemiluminescent reaction, and detecting the luminescence kinetics of the light emitted thereby.

[0012] In a specific embodiment, the chemiluminescent marker is selected from the group consisting of biochemiluminescent markers eliciting different luminescence kinetics and any combination thereof.

[0013] In a specific embodiment, the chemiluminescent label is selected from the group consisting of luciferases eliciting different luminescence kinetics and any combination thereof.

[0014] In a specific embodiment, the chemiluminescent label is a combination of two luciferases that elicit different luminescence kinetics.

[0015] In one aspect, the present invention relates to a method for determining the sequence of a target single-stranded polynucleotide, which comprises monitoring the sequential incorporation of nucleotides complementary to the target single-stranded polynucleotide, wherein the nucleotides are each attached to a chemiluminescent marker that elicits a different type of luminescence, wherein each incorporated nucleotide is identified by detecting the type of luminescence of the chemiluminescent reaction in which the chemiluminescent marker participates and subsequently removing the chemiluminescent marker.

[0016] In specific embodiments, the ribose or deoxyribose moiety of each nucleotide comprises a protecting group attached via the 2' or 3' oxygen atom, wherein the protecting group is modified or removed after incorporation of each nucleotide so as to expose the 3'-OH group.

[0017] In specific embodiments, the chemiluminescent label and the protecting group are removed under the same conditions.

[0018] In specific embodiments, the nucleotides are selected from the nucleotides A, G, C and T or U.

[0019] In a specific embodiment, the detection of the luminescence kinetics of a chemiluminescent reaction in which a chemiluminescent marker participates comprises contacting the chemiluminescent marker with a suitable substrate to trigger the chemiluminescent reaction, and detecting the luminescence pattern of the light emitted thereby.

[0020] In a specific embodiment, the chemiluminescent marker is selected from biochemiluminescent markers that elicit different types of luminescence, and any combination thereof.

[0021] In a specific embodiment, the chemiluminescent marker is selected from luciferases that elicit different types of luminescence and any combination thereof.

[0022] In a specific embodiment, the chemiluminescent label is a combination of two luciferases that elicit different types of luminescence.

[0023] In a specific embodiment, the light emitting type includes a flash type, a glow type, and a mixed type.

[0024] In one aspect, the present invention relates to a method for determining the sequence of a target single-stranded polynucleotide, which comprises (a) providing one or more nucleotides, wherein each of the nucleotides is attached to a different chemiluminescent label, wherein the chemiluminescent label to which each type of nucleotide is attached exhibits different luminescence kinetics when detected than the chemiluminescent labels to which other types of nucleotides are attached; (b) incorporating a nucleotide into the complementary strand of the target single-stranded polynucleotide; (c) detecting the chemiluminescent label of the nucleotide of (b) to determine the type of incorporated nucleotide; (d) removing the chemiluminescent label of the nucleotide of (b); and (e) optionally repeating steps (b)-(d) one or more times to determine the sequence of the target single-stranded polynucleotide.

[0025] In specific embodiments, detecting the chemiluminescent label of the nucleotide of (b) comprises contacting the chemiluminescent label with a suitable substrate to trigger a chemiluminescent reaction, and detecting the luminescence kinetics of the light emitted thereby.

[0026] In a specific embodiment, the chemiluminescent marker is selected from the group consisting of biochemiluminescent markers eliciting different luminescence kinetics and any combination thereof.

[0027] In a specific embodiment, the chemiluminescent label is selected from the group consisting of luciferases eliciting different luminescence kinetics and any combination thereof.

[0028] In a specific embodiment, the chemiluminescent label is a combination of two luciferases that elicit different luminescence kinetics.

[0029] In specific embodiments, the ribose or deoxyribose moiety of each nucleotide comprises a protecting group attached via the 2' or 3' oxygen atom, wherein the protecting group is modified or removed after incorporation into the nucleotide so as to expose the 3'-OH group.

[0030] In specific embodiments, the chemiluminescent label and the protecting group are removed under the same conditions.

[0031] In specific embodiments, the nucleotides are selected from the nucleotides A, G, C and T or U.

[0032] In a specific embodiment, each nucleotide is contacted with the target single-stranded polynucleotide in sequence, unincorporated nucleotides are removed before adding the next nucleotide, and wherein detection and removal of the chemiluminescent label is performed after addition of each nucleotide or after addition of all four nucleotides.

[0033] In specific embodiments, one, two, three or all four nucleotides are contacted with the target single-stranded polynucleotide simultaneously and unincorporated nucleotides are removed prior to detection, wherein detection and removal of the chemiluminescent label is performed after addition of the one, two, three or all four nucleotides.

[0034] In one aspect, the present invention relates to a method for determining the sequence of a target single-stranded polynucleotide, which comprises (a) providing one or more nucleotides, wherein each of the nucleotides is attached to a different chemiluminescent marker, wherein the chemiluminescent marker to which each type of nucleotide is attached exhibits a different type of luminescence when detected than the chemiluminescent marker to which other types of nucleotides are attached; (b) incorporating a nucleotide into the complementary strand of the target single-stranded polynucleotide; (c) detecting the chemiluminescent marker of the nucleotide of (b) to determine the type of the incorporated nucleotide; (d) removing the chemiluminescent marker of the nucleotide of (b); and (e) optionally repeating steps (b)-(d) one or more times to determine the sequence of the target single-stranded polynucleotide.

[0035] In a specific embodiment, detecting the chemiluminescent label of the nucleotide of (b) comprises contacting the chemiluminescent label with a suitable substrate to trigger a chemiluminescent reaction, and detecting the luminescent pattern of the light emitted thereby.

[0036] In a specific embodiment, the chemiluminescent marker is selected from biochemiluminescent markers that elicit different types of luminescence, and any combination thereof.

[0037] In a specific embodiment, the chemiluminescent marker is selected from luciferases that elicit different types of luminescence and any combination thereof.

[0038] In a specific embodiment, the chemiluminescent label is a combination of two luciferases that elicit different types of luminescence.

[0039] In a specific embodiment, the light emitting type includes a flash type, a glow type, and a mixed type.

[0040] In specific embodiments, the ribose or deoxyribose moiety of each nucleotide comprises a protecting group attached via the 2' or 3' oxygen atom, wherein the protecting group is modified or removed after incorporation into the nucleotide so as to expose the 3'-OH group.

[0041] In specific embodiments, the chemiluminescent label and the protecting group are removed under the same conditions.

[0042] In specific embodiments, the nucleotides are selected from the nucleotides A, G, C and T or U.

[0043] In a specific embodiment, each nucleotide is contacted with the target single-stranded polynucleotide in sequence, unincorporated nucleotides are removed before adding the next nucleotide, and wherein detection and removal of the chemiluminescent label is performed after addition of each nucleotide or after addition of all four nucleotides.

[0044] In specific embodiments, one, two, three or all four nucleotides are contacted with the target single-stranded polynucleotide simultaneously and unincorporated nucleotides are removed prior to detection, wherein detection and removal of the chemiluminescent label is performed after addition of the one, two, three or all four nucleotides.

[0045] In various aspects, the attachment between the nucleotide and the chemiluminescent label comprises attachment mediated by an affinity interaction.

[0046] In specific embodiments, affinity interactions include antigen-antibody interactions and biotin-avidin (eg, streptavidin) interactions.

[0047] In a specific embodiment, the chemiluminescent label is attached to the nucleotide via affinity interaction between the members by linking the chemiluminescent label to one of the members participating in the affinity interaction and linking the nucleotide to the other member participating in the affinity interaction.

[0048] In a specific embodiment, the member linked to the nucleotide is biotin and the member linked to the chemiluminescent label is avidin (eg, streptavidin).

[0049] In a specific embodiment, the member linked to the nucleotide is digoxigenin and the member linked to the chemiluminescent label is an anti-digoxigenin antibody.

[0050] In a specific embodiment, the member linked to the nucleotide is digoxigenin, and the member linked to the chemiluminescent label is avidin (eg, streptavidin), wherein the digoxigenin and avidin are affinity-bound via an anti-digoxigenin antibody linked to biotin.

[0051] In a specific embodiment, among the nucleotides, the first nucleotide is attached to a first chemiluminescent label, the second nucleotide is attached to a second chemiluminescent label, the third nucleotide is attached to both the first chemiluminescent label and the second chemiluminescent label, and the fourth nucleotide is not attached to any chemiluminescent label.

[0052] In a specific embodiment, among the nucleotides, the first nucleotide is attached to a first luciferase, the second nucleotide is attached to a second luciferase, the third nucleotide is attached to both the first and second luciferases, and the fourth nucleotide is not attached to any luciferase.

[0053] In other aspects, the present invention also relates to a kit comprising: (a) one or more nucleotides selected from nucleotides A, G, C and T or U, wherein each of the nucleotides is attached to a different chemiluminescent marker, wherein the chemiluminescent marker attached to each type of nucleotide exhibits different luminescence kinetics and / or luminescence type when detected than the chemiluminescent markers attached to other types of nucleotides; and (b) their packaging materials.

[0054] In specific embodiments, the kit further comprises an enzyme and a buffer suitable for the function of the enzyme.

[0055] In a specific embodiment, the kit further comprises a suitable substrate for reacting with the chemiluminescent label. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Figure 1 Examples of different luminescence kinetics are shown.

[0057] Figure 2 A flow chart for sequencing a polynucleotide according to one embodiment of the present invention is shown.

[0058] Figure 3 A signal curve for sequencing a polynucleotide according to one embodiment of the present invention is shown.

[0059] Figure 4 A comparison of signal curves for sequencing polynucleotides according to one embodiment of the present invention is shown. DETAILED DESCRIPTION OF THE INVENTION

[0060] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art to which the invention belongs. All patents, applications and other publications mentioned herein are incorporated herein by reference in their entirety. If the definitions set forth herein conflict or are inconsistent with the definitions described in the patents, applications and other publications incorporated herein by reference, the definitions set forth herein shall prevail.

[0061] As used herein, the term "polynucleotide" refers to deoxyribonucleic acid (DNA), ribonucleic acid (RNA) or its analog. Polynucleotides can be single-stranded, double-stranded or contain both single-stranded and double-stranded sequences. Polynucleotide molecules can be derived from double-stranded DNA (dsDNA) forms (e.g., genomic DNA, PCR and amplification products, etc.), or can be derived from DNA (ssDNA) or RNA in single-stranded form and it can be converted into dsDNA forms, and vice versa. The accurate sequence of polynucleotide molecules can be known or unknown. The following are illustrative examples of polynucleotides: gene or gene fragment (e.g., probe, primer, EST or SAGE tag), genomic DNA, genomic DNA fragment, exon, intron, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozyme, cDNA, recombinant polynucleotides, synthetic polynucleotides, branched polynucleotides, plasmids, vectors, DNA separated by any sequence, RNA separated by any sequence, nucleic acid probes, primers or amplification copies of any of the above sequences.

[0062] Polynucleotides may include nucleotides or nucleotide analogs. Nucleotides generally contain a sugar (such as ribose or deoxyribose), a base, and at least one phosphate group. Nucleotides may be abasic (i.e., lack a base). Nucleotides include deoxyribonucleotides, modified deoxyribonucleotides, ribonucleotides, modified ribonucleotides, peptide nucleotides, modified peptide nucleotides, modified phosphate sugar backbone nucleotides, and mixtures thereof. Examples of nucleotides include, for example, adenosine monophosphate (AMP), adenosine diphosphate (ADP), adenosine triphosphate (ATP), thymidine monophosphate (TMP), thymidine diphosphate (TDP), thymidine triphosphate (TTP), cytidylic acid (CMP), cytidylic acid diphosphate (CDP), cytidylic acid triphosphate (CTP), guanosine monophosphate (GMP), guanosine diphosphate (GDP), guanosine triphosphate (GTP), uridine monophosphate (UMP), uridine diphosphate (UDP), uridine triphosphate (UTP), deoxyadenosine monophosphate (dAMP), Deoxyadenosine diphosphate (dADP), deoxyadenosine triphosphate (dATP), deoxythymidine monophosphate (dTMP), deoxythymidine diphosphate (dTDP), deoxythymidine triphosphate (dTTP), deoxycytidine diphosphate (dCDP), deoxycytidine triphosphate (dCTP), deoxyguanosine monophosphate (dGMP), deoxyguanosine diphosphate (dGDP), deoxyguanosine triphosphate (dGTP), deoxyuridine monophosphate (dUMP), deoxyuridine diphosphate (dUDP) and deoxyuridine triphosphate (dUTP). Nucleotide analogs comprising modified bases can also be used in the methods described herein. Exemplary modified bases that can be included in polynucleotides, whether having a natural backbone or an analogous structure, include, for example, inosine, xathanine, hypoxathanine, isocytosine, isoguanine, 2-aminopurine, 5-methylcytosine, 5-hydroxymethylcytosine, 2-aminoadenine, 6-methyladenine, 6-methylguanine, 2-propylguanine, 2-propyladenine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 15-halouracil, 15-halocytosine, 5 ... -propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil, 4-thiouracil, 8-haloadenine or guanine, 8-aminoadenine or guanine, 8-thioadenine or guanine, 8-sulfanyladenine or guanine, 8-hydroxyadenine or guanine, 5-halogen-substituted uracil or cytosine, 7-methylguanine, 7-methyladenine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, etc. As is known in the art, certain nucleotide analogs cannot be incorporated into polynucleotides, for example, nucleotide analogs such as adenosine 5'-phosphosulfate.

[0063] As used herein, the term "nucleotide A" refers to a nucleotide containing adenine (A) or a modification or analog thereof, such as ATP, dATP. "Nucleotide G" refers to a nucleotide containing guanine (G) or a modification or analog thereof, such as GTP, dGTP. "Nucleotide C" refers to a nucleotide containing cytosine (C) or a modification or analog thereof, such as CTP, dCTP. "Nucleotide T" refers to a nucleotide containing thymine (T) or a modification or analog thereof, such as TTP, dTTP. "Nucleotide U" refers to a nucleotide containing uracil (U) or a modification or analog thereof, such as UTP, dUTP.

[0064] Nucleotide labeling

[0065] The present invention involves labeling nucleotides with chemiluminescent labels, thereby allowing different nucleotides to be distinguished.

[0066] As used herein, the term "chemiluminescent marker" refers to any compound that can be attached to a nucleotide, which can be contacted with a suitable substrate to trigger a chemiluminescent reaction, thereby generating a detectable light signal without the need for excitation light. In general, any component involved in a chemiluminescent reaction can be used as a chemiluminescent marker as described herein, and correspondingly, other components involved in a chemiluminescent reaction are referred to herein as substrates of the chemiluminescent marker. Examples of commonly used suitable chemiluminescent markers include, but are not limited to, peroxidase, alkaline phosphatase, luciferase, aequorin, functionalized iron-porphyrin derivatives, luminal, luminol, isoluminol, acridinium esters, sulfonamides, and the like. The substrate of the chemiluminescent marker will depend on the specific chemiluminescent marker used, for example, the substrate of alkaline phosphatase can be AMPPD (adamantyl 1,2-dioxane aromatic phosphate), the substrate of luciferase can be luciferin, and the substrate of acridinium ester can be sodium hydroxide and H 2 O 2 A mixture of, etc. For a detailed description of chemiluminescent labels and their corresponding substrates, see, for example, Larry J. Kricka, Chemiluminescent and Bioluminescent Techniques, CLIN.CHEM. 37 / 9, 1472-1481 (1991) and Tsuji, A. et al., eds. (2005) Bioluminescence and chemiluminescence: Progress and perspectives. World Scientific: [sl]. ISBN 978-981-256-118-3.596 pp.

[0067] In a preferred embodiment, the chemiluminescent label as used herein is a biochemiluminescent label.

[0068] As used herein, the term "biochemiluminescent marker" refers to any compound that can be attached to a nucleotide, which can be contacted with a suitable substrate to trigger a bioluminescent reaction, thereby producing a detectable light signal without the need for an excitation light. Bioluminescence is a type of chemiluminescence, which is light produced by a chemical reaction that occurs in vivo or in the secretions of certain types of organisms. Examples of biochemiluminescent markers can include, for example, luciferase, aequorin, glucose dehydrogenase, glucose oxidase, etc. The substrate of the biochemiluminescent marker will depend on the specific biochemiluminescent marker used, for example, the substrate of luciferase can be luciferin, and the substrate of aequorin can be calcium ions. For detailed descriptions of biochemiluminescent markers and their corresponding substrates, see, for example, Larry J. Kricka, Chemiluminescent and Bioluminescent Techniques, CLIN.CHEM. 37 / 9, 1472-1481 (1991) and Tsuji, A. et al., eds. (2005) Bioluminescence and chemiluminescence: Progress and perspectives. World Scientific: [sl]. ISBN 978-981-256-118-3.596 pp.

[0069] In preferred embodiments, the biochemiluminescent marker as used herein is a luciferase. In specific embodiments, the luciferase is selected from Gaussia luciferase, Renilla luciferase, dinoflagellate luciferase, firefly luciferase, fungal luciferase, bacterial luciferase and vargula luciferase.

[0070] As used herein, "labeling nucleotides with chemiluminescent markers" means attaching chemiluminescent markers to nucleotides. The specific manner in which chemiluminescent markers are attached to nucleotides is known to those skilled in the art, for example, as described in the following documents (all incorporated herein by reference): Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd edition (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989), Chapter 10; U.S. Patent Nos. 4,581,333, 5,283,174, 5,547,842, 5,656,207 and 5,658,737. In one embodiment, chemiluminescent markers can be directly attached to nucleotides by covalent bonds. In another embodiment, chemiluminescent markers can be attached to nucleotides by linking groups.

[0071] In a preferred embodiment, the chemiluminescent marker is attached to the nucleotide by an affinity interaction. As is well known to those skilled in the art, "affinity interaction" generally refers to a specific interaction between a biomolecule (e.g., a protein molecule, such as an enzyme, an antibody) and a substance that it specifically recognizes. Affinity interactions can include, for example, antigen-antibody interactions and biotin-avidin (e.g., streptavidin) interactions. Examples of antigen-antibody interactions can be, for example, digoxin-anti-digoxin antibody interactions.

[0072] In embodiments utilizing affinity interactions, a chemiluminescent label may be linked to one of the members participating in the affinity interaction, and a nucleotide may be linked to the other member participating in the affinity interaction, thereby attaching the chemiluminescent label to the nucleotide via the affinity interaction between the members.

[0073] In an exemplary embodiment utilizing the digoxin-anti-digoxin antibody interaction, digoxin can be linked to a nucleotide and a chemiluminescent label can be linked to the anti-digoxin antibody, thereby attaching the chemiluminescent label to the nucleotide via the digoxin-anti-digoxin antibody interaction.

[0074] In the exemplary embodiment utilizing biotin-avidin (e.g., streptavidin) interaction, biotin can be connected to nucleotides, and chemiluminescent markers are connected to avidin (e.g., streptavidin), so that chemiluminescent markers are attached to nucleotides by biotin-avidin (e.g., streptavidin) interactions. In another embodiment, the invention still further relates to the multiple labeling of nucleotides, i.e., more than one chemiluminescent marker is attached to the same nucleotide. In a preferred embodiment, more than one chemiluminescent marker is attached to the same nucleotide by different affinity interactions. This can be, for example, by simultaneously connecting members participating in different affinity interactions to nucleotides, and different chemiluminescent markers to be attached to nucleotides are connected to other members participating in the different affinity interactions respectively, so that more than one chemiluminescent marker is attached to nucleotides by the different affinity interactions. In a preferred embodiment, two different chemiluminescent markers are attached to the same nucleotide by different affinity interactions.

[0075] In an exemplary embodiment in which two different chemiluminescent labels are attached to a nucleotide, the nucleotide can be simultaneously linked to one of the members participating in the first affinity interaction and one of the members participating in the second affinity interaction, and the first chemiluminescent label is linked to the other member participating in the first affinity interaction, and the second chemiluminescent label is linked to the other member participating in the first affinity interaction, thereby attaching the first chemiluminescent label and the second chemiluminescent label to the nucleotide through the first affinity interaction and the second affinity interaction.

[0076] In one embodiment, the first affinity interaction is a digoxin-anti-digoxin antibody interaction, and the second affinity interaction is a biotin-avidin (e.g., streptavidin) interaction. In a specific embodiment, the nucleotide can be simultaneously linked to digoxin and biotin, and the first chemiluminescent label is linked to the anti-digoxin antibody, and the second chemiluminescent label is linked to avidin (e.g., streptavidin), thereby attaching the first chemiluminescent label and the second chemiluminescent label to the nucleotide via the digoxin-anti-digoxin antibody interaction and the biotin-avidin (e.g., streptavidin) interaction.

[0077] In another specific embodiment, the nucleotides can be simultaneously linked to digoxigenin and biotin, and the first chemiluminescent label can be linked to an anti-digoxigenin antibody, and the second chemiluminescent label can be linked to avidin (e.g., streptavidin), so that the first chemiluminescent label and the second chemiluminescent label are attached to the nucleotides through the digoxigenin-anti-digoxigenin antibody interaction and the biotin-avidin (e.g., streptavidin) interaction.

[0078] In addition, a chemiluminescent label can also be attached to a nucleotide by combining different affinity interactions. In an exemplary embodiment, the nucleotide can be attached to one of the members participating in the first affinity interaction, one of the members participating in the second affinity interaction can be attached to the other members participating in the first affinity interaction, and the chemiluminescent label can be attached to the other members participating in the second affinity interaction, thereby attaching the chemiluminescent label to the nucleotide through the first affinity interaction and the second affinity interaction.

[0079] In a specific embodiment, the chemiluminescent label can be attached to the nucleotide via the digoxigenin-anti-digoxigenin antibody interaction and the biotin-avidin (e.g., streptavidin) interaction, for example, by linking the nucleotide to digoxigenin, linking the biotin to the anti-digoxigenin antibody, and linking the chemiluminescent label to avidin (e.g., streptavidin).

[0080] As used herein, the "connection" between a chemiluminescent marker or nucleotide and a member participating in an affinity interaction can be any suitable form of connection known in the art. Such a connection can include, for example, a direct connection or an indirect connection, such as a connection via a linker, and can also include, for example, a non-covalent connection (such as a connection mediated by a hydrogen bond, an affinity interaction, etc.) and a covalent connection, and can also, for example, form a recombinantly expressed fusion protein to achieve such a connection.

[0081] Luminescence Kinetics of Chemiluminescent Reaction

[0082] The present invention relates to detecting nucleotides labeled with a chemiluminescent marker by detecting the luminescence kinetics of a chemiluminescent reaction in which the chemiluminescent marker participates.

[0083] As used herein, "luminescence kinetics of a chemiluminescent reaction" refers to the characteristic spectrum of the intensity of light emitted by a chemiluminescent reaction over time. This can be characterized, for example, by plotting a curve of the intensity of light emitted by a chemiluminescent reaction over time.

[0084] In the prior art, different chemiluminescent markers are usually detected and distinguished by detecting the light emitted by the chemiluminescent reaction at a specific wavelength. However, the inventors have found that the luminescence kinetics of the chemiluminescent reaction can also be used to detect and distinguish different chemiluminescent markers. Such different chemiluminescent markers each induce different luminescence kinetics. As used herein, "inducing" different luminescence kinetics means that the light emitted by the chemiluminescent reaction in which the chemiluminescent marker participates has different luminescence kinetics.

[0085] Such a detection method of the present invention is advantageous because chemiluminescent labels that emit light at similar wavelengths but have different luminescence kinetics can be distinguished.

[0086] Therefore, in a specific embodiment, the present invention relates to a method for identifying nucleotides, which comprises labeling nucleotides with chemiluminescent markers that induce different luminescence kinetics, and detecting the luminescence kinetics of the chemiluminescent reaction in which the chemiluminescent marker participates. The present invention also relates to nucleotides labeled with chemiluminescent markers that induce different luminescence kinetics.

[0087] Therefore, in a specific embodiment, the first nucleotide can be labeled with a first chemiluminescent marker that induces a first luminescence kinetic, the second nucleotide can be labeled with a second chemiluminescent marker that induces a second luminescence kinetic, and the third nucleotide can be labeled with a third chemiluminescent marker that induces a third luminescence kinetic, and the fourth nucleotide is not labeled at all, so that the four nucleotides can be identified by detecting the luminescence kinetics of each of the chemiluminescent markers.

[0088] In another embodiment, the present invention also relates to multiple labeling nucleotides with a combination of chemiluminescent labels that induce different luminescence kinetics. For example, chemiluminescent labels that induce different luminescence kinetics can be attached to the same nucleotide by different affinity interactions as described above. Such a technical solution is advantageous because a combination of chemiluminescent labels that induce different luminescence kinetics will induce luminescence kinetics different from the luminescence kinetics caused by each chemiluminescent label in the combination, thereby reducing costs.

[0089] In a specific embodiment, the present invention relates to dual labeling of nucleotides with a combination of two chemiluminescent labels that induce different luminescence kinetics. In a specific embodiment, a first nucleotide can be labeled with a first chemiluminescent label that induces a first luminescence kinetic, a second nucleotide can be labeled with a second chemiluminescent label that induces a second luminescence kinetic, and a third nucleotide can be dually labeled with the first chemiluminescent label and the second chemiluminescent label, and the fourth nucleotide is not labeled at all, so that the four nucleotides can be identified by detecting the luminescence kinetics of each of the chemiluminescent labels, wherein the dual labeling of the first chemiluminescent label and the second chemiluminescent label can induce luminescence kinetics that are different from the first luminescence kinetics and the second luminescence kinetics.

[0090] In a preferred embodiment, the nucleotides are selected from the group consisting of nucleotides A, G, C and T / U.

[0091] Types of luminescence in chemiluminescent reactions

[0092] In a further embodiment, the present invention relates to detecting a nucleotide labeled with a chemiluminescent marker by detecting the type of luminescence of a chemiluminescent reaction in which the chemiluminescent marker participates.

[0093] As used herein, "luminescence type of chemiluminescent reaction" is divided according to the duration of the light emitted by the chemiluminescent reaction, which generally includes a flash type and a glow type. The luminescence time of the flash type is within a few seconds, such as the acridinium ester system. The luminescence time of the glow type is from a few minutes to more than tens of minutes, such as the horseradish peroxidase-luminol system, the alkaline phosphatase-AMPPD system, the xanthine oxidase-luminol system, etc. In the present invention, the luminescence type between the flash type and the glow type is also referred to as a mixed type. The mixed type of luminescence is usually produced by mixing the luminescence of the flash type and the luminescence of the glow type together. For example, when a chemiluminescent marker that triggers a flash type is mixed with a chemiluminescent marker that triggers a glow type and simultaneously contacts and emits light with its substrate, a mixed luminescence column type between the flash type and the glow type is generated. Typical examples of luminescence characteristic spectra of flash type, glow type and mixed type are shown by Figure 1 shown.

[0094] Detecting chemiluminescent markers by detecting the luminescence type of the chemiluminescent reaction is advantageous because chemiluminescent markers with similar luminescence kinetics but significantly different luminescence types can be distinguished. Such detection is also particularly suitable for detecting multiple labels of chemiluminescent markers, because the combination of chemiluminescent markers with different luminescence types can result in a luminescence type that is significantly different from that of a single chemiluminescent marker.

[0095] Therefore, in a specific embodiment, the present invention relates to a method for identifying nucleotides, which comprises labeling nucleotides with chemiluminescent markers that induce different luminescence types, and detecting the luminescence type of the chemiluminescent reaction in which the chemiluminescent marker participates. The present invention also relates to nucleotides labeled with chemiluminescent markers that induce different luminescence types.

[0096] In a specific embodiment, the first nucleotide can be labeled with a first chemiluminescent marker that induces a first luminescence type, the second nucleotide can be labeled with a second chemiluminescent marker that induces a second luminescence type, and the third nucleotide can be dual-labeled with the first chemiluminescent marker and the second chemiluminescent marker, and the fourth nucleotide is not labeled at all, so that the four nucleotides can be identified by detecting the respective luminescence types of the chemiluminescent markers, wherein the dual labeling of the first chemiluminescent marker and the second chemiluminescent marker can induce a luminescence type different from the first luminescence type and the second luminescence type.

[0097] In a specific embodiment, the first luminescent type is a flash type, and the second luminescent type is a glow type. In a specific embodiment, the luminescent type caused by the dual labeling of the first chemiluminescent marker and the second chemiluminescent marker is between the first luminescent type (e.g., flash type) and the second luminescent type (e.g., glow type), which is referred to as a mixed type herein.

[0098] In a preferred embodiment, the nucleotides are selected from the group consisting of nucleotides A, G, C and T / U.

[0099] Polynucleotide Sequencing

[0100] The nucleotides labeled with chemiluminescent markers that induce different luminescence dynamics and the nucleotides labeled with chemiluminescent markers that induce different luminescence types of the present invention can be used in various nucleic acid sequencing methods. Preferably, the nucleotides labeled with chemiluminescent markers that induce different luminescence dynamics and the nucleotides labeled with chemiluminescent markers that induce different luminescence types of the present invention are suitable for synthesis sequencing. Synthesis sequencing as used herein is various synthesis sequencing methods well known in the art. Basically, synthesis sequencing involves first hybridizing the nucleic acid molecule to be sequenced with a sequencing primer, and then polymerizing the labeled nucleotides as described herein at the 3' end of the sequencing primer with the nucleic acid molecule to be sequenced as a template in the presence of a polymerase. After polymerization, the labeled nucleotides are identified by detecting the label. After removing the label (i.e., the chemiluminescent label as described herein) from the labeled nucleotides, the next polymerization sequencing cycle is started.

[0101] In addition, the nucleic acid sequencing method can also be performed using the nucleotides described herein by the method disclosed in US Pat. No. 5,302,509.

[0102] The method for determining the target polynucleotide sequence can be carried out by denaturing the target polynucleotide sequence, contacting the target single-stranded polynucleotide with different nucleotides respectively to form the complement of the target nucleotide, and detecting the incorporation of the nucleotide. The method utilizes polymerization, so that the polymerase extends the complementary chain by incorporating the correct nucleotide complementary to the target. The polymerization reaction also requires special primers to initiate polymerization.

[0103] For each round of reaction, the incorporation of the labeled nucleotide is carried out by a polymerase, and the incorporation event is subsequently determined. There are many different polymerases, and it is easy for a person of ordinary skill in the art to determine the most suitable polymerase. Preferred enzymes include DNA polymerase I, Klenow fragment, DNA polymerase III, T4 or T7 DNA polymerase, Taq polymerase or vent polymerase. Polymerases engineered to have specific properties can also be used.

[0104] The sequencing method is preferably performed on target polynucleotides arranged on a solid support. A plurality of target polynucleotides may be immobilized on the solid support via a linker molecule, or may be attached to particles such as microspheres, which may also be attached to a solid support material.

[0105] The polynucleotide can be connected to the solid support by a variety of methods, including the use of biotin-streptavidin interaction. Methods for fixing polynucleotides on solid supports are well known in the art, and include lithographic techniques and spotting each polynucleotide on a specific position of a solid support. Suitable solid supports are well known in the art, and include glass slides and beads, ceramic and silicon surfaces and plastic materials. The support is generally a plane, although microbeads (microspheres) can also be used, and the latter can also be connected to other solid supports by known methods. The microspheres can have any suitable size, and their diameter is generally 10-100 nanometers. In a preferred embodiment, the polynucleotide is directly connected to a plane, preferably to a flat glass surface. The connection is preferably carried out in the form of a covalent bond. The array used is preferably a single molecule array, which includes polynucleotides located in a unique optically resolvable region, such as described in International Application No. WO00 / 06770.

[0106] The necessary conditions for polymerization are well known to those skilled in the art. In order to carry out the polymerase reaction, it is usually necessary to first anneal the primer sequence to the target polynucleotide, which is recognized by the polymerase and serves as a starting point for the subsequent extension of the complementary chain. The primer sequence can be added as an independent component relative to the target polynucleotide. In addition, the primer and the target polynucleotide can be part of a single-stranded molecule, respectively, and an intramolecular duplex, i.e., a hairpin loop structure, is formed by the primer portion and a portion of the target. The structure can be fixed to the solid support at any site of the molecule. Other conditions necessary for carrying out the polymerase reaction are well known to those skilled in the art, and these conditions include temperature, pH, and buffer composition.

[0107] Subsequently, the labeled nucleotides of the invention are contacted with the target polynucleotide to enable polymerization. The nucleotides may be added sequentially, ie, each type of nucleotide (A, C, G or T / U) is added separately, or simultaneously.

[0108] The polymerization step is allowed to proceed for a time sufficient to incorporate one nucleotide.

[0109] Unincorporated nucleotides are then removed, for example, by subjecting the array to a washing step, and detection of incorporated label can then be performed.

[0110] Detection can be performed by conventional methods, for example, by contacting the synthesized nucleic acid with a corresponding substrate according to the specific chemiluminescent label carried by the nucleotide, and detecting the luminescence kinetics or luminescence type of the light emitted thereby.

[0111] After detection, the label can be removed using appropriate conditions.

[0112] The use of labeled Nucleotide of the present invention is not limited to DNA sequencing technology, and can also be implemented with Nucleotide of the present invention and comprise polynucleotide synthesis, DNA hybridization analysis, and other forms of single nucleotide polymorphism research.Relate to any technology of interaction between Nucleotide and enzyme, can utilize molecule of the present invention.For example, described molecule can be used as substrate of reverse transcriptase or terminal transferase.

[0113] In specific embodiments, the labeled nucleotides of the present invention also have a 3' protecting group. In some embodiments of the present invention, the protecting group and the chemiluminescent marker are usually two different groups on the 3' blocked labeled nucleotides, but in other embodiments, the protecting group and the chemiluminescent marker can also be the same group.

[0114] As used herein, the term "blocking group" means such a group, which prevents the polymerase (which incorporates the nucleotide containing the group into the polynucleotide chain being synthesized) from continuing to catalyze the incorporation of another nucleotide after the nucleotide containing the group is incorporated into the polynucleotide chain being synthesized. Such a blocking group is also referred to as a 3'-OH blocking group in this article. The nucleotide comprising such a blocking group is also referred to as the nucleotide of 3' blocking in this article. The blocking group can be any suitable group that can be added to the nucleotide, as long as the blocking group can prevent other nucleotide molecules from being added into the polynucleotide chain and is easy to remove from the sugar part of the nucleotide without destroying the polynucleotide chain. In addition, the nucleotide modified by the blocking group needs to tolerate polymerase or other suitable enzymes for incorporating the modified nucleotide into the polynucleotide chain. Therefore, the ideal blocking group shows long-term stability, can be efficiently incorporated by polymerase, prevents the secondary incorporation of nucleotide or further incorporation, and can be preferably removed under aqueous conditions without destroying the mild conditions of the polynucleotide structure.

[0115] The prior art has described a variety of protecting groups that meet the above description. For example, WO 91 / 06678 discloses that 3'-OH protecting groups include esters and ethers, -F, -NH 2 ,-OCH 3 ,-N 3 ,-OPO 3 ,-NHCOCH 3, 2-nitrophenyl carbonate, 2,4-sulfonyl dinitro and tetrahydrofuran ether. Metzker et al. (Nucleic Acids Research, 22 (20): 4259-4267, 1994) disclosed the synthesis and application of eight 3'-modified 2-deoxyribonucleoside 5'-triphosphates (3'-modified dNTPs). WO2002 / 029003 describes the use of allyl protecting groups to cap the 3'-OH group on the growing DNA chain in a polymerase reaction. Preferably, various protecting groups reported in International Application Publications WO2014139596 and WO2004 / 018497 can be used, including, for example, WO2014139596 Figure 1 Those protecting groups exemplified in A and those 3'hydroxy protecting groups (ie, protecting groups) defined in the claims, and for example those of WO2004 / 018497 Figure 3 and 4 The above references are all incorporated herein by reference in their entirety.

[0116] Those skilled in the art will understand how to attach a suitable protecting group to the ribose ring to block the interaction with the 3'-OH. The protecting group may be attached directly to the 3' position, or may be attached to the 2' position (where the protecting group has sufficient size or charge to block the interaction at the 3' position). Additionally, the protecting group may be attached to both the 3' and 2' positions and may be cleaved to expose the 3' OH group.

[0117] After successfully incorporating 3' blocked nucleotides into the nucleic acid chain, the sequencing protocol requires the removal of the protecting group to generate an available 3'-OH site for continuous chain synthesis. As used herein, the reagents that can remove the protecting group from the modified nucleotides depend to a large extent on the protecting group used. For example, the removal of the ester protecting group from the 3' hydroxyl functional group is usually achieved by alkaline hydrolysis. The ease of removing the protecting group varies greatly; generally, the greater the electronegativity of the substituent on the carbonyl carbon, the greater the ease of removal. For example, the highly electronegative trifluoroacetic acid group can be rapidly cleaved from the 3' hydroxyl in methanol at pH 7 (Cramer et al., 1963), so it is unstable during polymerization at this pH. The phenoxyacetic acid ester group cleaves in less than 1 minute, but requires significantly higher pH, such as with NH- / methanol (Reese and Steward, 1968). A variety of hydroxyl protecting groups can be selectively cut using chemical methods other than alkaline hydrolysis. 2,4-Dinitrophenylthio groups can be rapidly cleaved by treatment with nucleophiles such as thiophenol and thiosulfate (Letsinger et al., 1964). Allyl ethers are cleaved by treatment with Hg(II) in acetone / water (Gigg and Warren, 1968). Tetrahydrothiopyranyl ethers are removed under neutral conditions using Ag(I) or Hg(II) (Cohen and Steele, 1966; Cruse et al., 1978). Photochemical deblocking can be used with photochemically cleavable protecting groups. Several protecting groups can be used for this method. The use of o-nitrobenzyl ether as a protecting group for the 2'-hydroxy functionality of ribonucleosides is known and demonstrated (Ohtsuka et al., 1978); it is removed by irradiation at 260 nm. Alkyl carbonate o-nitrobenzyl carbonate protecting groups are also removed by irradiation at pH 7 (Cama and Christensen, 1978). Enzymatic deblocking of the 3'-OH protecting group is also possible. T4 polynucleotide kinase has been shown to convert 3'-phosphate termini into 3'-hydroxy termini that can then be used as primers for DNA polymerase I (Henner et al., 1983). This 3'-phosphatase activity is used to remove the 3' protecting group of those dNTP analogs that contain phosphate as a protecting group.

[0118] Other reagents that can remove protecting groups from 3'-blocked nucleotides include, for example, phosphines (e.g., tris(hydroxymethyl)phosphine (THP)), which can, for example, remove azide-containing 3'-OH protecting groups from nucleotides (for this application of phosphines, see, for example, the description in WO2014139596, the entire contents of which are incorporated herein by reference). Other reagents that can remove protecting groups from 3'-blocked nucleotides also include, for example, corresponding reagents for removing 3'-allyl, 3,4-dimethoxybenzyloxymethyl or fluoromethoxymethyl as 3'-OH protecting groups as described on pages 114-116 of the specification of WO2004 / 018497.

[0119] In an embodiment of the invention, the chemiluminescent label is preferably removed together with the protecting group after detection.

[0120] In certain embodiments, the chemiluminescent label may be incorporated with a protecting group, thereby allowing it to be removed along with the protecting group after the 3' blocked nucleotide is incorporated into the nucleic acid strand. For example, a radioactive substance such as C 14 or P 32 Alternatively, the protective group may contain a group that does not fluoresce itself but can react fluorescently with other substances. For example, the protective group may contain a metal-binding ligand such as a carboxylic acid group that can react with added rare earth metal ions such as europium or terbium ions to produce a fluorescent substance.

[0121] In other embodiments, chemiluminescent label can utilize linking group and blocking group to be connected on nucleotide separately.Such chemiluminescent label can for example be connected on the purine or pyrimidine base of nucleotide.In certain embodiments, used linking group is cleavable.The use of cleavable linking group can ensure that described mark can be removed after detection, and this avoids any signal interference with any labeled nucleotide of subsequent incorporation.In other embodiments, can use non-cleavable linking group, because after labeled nucleotide is incorporated into nucleic acid chain, do not need subsequent nucleotide to incorporate, therefore do not need to remove mark from nucleotide.

[0122] In other embodiments, the chemiluminescent label and / or linker group may have a size or structure sufficient to act as a barrier to the incorporation of other nucleotides into the polynucleotide chain (that is, the label itself may serve as a protecting group). The barrier may be due to steric hindrance, or may be due to a combination of size, charge, and structure.

[0123] Cleavable linking groups are well known in the art and conventional chemical methods can be used to attach the linking group to the nucleotide base and the chemiluminescent label. The linking group can be attached to any position of the nucleotide base, provided that Watson-Crick base pairing can still be performed. For purine bases, it will be preferred if the linking group is attached through the 7 position of the purine or the preferred deazapurine analog, through an 8-modified purine, through an N-6 modified adenine or an N-2 modified guanine. For pyrimidines, the attachment is preferably through the 5 position on cytosine, thymine and uracil and the N-4 position on cytidine.

[0124] The use of the term "cleavable linking group" does not imply that the entire linking group needs to be removed (e.g., removed from a nucleotide base). When a chemiluminescent label is attached to a base, the nucleoside cleavage site can be located at a position on the linking group that ensures that a portion of the linking group remains attached to the nucleotide base after cleavage.

[0125] Suitable linking groups include, but are not limited to, disulfide linking groups, acid-labile linking groups (including dialkoxybenzyl linking groups, Sieber linking groups, indole linking groups, tert-butyl Sieber linking groups), electrophilic cleavable linking groups, nucleophilic cleavable linking groups, photocleavable linking groups, linking groups that cleave under reducing conditions, oxidative conditions, safety-catch linking groups, and linking groups that cleave by an elimination mechanism. Suitable linking groups can be modified with standard chemical protecting groups, as disclosed in Greene & Wuts, Protective Groups in Organic Synthesis, John Wiley & Sons. Other suitable cleavable linking groups for solid phase synthesis are disclosed by Guillier et al. (Chem. Rev. 100: 2092-2157, 2000).

[0126] The linking group can be cleaved by any suitable method, including contact with an acid, a base, a nucleophile, an electrophile, a free radical, a metal, a reducing or oxidizing agent, light, temperature, an enzyme, etc., and suitable cleavage modes of various cleavable linking groups will be described exemplarily below. Generally, the cleavable linking group can be cleaved under the same conditions as the protecting group, so that only one treatment is required to remove the chemiluminescent label and the protecting group.

[0127] Electrophilic cleavage linking groups are typically cleaved by protons and include acid-sensitive cleavage. Suitable electrophilic cleavage linking groups include modified benzyl systems, such as trityl, p-hydrocarbyloxybenzyl esters and p-hydrocarbyloxybenzyl amides. Other suitable linking groups include tert-butyloxycarbonyl (Boc) groups and acetal systems. For the preparation of suitable linking molecules, it is also possible to consider using sulfur-philic metals such as nickel, silver or mercury in the cleavage of thioacetal or other sulfur-containing protecting groups. Nucleophilic cleavage linking groups include unstable groups in water (i.e., can be simply cleaved at alkaline pH values), such as esters, and groups that are unstable to non-aqueous nucleophiles. Fluoride ions can be used to cleave silicon-oxygen bonds in groups such as triisopropylsilane (TIPS) or tert-butyldimethylsilane (TBDMS). Photolytic linking groups are widely used in sugar chemistry. Preferably, the light required for activation cleavage does not affect other components in the modified nucleotides. For example, if a fluorophore is used as a label, preferably, the fluorophore absorbs light of a different wavelength from the light required for the cleavage linking molecule. Suitable linking groups include those based on O-nitrobenzyl compounds and nitrovarachyl compounds. Linking groups based on benzoin chemistry can also be used (Lee et al., J.Org.Chem.64:3454-3460,1999). A variety of linking groups that are sensitive to reduction cleavage are known. Catalytic hydrogenation based on palladium catalysts has been used to cleave benzyl and benzyloxycarbonyl groups. Disulfide bond reduction is also known in the art. Oxidation-based methods are well known in the art. These methods include oxidation of alkoxybenzyl and oxidation of sulfur and selenium linking groups. Using iodine solution (aqueous iodine) to cleave disulfides and other sulfur- or selenium-based linking groups is also within the scope of the present invention. Safety-catch linkers are those linking groups that are cleaved in two steps. In a preferred system, the first step is the generation of a reactive nucleophilic center, and the subsequent second step involves intramolecular cyclization, which leads to cleavage. For example, the levulinate ester linkage can be treated with hydrazine or photochemical methods to release the active amine, which is then cyclized to cleave esters elsewhere in the molecule (Burgess et al., J. Org. Chem. 62:5165-5168, 1997). Elimination reactions can also be used to cleave the linking group. Base-catalyzed elimination of groups such as fluorenylmethoxycarbonyl and cyanoethyl and palladium-catalyzed reduction elimination of allyl systems can be used.

[0128] In certain embodiments, the linker may comprise a spacer unit. The length of the linker is not critical, as long as the chemiluminescent label is kept at a sufficient distance from the nucleotide so as not to interfere with the interaction between the nucleotide and the enzyme.

[0129] In certain embodiments, the linking group may consist of a functional group similar to the 3'-OH protecting group. This would require only a single treatment to remove the chemiluminescent label and the protecting group. A particularly preferred linking group is an azide-containing linking group that can be cleaved by a phosphine.

[0130] As used herein, the reagents that can remove the chemiluminescent label from the modified nucleotides depend largely on the chemiluminescent label used. For example, in the case where the chemiluminescent label is incorporated with a protecting group, the chemiluminescent label is removed using the reagents described above for removing the protecting group. Alternatively, when the chemiluminescent label is connected to the base of the nucleotide via a cleavable linking group, the chemiluminescent label is removed using the reagents for cleaving the linking group as described above. In a preferred embodiment, the same reagent is used to remove the chemiluminescent label and the protecting group from the modified nucleotides, for example, in the case where the linking group is composed of a functional group similar to the 3'-OH protecting group.

[0131] An exemplary embodiment of the present invention

[0132] In a specific embodiment, the present invention relates to a method for distinguishing four nucleotides by using different luminescence types (flash and glow) to achieve gene sequencing. This method does not require an additional excitation light source and can meet the development of low-cost portable sequencers. In this method, the characteristics of two different luciferases and their substrates producing different luminescence forms are utilized to distinguish different nucleotides according to different luminescence curves. The luciferase sources include but are not limited to fireflies, gaussia, Renilla and other organisms. The luciferase can be connected to four deoxynucleotide derivatives in an affinity interaction manner.

[0133] In a more specific embodiment, the present invention relates to a method for determining the sequence of a target single-stranded polynucleotide, comprising

[0134] (a) providing four nucleotides, wherein a first nucleotide is attached to a first luciferase, a second nucleotide is attached to a second luciferase, a third nucleotide is attached to both the first luciferase and the second luciferase, and a fourth nucleotide is not attached to any luciferase, wherein the first luciferase and the second luciferase exhibit different luminescence kinetics or luminescence types when reacting with their substrates; in a preferred embodiment, the substrates of the first luciferase and the second luciferase are the same, for example, selected from coelenterazine;

[0135] (b) incorporating a nucleotide into the complementary strand of the target single-stranded polynucleotide;

[0136] (c) detecting the chemiluminescent label of the nucleotide of (b) to determine the type of incorporated nucleotide;

[0137] (d) removing the chemiluminescent label of the nucleotide of (b); and

[0138] (e) optionally repeating steps (b)-(d) one or more times to determine the sequence of the target single-stranded polynucleotide. Example

[0139] 1. Sequencing library construction

[0140] (1) Design the following DNA sequence: GATATCTGCAGGCAT AGAATGAATATTATTGAATCAATAATTAAAGTCGGAGGCCAAGCGGTCTTAGGAAGACAAACTAGTACGTCAACTCCTTGGCTCACAGAACGACATGGCTACGATCCGACTTTACAACTACGATAATGGGCTGGATACATGGAATGATTATAGATATATTAAGGAATAATGTTAATTAATGCCTAAATTAATTAATCTAAGGGGGTTAATACT TCAGCCTGTGATATC For the convenience of library construction, the same oligonucleotide sequences were added at both ends of the sequence, as shown in the underlined fonts, and the BGI-SEQ500 linker sequence was inserted in the middle, as shown in the italicized sequence. The above sequence was sent to GenScript Biotech for synthesis. For unlimited use of the sequence, the synthesized sequence was inserted into the pUC57 vector and transformed into Escherichia coli.

[0141] (2) Culture an appropriate amount of E. coli containing a known library, extract the plasmid, design the following pair of primers: GATATCTGCAGGCAT, GATATCACAGGCTGA, amplify the known sequence according to the following system (Table 1) and process (Table 2), and purify the PCR product using magnetic beads. Add split oligo (ATGCCTGCAGATATCGATATCACAGGCTGA) to the purified PCR product and perform circularization library construction according to the BGIseq-500SE50 circularization library construction kit and process, and set aside;

[0142] Table 1 (Enzymes from BGI)

[0143]

[0144] Table 2:

[0145]

[0146] 2. Amplification of library sequences

[0147] Purchase a streptavidin-coated 96-well plate from Thermo Fisher, incubate 100ul 1uM 5'-end biotin-modified primer (RCA) GCCATGTCGTTCTGTGAGCCAAGG with one of the wells at room temperature for 30min, remove the reaction liquid, add 6ng of the library constructed in Example 1 and 20ul of DNB preparation buffer I in the BGISEQ-500 kit, perform primer hybridization with the above biotin-modified primer at 60°C for 5min, add 40ul of DNB polymerase I and 4ul of DNB polymerase II in the BGISEQ-500 sequencing kit, react at 30°C for 60min, heat to 65°C to terminate the reaction, and carefully remove the reaction solution. Add 100ul 5uM sequencing primer GCTCAGAACGACATGGCTACGATCCGACTT, hybridize at room temperature for 30min, and carefully remove the reaction solution;

[0148] 3. Sequencing

[0149] (1) Acme Bioscience outsourced the synthesis of the following four dNTPs:

[0150]

[0151]

[0152] (2) Reagent preparation:

[0153] Prepare the following reagents needed for sequencing reaction

[0154] Polymerization reaction solution: 50mM Tris-HCl, 50mM NaCl, 10mM (NH4) 2 SO 4 , 0.02 mg / ml polymerase BG9 (BGI), 3 mM MgSO 4 , 1mM EDTA, 1uM each of the above four dNTPs;

[0155] Polymerization buffer: 50 mM Tris-HCl, 50 mM NaCl, Tween20 0.05%;

[0156] Elution buffer: 5XSSC, Tween20 0.05%;

[0157] Antibody reaction solution: TBST buffer, 1uM anti-digoxigenin-ss-biotin (Abcam);

[0158] Antibody elution buffer: TBST buffer

[0159] Luminescent enzyme reaction solution 1: TBST buffer, 2ug / ml SA-gluc(M2)-glow(avidity);

[0160] Self-luminescent enzyme reaction solution 2: TBST buffer, 2ug / ml SA-gluc(8990)-flash(avidity)

[0161] Substrate luminescent solution: prepare 50mM tris-HCl 0.5mM NaCl buffer and dilute 50X Coelenterazine (nonolight) to 1X;

[0162] Excision buffer: 20 mM THPP, 0.5 M NaCl, 0.05% tween20;

[0163] (3) Sequencing reaction:

[0164] Sequencing process Figure 2 shown.

[0165] a. Polymerization: Add 100ul of polymerase reaction solution to the well where the library was amplified in (1), raise the temperature of the microplate reader to 55°C, and react for 3 minutes to allow the four dNTPs to polymerize onto the amplified temperature control. Carefully remove the reaction solution, add 100ul of elution reaction solution, and gently blow several times to remove the elution reaction solution.

[0166] b. Binding of self-luminescent enzyme 1: Add 100ul of self-luminescent enzyme reaction solution 1, incubate at 35°C for 30 minutes to allow SA-gluc(M2)-glow to bind to dNTP-biotin, remove the reaction solution, add eluent, gently pipette several times, and remove the eluent;

[0167] c. Binding of self-luminescent enzyme 2: add 100ul antibody reaction solution, incubate at 35℃ for 3min to allow anti-digoxigenin-ss-biotin to bind to dNTP-digoxigenin, remove the reaction solution, add 200ul antibody elution solution, gently blow several times, and remove the antibody elution solution; add 100ul self-luminescent enzyme 2 reaction solution, react at 35℃ for 2min, allow SA-gluc(8990)-flash to bind to dNTP-digoxigenin by binding to anti-digoxigenin-ss-biotin, and remove the reaction solution; add 200ul elution solution, gently blow several times, and remove the elution solution;

[0168] d. Spontaneous luminescence detection: set the parameters of the microplate reader, add the substrate luminescent liquid, and detect the spontaneous luminescence curve; read the corresponding base according to the signal curve;

[0169] e. Excision; remove the self-luminescent reaction solution, add 200ul elution buffer, gently blow several times, remove the elution buffer, add 100ul excision reaction solution, react at 55℃ for 3min, remove the excision reaction solution; add 200ul elution buffer for washing, repeat washing three times;

[0170] f. Repeat steps ae to proceed to the next cycle of sequencing;

[0171] (4) Sequencing results

[0172] a.10bp sequencing signal curve is as follows Figure 3 and Figure 4 As shown:

[0173] b. Analysis of sequencing results:

[0174] Comparing the signal change curves of all cycles, as shown in the figure below, we can judge based on the form of signal decline in each cycle:

[0175] Nucleotide A: cycle 1, cycle 4, cycle 5, cycle 8;

[0176] Nucleotide T: Cycle 2, Cycle 7

[0177] Nucleotide C: Cycle 3, Cycle 6, Cycle 9

[0178] Nucleotide G: Cycle 10

[0179] It matches the first 10bp base sequence of the library to be tested: TACAACTACG.

Claims

1. A method for determining the sequence of a target single-stranded polynucleotide, comprising: (1) incorporating nucleotides into the complementary strand of the target single-stranded polynucleotide; (2) attaching each of the nucleotides to a different chemiluminescent label; (3) Detecting the luminescence kinetics of the chemiluminescent reaction in which the chemiluminescent marker participates: A) if the luminescence kinetics is the first luminescence kinetics, identifying the nucleotide as the first nucleotide, B) if the luminescence kinetics is the second luminescence kinetics, identifying the nucleotide as the second nucleotide, C) if the luminescence kinetics is the third luminescence kinetics, identifying the nucleotide as the third nucleotide, D) if there is no luminescence kinetics, identifying the nucleotide as a fourth nucleotide, Wherein, the luminescence kinetics is a characteristic spectrum of the intensity of the light emitted by the chemiluminescent reaction changing with time, and the characteristic spectrum of the first luminescence kinetics, the characteristic spectrum of the second luminescence kinetics and the characteristic spectrum of the third luminescence kinetics are different from each other; (4) Identify the type of each incorporated nucleotide based on the luminescence kinetics.

2. The method according to claim 1, wherein: The first nucleotide is attached to a first chemiluminescent label, which elicits first luminescence kinetics; The second nucleotide is attached to a second chemiluminescent label, which elicits second luminescence kinetics; The third nucleotide is attached to a third chemiluminescent label, the third chemiluminescent label eliciting third luminescence kinetics; The fourth nucleotide does not have a chemiluminescent label attached.

3. The method according to claim 1, wherein: The first nucleotide is attached to a first chemiluminescent label, which elicits first luminescence kinetics; The second nucleotide is attached to a second chemiluminescent label, which elicits second luminescence kinetics; the third nucleotide is attached to both the first chemiluminescent label and the second chemiluminescent label, and the attachment of both the first chemiluminescent label and the second chemiluminescent label induces a third luminescence kinetic; The fourth nucleotide does not have a chemiluminescent label attached.

4. The method according to any one of claims 1 to 3, wherein: The first luminescence dynamics is of a flash type, the second luminescence dynamics is of a glow type, and the third luminescence dynamics is of a mixed type.

5. The method according to claim 1, wherein: The attachment between the nucleotide and the chemiluminescent label comprises attachment mediated by affinity interactions.

6. The method according to claim 5, wherein: The affinity interactions include antigen-antibody interactions and biotin-avidin interactions.

7. The method according to claim 1, further comprising: (5) Modifying or removing the protecting group of the incorporated nucleotide so as to expose the 3'-OH group, wherein the ribose or deoxyribose moiety of each of the nucleotides comprises the protecting group attached via the 2' or 3' oxygen atom.

8. The method according to claim 1 or 7, further comprising: (6) Removal of the chemiluminescent label attached to the incorporated nucleotide.

9. The method of claim 8, wherein the chemiluminescent label and the protecting group are removed simultaneously.

10. The method according to claim 8 or 9, optionally repeating steps (1) to (6) one or more times to determine the sequence of the target single-stranded polynucleotide.

11. The method according to claim 1, wherein the detection of the luminescence kinetics of the chemiluminescent reaction in which the chemiluminescent marker participates comprises contacting the chemiluminescent marker with a suitable substrate to trigger the chemiluminescent reaction, and detecting the luminescence kinetics of the light emitted thereby, wherein The chemiluminescent marker is selected from biochemiluminescent markers that induce different luminescence dynamics and any combination thereof, or The chemiluminescent marker is selected from luciferases that induce different luminescence kinetics and any combination thereof, or The chemiluminescent label is a combination of two luciferases that elicit different luminescence kinetics.

12. The method of claim 2, wherein among the nucleotides, a first nucleotide is attached to a first luciferase, a second nucleotide is attached to a second luciferase, a third nucleotide is attached to both the first luciferase and the second luciferase, and a fourth nucleotide is not attached to a luciferase.

13. The method according to claim 5, wherein the chemiluminescent label is attached to the nucleotide by affinity interaction between the members by linking the chemiluminescent label to one of the members participating in the affinity interaction and linking the nucleotide to the other member participating in the affinity interaction, or wherein the member linked to the nucleotide is biotin, and the member linked to the chemiluminescent label is avidin, or wherein the member linked to the nucleotide is digoxigenin, and the member linked to the chemiluminescent marker is an anti-digoxigenin antibody, or The member linked to the nucleotide is digoxigenin, and the member linked to the chemiluminescent marker is avidin, wherein digoxigenin and avidin are affinity-bound via an anti-digoxigenin antibody linked to biotin.

14. A kit for determining the sequence of a target single-stranded polynucleotide, comprising: (1) a target single-stranded polynucleotide, (2) one or more nucleotides selected from the group consisting of nucleotides A, G, C and T or U, (3) Chemiluminescent markers, in, The nucleotides are each attached to a different chemiluminescent label, the chemiluminescent label attached to each type of nucleotide exhibiting different luminescence kinetics when detected than the chemiluminescent labels attached to the other types of nucleotides; Wherein, the luminescence dynamics is the characteristic spectrum of the intensity of the light emitted by the chemiluminescent reaction changing with time; The first nucleotide is attached to a first chemiluminescent label, the second nucleotide is attached to a second chemiluminescent label, the third nucleotide is attached to a third chemiluminescent label, and the fourth nucleotide is not attached to a chemiluminescent label.

15. The kit according to claim 14, wherein the chemiluminescent label is attached to the nucleotide through an antigen-antibody or biotin-avidin affinity interaction. The kit according to claim 14 , wherein the target single-stranded polynucleotide is immobilized on a solid support.

17. The kit of claim 14, wherein the ribose or deoxyribose moiety of each of the nucleotides comprises a protecting group attached via the 2' or 3' oxygen atom.

18. The kit according to claim 14, comprising at least one of: (4) an enzyme and a buffer suitable for the enzyme to function; (5) a suitable substrate for reacting with the chemiluminescent marker; (6) Excision of the reaction solution, which removes the chemiluminescent label, and / or modifies or removes the protecting group to expose the 3'-OH group.

Images