Probes for nucleic acid detection and their applications

Abstract

This application relates to the field of nucleic acid detection technology, and particularly to a probe for nucleic acid detection and its application. The nucleotide sequence of the probe for nucleic acid detection provided by this application sequentially includes an induced ring-opening sequence, an upstream looping sequence, a loop sequence, a downstream looping sequence, and an anchoring and extending sequence from the 5'-end to the 3'-end; wherein, the upstream looping sequence and the downstream looping sequence are reverse complementary to each other, a first quenching group is connected to the 5'-end of the nucleotide sequence of the probe, a second quenching group is connected to the 3'-end of the nucleotide sequence of the probe, and a fluorescent group is connected upstream of the anchoring and extending sequence. The probe provided by this application can significantly reduce the background fluorescence value and improve the signal-to-noise ratio, thereby significantly improving the detection sensitivity of the fluorescence signal. Therefore, the probe provided by this application can be well used in nucleic acid detection and can be used to prepare nucleic acid detection-related products such as nucleic acid detection kits.

Description

Technical Field

[0001] This application belongs to the technical field of nucleic acid detection, and particularly relates to a probe for nucleic acid detection and its application. Background Art

[0002] Real-time fluorescence polymerase chain reaction (Real-time PCR) is a commonly used detection method in the field of nucleic acid detection, with simple operation and wide application. Taqman probe is a fluorescent probe widely used in real-time quantitative PCR. Its principle is to utilize the 5'-3' exonuclease activity of Taq DNA polymerase to hydrolyze the double-labeled probe during PCR amplification, releasing the reporter group to generate a fluorescent signal. However, it has the following problems: There is a certain distance between the fluorescent group and the quenching group of the Taqman probe (generally the total length from the 5' end to the 3' end of the probe), which easily leads to a relatively high background fluorescence value of the probe, resulting in a low signal-to-background ratio, and thus a decrease in the detection sensitivity of multiplex real-time PCR.

[0003] In order to improve the detection level of fluorescence real-time PCR signals, Sanjay Tyagi and Fred Russell Kramer pioneered the concept of molecular beacon in 1996. Its basic principle is to design two complementary pairing regions at the 5' end and 3' end of the Taqman probe, enabling the probe to form a hairpin structure. Through this special secondary structure, the probe presents a hairpin structure when not bound to the target, and the fluorescence is quenched, achieving a reduction in the background fluorescence value. However, the presence of the secondary structure increases the difficulty of the molecular beacon probe binding to the template, especially when the melting temperature (Tm) of the secondary structure is greater than the PCR annealing temperature; at the same time, the design requirements for molecular beacons are relatively high, requiring careful design of the hairpin structure, probe sequence, selection of fluorescent groups and quenching agents, etc., increasing the difficulty of use.

[0004] Multiplex detection is the development direction of nucleic acid detection. Probe melting curve analysis of PCR amplification products is an important technical means to achieve multiplex detection, and this requires a probe that can be compatible with the amplification curve analysis of fluorescence real-time PCR and the probe melting curve analysis. The Li Qingge research group at Xiamen University proposed a design scheme of mediator probe combined with molecular beacon structure reporter probe - melting array technology in 2022, which can perform fluorescence real-time PCR amplification curve analysis and probe melting curve analysis of amplification products successively. Although this method can improve the detection throughput, stability and specificity of a single PCR reaction, it cannot significantly reduce the amplification background signal of the fluorescence real-time PCR reaction, and the signal-to-noise ratio needs to be further improved. Summary of the Invention

[0005] The object of the present application is to provide a probe for nucleic acid detection and its application, aiming to solve the technical problem of how to provide a fluorescence reporting probe with a low background fluorescence value, a high signal-to-noise ratio, and high sensitivity.

[0006] To achieve the above application object, the technical solution adopted in the present application is as follows:

[0007] In the first aspect, the present application provides a probe for nucleic acid detection. The nucleotide sequence of the probe sequentially includes an induced ring-opening sequence, an upstream looping sequence, a loop sequence, a downstream looping sequence, and an anchoring and extending sequence from the 5'-end to the 3'-end; wherein, the upstream looping sequence and the downstream looping sequence are reverse complementary to each other. A first quenching group is connected to the 5'-end of the nucleotide sequence of the probe, a second quenching group is connected to the 3'-end of the nucleotide sequence of the probe, and a fluorescent group is connected upstream of the anchoring and extending sequence.

[0008] In the second aspect, the present application provides an application, that is, the application of the above probe provided by the present application in nucleic acid detection.

[0009] In the third aspect, the present application provides a nucleic acid detection kit, including the above probe provided by the present application and an intermediate probe.

[0010] The nucleotide sequence of the probe provided by the present application sequentially includes an induced ring-opening sequence, an upstream looping sequence, a loop sequence, a downstream looping sequence, and an anchoring and extending sequence from the 5'-end to the 3'-end; based on the hairpin structure formed by the upstream looping sequence, the loop sequence, and the downstream looping sequence of the probe of the present application, and combined with the fluorescent group and quenching group modified at specific positions, such a probe can be used as a fluorescence reporting probe. When used in combination with an intermediate probe (i.e., an oligonucleotide sequence that can bind to the target sequence and has no fluorescence modification) for real-time fluorescence PCR, compared with the commonly used Taqman probe and molecular beacon probe, it can significantly reduce the background fluorescence value, and the signal-to-noise ratio is improved, thereby significantly improving the detection sensitivity of the fluorescence signal. Therefore, the probe provided by the present application can be well used in nucleic acid detection and can be used to prepare nucleic acid detection-related products such as nucleic acid detection kits. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the following will briefly introduce the drawings required for use in the embodiments or the description of the prior art. Obviously, the following drawings are only some embodiments of the present application. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0012] Figure 1 is a schematic structural diagram of the probe provided by the embodiment of the present application;

[0013] Figure 2It is a feasibility analysis result diagram of the probe provided by the embodiment of the present application for reducing background fluorescence value and improving signal-to-noise ratio; A is the comparison of fluorescence PCR amplification curves between the experimental group using the KEY probe and the control group 1 using the common Taqman probe, the control group 2, and the control group 3, the control group 4, and the control group 5 using molecular beacon probes with weak, medium, and strong hairpin structures; B is the significant difference analysis of background fluorescence values between the experimental group and the control group; C is the significant difference analysis of signal-to-noise ratio between the experimental group and the control group; D is the comparison of Ct values between the experimental group and the control group at different template concentration levels;

[0014] Figure 3 It is a feasibility analysis result diagram of the probe provided by the embodiment of the present application for probe melting curve analysis;

[0015] Figure 4 It is a result diagram of the strength investigation of different hairpin structures of the probe provided by the embodiment of the present application;

[0016] Figure 5 It is a result diagram of the investigation of different induced open-loop sequence lengths of the probe provided by the embodiment of the present application;

[0017] Figure 6 It is a result diagram of the signal investigation of the probe provided by the embodiment of the present application in different fluorescence channels. Detailed implementation manners

[0018] In order to make the technical problems to be solved, technical solutions and beneficial effects of the present application clearer, the present application will be further described in detail below in conjunction with embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application.

[0019] In the present application, the term "and / or" describes the association relationship of associated objects and indicates that three relationships may exist. For example, A and / or B may represent: A exists alone, A and B exist simultaneously, and B exists alone. Wherein A and B may be singular or plural. The character " / " generally represents an "or" relationship between the associated objects before and after.

[0020] In the present application, "at least one" means one or more, and "a plurality" means two or more. "At least one of the following" or similar expressions refer to any combination of these items, including any combination of single item (s) or plural item (s).

[0021] It should be understood that in the embodiments of the present application, the magnitude of the serial numbers of the above processes does not mean the order of execution. Some or all steps may be executed in parallel or sequentially. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation to the implementation process of the embodiments of the present application.

[0022] The terms used in the embodiments of the present application are for the purpose of describing specific embodiments only and are not intended to limit the present application. The singular forms "a", "the" and "said" used in the embodiments of the present application and the appended claims are also intended to include the plural forms unless the context clearly indicates otherwise.

[0023] The weight of the relevant components mentioned in the specification of the embodiments of the present application not only can refer to the specific content of each component, but also can represent the proportional relationship of the weights between the components. Therefore, as long as the content of the relevant components in the specification of the embodiments of the present application is enlarged or reduced in proportion, it is within the scope disclosed in the specification of the embodiments of the present application. Specifically, the mass described in the specification of the embodiments of the present application can be mass units well-known in the chemical industry such as µg, mg, g, kg, etc.

[0024] The terms "first" and "second" are only used for descriptive purposes to distinguish objects such as substances from each other, and cannot be understood as indicating or implying relative importance or implicitly specifying the quantity of the indicated technical features. For example, without departing from the scope of the embodiments of the present application, the first XX can also be referred to as the second XX, and similarly, the second XX can also be referred to as the first XX. Thus, the features defined with "first" and "second" can explicitly or implicitly include one or more of such features.

[0025] In order to meet the high-sensitivity detection requirements of nucleic acid samples with low abundance and low concentration, and at the same time be compatible with amplification curve analysis and probe melting curve analysis, real-time fluorescence PCR urgently needs to introduce fluorescent probes with lower background fluorescence values, high signal-to-noise ratios, and high sensitivities. In view of the deficiencies of the prior art, the embodiments of the present application designed a probe with an ultra-low fluorescence background value and capable of improving the sensitivity of the detection system. The specific technical solution is as follows.

[0026] In a first aspect, the embodiments of the present application provide a probe for nucleic acid detection, which binds Figure 1 as shown. The probe provided by the embodiments of the present application includes a long nucleotide sequence. Specifically, the nucleotide sequence of the probe sequentially includes from the 5'-end to the 3'-end: ① an induced ring-opening sequence, whose function is to promote the opening of the probe's own hairpin structure when the cleavage sequence extends to this position; ② an upstream looping sequence, whose function is to complementarily pair with the downstream looping sequence; ③ a loop sequence, which forms a hairpin structure in combination with the complementarily paired upstream and downstream looping sequences; ④ a downstream looping sequence, whose function is to complementarily pair with the upstream looping sequence; ⑤ an anchoring extension sequence, which is used for mediating the anchoring and extension of the cleavage sequence.

[0027] In the probe structure provided above, the upstream loop-forming sequence and the downstream loop-forming sequence are reverse complementary paired, so that a hairpin structure can be formed with the loop sequence located therebetween. Meanwhile, a quenching group is connected to the 5'-end of the nucleotide sequence of the probe, i.e., the 5'-end of the loop-opening induction sequence. The 5'-end quenching group is the first quenching group. A quenching group is connected to the 3'-end of the nucleotide sequence of the probe, i.e., the 3'-end of the anchoring extension sequence. The 3'-end quenching group is the second quenching group. And a fluorescent group is connected to the upstream of the anchoring extension sequence. The upstream of the anchoring extension sequence means that the anchoring extension sequence is divided into two segments according to the number of bases. The segment closer to the 5'-end is the upstream, and the segment closer to the 3'-end is the downstream. And the fluorescent group is at the upstream of the anchoring extension sequence closer to the 5'-end.

[0028] In the probe provided by the embodiment of the present application, quenching groups are modified at both ends (i.e., the first quenching group at the 5'-end and the second quenching group at the 3'-end), and a fluorescent group is modified in the middle. Combining with the hairpin structure can reduce the distance between the first quenching group and the middle fluorescent group. When in use, a probe with an ultra-low background fluorescence value can be formed; the loop-opening induction sequence designed at the 5'-end of the probe helps the intermediate cleavage sequence to extend on the probe, open the hairpin structure, and improve the fluorescence signal level. In this way, when performing real-time fluorescence PCR, the background fluorescence value can be significantly reduced, and the signal-to-noise ratio is improved, thereby significantly improving the detection sensitivity of the fluorescence signal.

[0029] In some embodiments, the loop sequence of the probe is provided with a spacer modification. By introducing a spacer modification (Spacer) into the probe loop sequence, the extension of the intermediate cleavage sequence on the probe can be further terminated at a fixed point, so that the extension product forms a hairpin structure and does not bind to the reporter probe, improving the fluorescence signal intensity and realizing stable probe melting curve analysis.

[0030] For example, the spacer modification includes one or more Spacer 18, Spacer 9, Spacer C3 or Spacer C6 modifications. Taking the iSp18 modification as an example, iSp18 is the abbreviation of the middle-modified Spacer 18, and its full name is hexaethylene glycol phosphoramide (spacer phosphoramide 18). Through one or more of the above spacer modifications, the extension of the intermediate cleavage sequence on the reporter probe can be terminated, so as to obtain a stable melting temperature (Tm value) during the probe melting curve analysis. The spacer modification can be at any specific position on the loop sequence, and the above effects can be achieved.

[0031] In some embodiments, the anchoring extension sequence of the probe can also be provided with an iXNA modification, which is a kind of probe middle modification, and a synthetic nucleic acid analogue xeno nucleic acids (XNA) is modified on the base to enhance the binding force of the probe.

[0032] In some embodiments, the induced open-loop sequence has a length of 1 to 20 bases, such as 1 base, 4 bases, 6 bases, 8 bases, 9 bases, 10 bases, 12 bases, 15 bases, 18 bases, etc.; both the upstream loop-forming sequence and the downstream loop-forming sequence have a length of 4 to 20 bases, such as 4 bases, 6 bases, 8 bases, 10 bases, 12 bases, 14 bases, 16 bases, 18 bases, etc.; the loop sequence has a length of 3 to 10 bases, such as 3 bases, 5 bases, 6 bases, 8 bases, 10 bases, etc.; the anchored extension sequence has a length of 30 to 45 bases, and the distance between the fluorescent group and the second quenching group is at least 25 bases. Specifically, the above base numbers are some optional embodiments, and the lengths of the induced open-loop sequence, the upstream loop-forming sequence, the loop sequence, the downstream loop-forming sequence, and the anchored extension sequence can be selected according to actual needs. The nucleotide sequence lengths mentioned in the embodiments of the present application are counted in base numbers.

[0033] In some embodiments, the nucleotide sequence of the probe has a length of 50 to 70 bases, that is, the total length of the induced open-loop sequence, the upstream loop-forming sequence, the loop sequence, the downstream loop-forming sequence, and the anchored extension sequence can be 50 to 70 bases.

[0034] In some embodiments, the embodiments of the present application analyzed the influence of the loop-forming sequence length (upstream loop-forming sequence / downstream loop-forming sequence) on the amplification curve and the melting curve signal. The investigated loop-forming sequence length range was from 4 base pairs to 8 base pairs. As the loop-forming sequence length increased, the fluorescence signal values of both the amplification curve and the melting curve increased. Based on this, the loop-forming sequence length of the probe is greater than or equal to 4 base pairs, such as 6 to 10 base pairs. By adjusting and optimizing the loop-forming sequence length, better detection effects can be obtained.

[0035] In some embodiments, the embodiments of the present application analyzed the influence of the induced open-loop sequence length on the amplification curve and the melting curve signal. The investigated induced open-loop sequence length range was from 0 bases to 10 bases. It was found that as the induced open-loop sequence length increased, the fluorescence signal values of both the amplification curve and the melting curve increased, but non-specific signals appeared in the negative control as the length increased to 10 bases. Based on this, the length of the induced open-loop sequence of the probe can be selected as 2 to 9 bases.

[0036] In some embodiments, in the probe of the present application, the induced open-loop sequence has a length of 2 to 9 bases, both the upstream loop-forming sequence and the downstream loop-forming sequence have a length of 6 to 10 bases, the loop sequence has a length of 3 to 10 bases, the anchored extension sequence has a length of 40 to 45 bases, and the distance between the fluorescent group and the second quenching group is at least 38 bases.

[0037] In some embodiments, the melting curve Tm value of the probe is 50°C - 90°C. The probe of the embodiments of the present application can not only be used for the analysis of the fluorescence real-time PCR amplification curve, but also for the analysis of the probe melting curve, and can achieve the detection of multiple target nucleic acids through the Tm value.

[0038] Specifically, the embodiments of the present application analyzed the amplification curves and melting curves of the probes of the present application in different fluorescence channels, demonstrating the high fluorescence signal detection ability in multiple fluorescence channels and the excellent application potential in the field of multiplex detection. In some embodiments, the Tm value range of the melting peak is 58.5°C - 83.5°C, and the temperature span range is 25°C. By further adjusting the position of the mediator, the Tm value can be further reduced or enhanced. Therefore, the melting curve Tm value of the probe is reasonably designed to be 50°C - 90°C, and the temperature span range is 40°C.

[0039] In some embodiments, the fluorescent groups in the probe include but are not limited to at least one of Atto425 (450 nm), FAM (510 nm), HEX (565 nm), Cy5 (665 nm), ROX (620 nm), and Quasar705 (705 nm). The probe of the embodiments of the present application can have the high fluorescence signal detection ability in multiple fluorescence channels and the excellent application ability in the field of multiplex detection through the selection and combination of different fluorescent groups.

[0040] In some embodiments, there can be various choices for the types of the first quenching group and the second quenching group; for example, the first quenching group includes at least one of TAMRA, Dabcyl, BHQ1, and BHQ2; the second quenching group includes at least one of TAMRA, Dabcyl, BHQ1, and BHQ2. The first quenching group and the second quenching group can be the same or different, and the same quenching group is selected in the embodiments of the present application. In the embodiments of the present application, the double quenching group can enhance the fluorescence quenching efficiency, and the loop structure of this probe enables the first quenching group to be in close contact with the fluorescent group, greatly reducing the fluorescence background.

[0041] In some embodiments, the nucleotide sequence of the probe includes at least one of the sequences shown in SEQ ID No.1 - 12.

[0042] SEQ ID No.1 (60 base lengths):

[0043] TATTGCCGGTTTTCCGGCATATAAACAGGTCAGAGTGAGGAGACAGCACCGTCCAGCGTC.

[0044] SEQ ID No.2 (60 base lengths):

[0045] TATTGCCGGTTTTCCGGCATATAAGAAGTGTGAGAGGTGTGATGAGTCAGGAGCTGGAGC。

[0046] SEQ ID No.3 (62 base pairs in length):

[0047] TATTGCCCGGTTTTCCGGGCATATAAACAGGTCAGAGTGAGGAGACAGCACCGTCCAGCGTC。

[0048] SEQ ID No.4 (64 base pairs in length):

[0049] TATTGCCGCGGTTTTCCGCGGCATATAAACAGGTCAGAGTGAGGAGACAGCACCGTCCAGCGTC。

[0050] SEQ ID No.5 (58 base pairs in length):

[0051] TATTCCGGTTTTCCGGATATAAACAGGTCAGAGTGAGGAGACAGCACCGTCCAGCGTC。

[0052] SEQ ID No.6 (54 base pairs in length):

[0053] AGCCGGTTTTCCGGCTAAGAAGTGTGAGAGGTGTGATGAGTCAGGAGCTGGAGC。

[0054] SEQ ID No.7 (56 base pairs in length):

[0055] TTGCCGGTTTTCCGGCATAAGAAGTGTGAGAGGTGTGATGAGTCAGGAGCTGGAGC。

[0056] SEQ ID No.8 (58 base pairs in length):

[0057] TATGCCGGTTTTCCGGCAATAAGAAGTGTGAGAGGTGTGATGAGTCAGGAGCTGGAGC。

[0058] SEQ ID No.9 (68 base pairs in length):

[0059] TTTTTTTTATTGCCGGTTTTCCGGCATATTAAGAAGTGTGAGAGGTGTGATGAGTCAGGAGCTGGAGC。

[0060] SEQ ID No. 10 (62 bases in length):

[0061] TATTGCCGCGGTTTTCCGCGGCATATACTGGGCAGGGACTCGGCTCGTCTCGGAGGGCAGCA.

[0062] SEQ ID No. 11 (64 bases in length):

[0063] TATTGCCGCGGTTTTCCGCGGCATATACGCACGACCTCAGGAGACGACGGCAGGGTGGACGGCA.

[0064] SEQ ID No. 12 (64 bases in length):

[0065] TATTGCCGCGGTTTTCCGCGGCATATGGAGGGACGGTCGTGGCAGGAGGAGCAGCTCAGTCGCA.

[0066] In the embodiments of the present application, by modifying the first quenching group at the 5'-end, the second quenching group at the 3'-end, the fluorescent group upstream near the 5'-end of the anchored extension sequence, and introducing a spacer modification into the loop sequence of the nucleotide sequence of any one of SEQ ID Nos. 1-12 above. The probe thus formed can significantly reduce the background fluorescence value, improve the detection signal-to-noise ratio and sensitivity. At the same time, it can also be used for the probe melting curve analysis after PCR amplification reaction.

[0067] In some embodiments, through the feasibility analysis of reducing the background fluorescence value and improving the signal-to-noise ratio of the probe, the results show that the background fluorescence value can be reduced to 2.2%-3.5% of the common Taqman probe and molecular beacon schemes, the signal-to-noise ratio is increased to 3.6-4.8 times, and the cycle threshold (Ct value) is reduced by 3.2 to 4.7 Ct values, significantly improving the detection sensitivity of the fluorescence signal.

[0068] In the second aspect, the embodiments of the present application provide an application. Specifically, it is the application of the probe provided in the first aspect of the embodiments of the present application in nucleic acid detection.

[0069] Based on the probe of the embodiments of the present application, the background fluorescence value can be significantly reduced and the signal-to-noise ratio is improved, thus significantly improving the detection sensitivity of the fluorescence signal. Therefore, the probe provided by the embodiments of the present application can be well used in nucleic acid detection and nucleic acid detection-related products such as nucleic acid detection kits can be prepared.

[0070] In a third aspect, an embodiment of the present application further provides a nucleic acid detection kit. Specifically, the nucleic acid detection kit provided by the present application includes the probe provided in the first aspect of the embodiment of the present application, and an intermediate probe.

[0071] The nucleic acid detection kit of the embodiment of the present application contains the probe provided in the first aspect of the embodiment of the present application. The nucleotide sequence of the probe sequentially includes an induced ring-opening sequence, an upstream looping sequence, a loop sequence, a downstream looping sequence, and an anchoring extension sequence from the 5'-end to the 3'-end. Based on the combination of this probe and the intermediate probe, when the nucleic acid detection kit of the embodiment of the present application performs nucleic acid detection, the background fluorescence value can be significantly reduced, and the signal-to-noise ratio is improved, thereby significantly enhancing the detection sensitivity of the fluorescence signal.

[0072] In some embodiments, in addition to the probe provided in the first aspect of the embodiment of the present application, the nucleic acid detection kit may further contain an intermediate probe. The intermediate probe is an oligonucleotide sequence that can bind to the target sequence and has no fluorescence modification (for example, one or more of SEQ ID No. 13, SEQ ID No. 19-39, etc.). In addition, various reagents and polymerases required for PCR may also be included. The nucleic acid detection kit of the embodiment of the present application can be used for multiplex fluorescence real-time PCR. In the embodiment of the present application, the KEY probe mentioned during relevant experimental verification is the probe specifically designed in the embodiment of the present application.

[0073] The following will be described in conjunction with specific embodiments.

[0074] Example 1 Feasibility verification of the KEY probe in reducing the background fluorescence value and improving the signal-to-noise ratio

[0075] The commonly used Taqman probe and molecular beacon probe in nucleic acid detection were selected as controls to investigate whether the KEY probe can be used to reduce the background fluorescence value of the fluorescence real-time PCR detection system and improve the signal-to-noise ratio.

[0076] The characteristic sequence of the stp gene of enterotoxigenic Escherichia coli in Escherichia coli was selected as the detection object. Each 25 μL PCR reaction system includes: 1×PCR buffer (10 mM Tris-HCl (pH 8.0) and 50 mM KCl), 3.0 mM MgCl 2, 0.2 mM dNTPs, 2 U TaqHS enzyme (TaKaRa, Japan), upstream primer of the target gene (SEQ ID No. 40: 5'-GTTTTATCCTTTTCTTGTTCGT-3', 400 nM) and downstream primer (SEQ ID No. 41: 5'-CATCTGCCACTGAAATACA-3', 400 nM), 5 μL of the template was nucleic acid extracted from the enterotoxigenic Escherichia coli strain with the stp virulence gene at gradient dilutions, and the template copy numbers added were 50000, 10000, 2000, 400, 80, 16 copies / reaction in sequence. Two sub-wells were made for each experiment, and two template-free controls (template was 5 μL of nucleic acid diluent) were made simultaneously. The PCR reaction program was: incubation at 50°C for 2 min, denaturation at 95°C for 30 s, and then 40 cycles of 95°C for 10 s and 60°C for 1 min, and fluorescence was collected at 60°C. The experimental instrument was a SLAN 96S real-time PCR instrument (Hongshi Medical Technology Co., Ltd., Shanghai), and the primers and probes were all synthesized by Shanghai Bioengineering Co., Ltd.

[0077] The PCR buffer, magnesium ion concentration, dNTPs concentration, primer dosage, and Taq enzyme dosage used in the nucleic acid detection systems of the experimental group and the control group are the same. The difference lies in the probe design scheme. The experimental group uses a combination of an intermediate probe (nucleotide sequence shown in SEQ ID: NO.13) and a KEY probe (nucleotide sequence shown in SEQ ID: NO.1). The specific settings of the control group are as follows: The probe of control group 1 is a Taqman probe with a predicted Tm value of 68°C (conventional Taqman probe design scheme, nucleotide sequence shown in SEQ ID: NO.14); The probe of control group 2 is a Taqman probe with a predicted Tm value of 62°C by shortening 4 bases at the 3' end based on control group 1 (nucleotide sequence shown in SEQ ID: NO.15); Control group 3 uses a molecular beacon probe with a weak hairpin structure (nucleotide sequence shown in SEQ ID: NO.16), and the predicted melting Tm value of the secondary structure is 55°C (nucleotide sequence shown in SEQ ID: NO.17); Control group 4 uses a molecular beacon probe with a general-strength hairpin structure (nucleotide sequence shown in SEQ ID: NO.18), and the predicted melting Tm value of the secondary structure is 60°C; Control group 5 uses a molecular beacon probe with a strong hairpin structure, and the predicted melting Tm value of the secondary structure is 65°C. The above parameters are based on an online software (OligoAnalyzer™, https: / / sg.idtdna.com / pages / tools / oligoanalyzer) for predicting the Tm value of the probe, and the secondary structure strength (melting Tm value) of the molecular beacon probe is predicted by an online software (DNA Folding form, http: / / www. unafold.org / DNA_ form.php). The dosage of the probe binding to the template strand in the experimental group and the control group is controlled to be the same, and the background fluorescence value and signal-to-noise ratio differences of different technical solutions are compared. The probes and corresponding concentrations of the experimental group and the control group used are shown in Table 1.

[0078] Table 1 Sequences of the probes in the examples of this application and the control group probes

[0079]

[0080] Note: The bold-identified bases are the same probe binding regions matching the template.

[0081] The experimental results are as Figure 2 shown, and the results show that the amplification curve signal of the experimental group using the KEY probe of this application example is better than that of the control group using Taqman probes and molecular beacon probes (see Figure 2in A). The fluorescence background value of the experimental group was only 2.16% - 2.88% of that of the Taqman probe control group and only 2.21% - 3.52% of that of the molecular beacon control group, which was significantly better than that of the Taqman probe and the molecular beacon probe (see Figure 2 in B). The signal-to-noise ratio of the experimental group was 4.27 - 4.28 times that of the Taqman probe control group and 3.63 - 4.75 times that of the molecular beacon control group, which was significantly better than that of the Taqman probe and the molecular beacon probe (see Figure 2 in C). The cycle threshold (Ct value) of different template concentrations in the experimental group was 3.55 - 4.07 Ct values lower than that of the Taqman probe control group and 3.19 - 4.70 Ct values lower than that of the molecular beacon control group, which was significantly better than that of the Taqman probe and the molecular beacon probe ( Figure 2 in D). In summary, the nucleic acid detection system using the KEY probe in the embodiments of the present application has a low background fluorescence value and a high signal-to-noise ratio, and can more sensitively detect changes in fluorescence signals.

[0082] Example 2 Verification of the Minimum Detection Limit and Specificity of the KEY Probe

[0083] 1) Select the commonly used Taqman probe and molecular beacon probe in nucleic acid detection as controls to investigate whether the KEY probe can be used to reduce the minimum detection limit (Limit of Detection, LOD) of the nucleic acid detection system.

[0084] Select the characteristic sequence of the stp gene, a characteristic gene of enterotoxigenic Escherichia coli, as the detection object. Each 25 μL PCR reaction system includes 1×PCR buffer (10 mM Tris-HCl (pH 8.0) and 50 mM KCl), 3.0 mM MgCl 2, 0.2 mM dNTPs, 2 U TaqHS enzyme (TaKaRa, Japan), upstream primer of the target gene (sequence 5'-GTTTTATCCTTTTCTTGTTCGT-3', 400 nM) and downstream primer (sequence 5'-CATCTGCCACTGAAATACA-3', 400 nM). The probes and corresponding concentrations used in the experimental group and the control group are shown in Table 1. 5 μL of the template is the nucleic acid extracted from the enterotoxigenic Escherichia coli strain with the stp virulence gene by gradient dilution. The added template copy numbers are 10, 5, 3, 2, and 1 copies / reaction in sequence, and 20 parallel wells are made for each. The PCR reaction program is: incubation at 50 °C for 2 min, denaturation at 95 °C for 30 s, and then 40 cycles of 95 °C for 10 s and 60 °C for 1 min, and fluorescence is collected at 60 °C. The experimental instrument is a SLAN 96S real-time PCR instrument (Hongshi Medical Technology Co., Ltd., Shanghai). The lowest concentration gradient with a positive detection rate ≥ 95% is defined as the LOD of the nucleic acid detection system (at least 19 out of 20 parallel wells have positive signals).

[0085] The detection results are shown in Table 2. The lowest detection limits of the Taqman probe scheme and the molecular beacon scheme are both 5 copies / reaction, while the lowest detection limit of the design scheme based on the KEY probe in the examples of the present application can reach 2 copies / reaction, and the lowest detection limit is significantly reduced, which is beneficial to the detection of nucleic acid samples with low abundance and low concentration.

[0086] Table 2 Investigation of the lowest detection limits of nucleic acid detection systems with different probes

[0087]

[0088] 2) The stp characteristic sequence of the enterotoxigenic Escherichia coli characteristic gene of Escherichia coli was selected as the detection object to investigate the specificity of the probe. Each 25 μL PCR reaction system includes 1×PCR buffer (10 mM Tris-HCl (pH 8.0) and 50 mM KCl), 3.0 mM MgCl 2 , 0.2 mM dNTPs, 2 U TaqHS enzyme (TaKaRa, Japan), upstream primer of the target gene (sequence 5'-GTTTTATCCTTTTCTTGTTCGT-3', 400 nM) and downstream primer (sequence 5'-CATCTGCCACTGAAATACA-3', 400 nM) and 5 μL of the template. The PCR reaction program is: incubation at 50 °C for 2 min, denaturation at 95 °C for 30 s, and then 40 cycles of 95 °C for 10 s and 60 °C for 1 min, and fluorescence is collected at 60 °C. The experimental instrument is a SLAN 96S real-time PCR instrument (Hongshi Medical Technology Co., Ltd., Shanghai).

[0089] For specificity investigation, 10 strains of enterotoxigenic Escherichia coli (ETEC) containing the stp virulence gene and 30 strains of Escherichia coli without the stp virulence gene were selected as nucleic acid templates, including 5 strains of enteropathogenic Escherichia coli (EPEC), 5 strains of enteroaggregative Escherichia coli (EAEC), 5 strains of enteroinvasive Escherichia coli (EIEC), 5 strains of Shiga toxin-producing Escherichia coli (STEC), 10 strains of non-diarrheagenic Escherichia coli (Non-DEC), as well as 5 strains of Salmonella and 5 strains of Vibrio parahaemolyticus which do not belong to Escherichia coli. The experimental results are shown in Table 3. The results show that the nucleic acid detection results of the 10 ETEC strains containing the stp virulence gene are all positive for the stp virulence gene, while the nucleic acid detection results of the other 40 strains without the stp virulence gene are all negative for the stp virulence gene, and no non-specific signal is generated, proving that the KEY probe nucleic acid detection system has strong specificity.

[0090] Table 3 Specificity investigation of the probe nucleic acid detection system of the present application

[0091]

[0092] Example 3 Feasibility verification of the application of the KEY probe in probe melting curve analysis

[0093] The characteristic sequence of the stp gene, a characteristic gene of enterotoxigenic Escherichia coli, was selected as the detection object to investigate whether the KEY probe can be used for probe melting curve analysis (MCA).

[0094] In this example, 6 mediator probes corresponding to different Tm values (nucleotide sequences are shown in SEQ ID: NO. 19-24) were designed based on the KEY probe with the nucleotide sequence shown in SEQ ID: NO. 2. Each 25 μL PCR reaction system includes 1×PCR buffer (10 mM Tris-HCl (pH 8.0) and 50 mM KCl), 3.0 mM MgCl 2, 0.2 mM dNTPs, 2 U TaqHS enzyme (TaKaRa, Japan), forward primer for the target gene (sequence 5'-GTTTTATCCTTTTCTTGTTCGT-3', 400 nM) and reverse primer (sequence 5'-CATCTGCCACTGAAATACA-3', 400 nM). The mediator probes, KEY probes with different melting temperatures and their corresponding concentrations used are shown in Table 4. The number of template copies added was 2000 copies / reaction, and two template-free controls (template: 5 μL of nucleic acid diluent) were set up simultaneously. The PCR reaction program was as follows: incubation at 50°C for 2 min, denaturation at 95°C for 30 s, and then 40 cycles of 95°C for 10 s and 60°C for 1 min, with fluorescence collection at 60°C. After PCR, the probe melting curve analysis program was as follows: incubation at 35°C for 20 min, incubation at 45°C for 5 min, gradually heating from 45°C to 95°C (0.04°C / s), and fluorescence collection at each step. The experimental instrument was a SLAN 96S real-time PCR instrument (Hongshi Medical Technology Co., Ltd., Shanghai).

[0095] Table 4 Sequences of the probes and mediator probes in this application

[0096]

[0097] Note: The bases marked in bold are the probe binding regions matching the template.

[0098] The experimental results are as Figure 3 shown. The results show that the probe melting curve analysis shows that each mediator probe corresponds to a different melting peak, and the corresponding Tm values are 55.0°C, 61.0°C, 63.8°C, 69.5°C, 72.6°C, and 74.4°C, respectively. Moreover, the signals of the melting peaks are good, and the Tm values between the melting peaks can be clearly distinguished. The above results indicate that the KEY probe of the embodiment of this application can not only be used for probe melting curve analysis, but also can achieve multi-target nucleic acid detection through the Tm value in a single fluorescence channel.

[0099] Example 4 Investigation and verification of the strength of the KEY probe hairpin structure

[0100] To investigate the secondary structure strength of the KEY probe hairpin structure, while keeping the nucleic acid sequences of the probe KEY-FL1-induced open-loop sequence, loop sequence, and extended anchor sequence unchanged, 4 KEY probes with different hairpin structure strengths were obtained by adjusting the lengths of the upstream and downstream loop-forming sequences (4 - 8 bp). The hairpin structures from strong to weak are KEY-FL3 (hairpin structure Tm = 92.4 °C), KEY-FL2 (hairpin structure Tm = 88.5 °C), KEY-FL1 (hairpin structure Tm = 84 °C), and KEY-FL4 (hairpin structure Tm = 79.6 °C). The corresponding nucleotide sequences of the KEY probes are SEQ ID: NO.4, SEQ ID: NO.3, SEQ ID: NO.1, and SEQ ID: NO.5 in sequence. The nucleotide sequences of the mediator probes used are shown in SEQ ID: NO.25 - 27.

[0101] Each 25 μL PCR reaction system includes 1×PCR buffer (10 mM Tris-HCl (pH 8.0) and 50 mM KCl), 3.0 mM MgCl 2 , 0.2 mM dNTPs, 2U TaqHS enzyme (TaKaRa, Japan), upstream primer for the target gene (sequence 5'-GTTTTATCCTTTTCTTGTTCGT-3', 400 nM) and downstream primer (sequence 5'-CATCTGCCACTGAAATACA-3', 400 nM). The mediator probes, KEY probes with different melting temperatures and their corresponding concentrations used in the design are shown in Table 5. The added template copy number is 2000 copies / reaction, and at the same time, two template-free controls (template is 5 μL of nucleic acid dilution) are made. The PCR reaction program is: incubation at 50 °C for 2 min, denaturation at 95 °C for 30 s, and then 40 cycles of 95 °C for 10 s and 60 °C for 1 min, and fluorescence is collected at 60 °C. The PCR probe melting curve analysis program is as follows: incubation at 35 °C for 20 min, incubation at 45 °C for 5 min, gradually heating from 45 °C to 95 °C (0.04 °C / s), and fluorescence is collected at each step. The experimental instrument is a SLAN 96S real-time PCR instrument (Hongshi Medical Technology Co., Ltd., Shanghai).

[0102] Table 5 Probe sequences used for investigating the hairpin structure strength of the probes in this application

[0103]

[0104] Note: The bold-identified bases are the probe binding regions matching the template.

[0105] The experimental results are as Figure 4As shown, the results indicate that when the length of the loop-forming sequence (upstream loop-forming sequence / downstream loop-forming sequence) is greater than or equal to 6 base pairs, both the amplification curve signal and the melting curve signal are good. However, when the length of the loop-forming sequence is shortened to 4 base pairs, the amplification curve signal and the melting peak signal are significantly reduced. Therefore, in the application examples, the length of the loop-forming sequence of the KEY probe can be designed to be greater than or equal to 4 base pairs, preferably 6 base pairs or more.

[0106] Example 5 Investigation and Verification of the Length of the Loop-Opening Sequence Induced by the KEY Probe

[0107] To investigate the appropriate length of the loop-opening sequence induced by the KEY probe, while keeping the nucleic acid sequences of the upstream loop-forming sequence, downstream loop-forming sequence, loop sequence, and extension anchor sequence of the KEY probe unchanged, 5 KEY probes were obtained by adjusting the length of the loop-opening sequence (0 - 10 bp). The lengths of the loop-opening sequences from small to large are ROX-RL2 (0 bp), ROX-RL3 (1 bp), ROX-RL4 (2 bp), ROX-RL1 (3 bp), and ROX-RL5 (10 bp), and the corresponding nucleotide sequences of the KEY probes are SEQ ID: NO.6, SEQ ID: NO.7, SEQ ID: NO.8, SEQ ID: NO.2, and SEQ ID: NO.9 in sequence. The nucleotide sequences of the mediator probes used are shown in SEQ ID: NO.28 - 29.

[0108] Each 25 μL PCR reaction system includes 1×PCR buffer (10 mM Tris-HCl (pH 8.0) and 50 mM KCl), 3.0 mM MgCl 2 , 0.2 mM dNTPs, 2U TaqHS enzyme (TaKaRa, Japan), the upstream primer of the target gene (sequence 5'-GTTTTATCCTTTTCTTGTTCGT-3', 400 nM), and the downstream primer (sequence 5'-CATCTGCCACTGAAATACA-3', 400 nM). The mediator probes, KEY probes with different melting temperatures and their corresponding concentrations are shown in Table 6. The number of template copies added is 2000 copies / reaction, and at the same time, two template-free controls (the template is 5 μL of nucleic acid dilution solution) are made. The PCR reaction program is as follows: incubate at 50°C for 2 min, denature at 95°C for 30 s, and then perform 40 cycles of 95°C for 10 s and 60°C for 1 min, and collect fluorescence at 60°C. The program for analyzing the probe melting curve after PCR is as follows: incubate at 35°C for 20 min, incubate at 45°C for 5 min, gradually heat from 45°C to 95°C (0.04°C / s), and collect fluorescence at each step. The experimental instrument is a SLAN 96S real-time PCR instrument (Hongshi Medical Technology Co., Ltd., Shanghai).

[0109] Table 6 Probe Sequences Used in the Investigation of the Length of the Probe-Induced Ring-Opening Sequence in This Application

[0110]

[0111] Note: The bold-identified bases are the probe binding regions that match the template.

[0112] The experimental results are as Figure 5 shown. The results indicate that within the range of 0 to 10 bases for the length of the induced ring-opening sequence, as the length of the induced ring-opening sequence increases, the fluorescence signal values of both the amplification curve and the melting curve increase. However, when the length increases to 10 bases, non-specific signals appear in the negative control. Based on this, the KEY probe-induced ring-opening sequence can be 2 - 9 bases.

[0113] Example 6 Comprehensive Verification of the Nucleic Acid Sequence of the KEY Probe and Its Modification Method

[0114] In order to investigate the detection signals of the KEY probe in different fluorescence channels, based on the optimal induced ring-opening sequence length and the optimal upstream / downstream loop-forming sequences obtained in the above examples, one KEY probe was designed for each of the fluorescence channels FAM (510 nm), HEX (565 nm), ROX (620 nm), and Cy5 (665 nm) in real-time fluorescence PCR, namely KEY-FH1 (nucleotide sequence as shown in SEQ ID: NO.1), KEY-HH1 (nucleotide sequence as shown in SEQ ID: NO.10), KEY-RH1 (nucleotide sequence as shown in SEQ ID: NO.11), KEY-CH1 (nucleotide sequence as shown in SEQ ID: NO.12), and 3 mediator probes corresponding to each KEY probe.

[0115] Each 25 μL PCR reaction system includes 1×PCR buffer (10 mM Tris-HCl (pH 8.0) and 50 mM KCl), 3.0 mM MgCl 2, 0.2 mM dNTPs, 2 U TaqHS enzyme (TaKaRa, Japan), forward primer for the target gene (sequence 5'-GTTTTATCCTTTTCTTGTTCGT-3', 400 nM) and reverse primer (sequence 5'-CATCTGCCACTGAAATACA-3', 400 nM). The mediator probes, KEY probes with different melting temperatures and their corresponding concentrations used in the design are shown in Table 7. The number of template copies added is 2000 copies / reaction, and two template-free controls (template is 5 μL of nucleic acid dilution solution) are made simultaneously. The PCR reaction program is as follows: incubate at 50°C for 2 min, denature at 95°C for 30 s, and then perform 40 cycles of 95°C for 10 s and 60°C for 1 min, and collect fluorescence at 60°C. The probe melting curve analysis program after PCR is as follows: incubate at 35°C for 20 min, incubate at 45°C for 5 min, gradually heat from 45°C to 95°C (0.04°C / s), and collect fluorescence at each step. The experimental instrument is a SLAN 96S real-time PCR instrument (Hongshi Medical Technology Co., Ltd., Shanghai).

[0116] Table 7 Nucleic acid sequences and their modifications of the probe combinations in this application

[0117]

[0118] Note: The bold-identified bases are the probe binding regions matching the template.

[0119] The experimental results are as Figure 6 shown. The results show that the amplification curves and melting curve signals of the KEY probes designed in 4 common fluorescence channels are all good. The Tm value range of the melting peaks is 58.5°C - 83.5°C, the temperature span range is 25°C, and a melting peak (corresponding to the target gene of 1 detection object) is set every 2°C. 13 target genes can be detected in a single fluorescence channel. Using a common four-fluorescence-channel real-time fluorescence PCR instrument, it is expected to detect 52 target genes in a single PCR reaction; using a six-fluorescence-channel real-time fluorescence PCR instrument, it is expected to detect 78 target genes in a single PCR reaction; and so on. This example demonstrates the high fluorescence signal detection ability of the KEY probe in multiple fluorescence channels and its excellent application potential in the field of multiplex detection.

[0120] The above are only the preferred embodiments of this application and are not intended to limit this application. Any modifications, equivalent replacements, and improvements made within the spirit and principle of this application shall be included in the protection scope of this application.

Claims

1. A probe for nucleic acid detection, characterized in that: The nucleotide sequence of the probe includes, from the 5' end to the 3' end, an induced ring-opening sequence, an upstream ring-forming sequence, a ring sequence, a downstream ring-forming sequence and an anchor extension sequence in sequence; wherein the upstream ring-forming sequence and the downstream ring-forming sequence are reverse complementary pairs, the 5' end of the nucleotide sequence of the probe is connected to a first quenching group, the 3' end of the nucleotide sequence of the probe is connected to a second quenching group, and the upstream of the anchor extension sequence is connected to a fluorescent group; The induced loop-opening sequence has a length of 2-10 bases, the upstream loop-forming sequence and the downstream loop-forming sequence both have a length of 4-20 bases, and the loop sequence is provided with an inter-arm modification; The anchor extension sequence is a sequence used to coordinate the anchoring and extension of the intermediate enzyme cleavage sequence during nucleic acid detection, and the induced loop opening sequence is a sequence that promotes the opening of the probe's own hairpin structure when the intermediate enzyme cleavage sequence extends to this position.

2. The probe according to claim 1, characterized in that The spacer modification includes one or more Spacer18, Spacer 9, Spacer C3 or Spacer C6 modification.

3. The probe according to claim 1, characterized in that The loop sequence has a length of 4-10 bases; And / or, the anchor extension sequence has a length of 30-45 bases, and the distance between the fluorescent group and the second quenching group is at least 25 bases.

4. The probe according to claim 3, characterized in that: The induced ring-opening sequence has a length of 2-9 bases, the upstream ring-forming sequence and the downstream ring-forming sequence both have a length of 6-10 bases, the anchor extension sequence has a length of 40-45 bases, and the distance between the fluorescent group and the second quenching group is at least 38 bases.

5. The probe according to claim 1, characterized in that: The nucleotide sequence of the probe has a length of 50-70 bases.

6. The probe according to any one of claims 1 to 5, characterized in that: The fluorescent group includes at least one of Atto425, FAM, HEX, ROX, Cy5, and Quasar705; and / or, the first quenching group comprises at least one of TAMRA, Dabcyl, BHQ1 and BHQ2; And / or, the second quenching group includes at least one of TAMRA, Dabcyl, BHQ1 and BHQ2.

7. The probe according to any one of claims 1 to 5, characterized in that: The probe is at least one of the following: BHQ1-TATTGCCGGTTTT / iSp18 / / iSp18 / CCGGCATA / i6FAMdT / AAACAGGTCAGAGTGAGGAGACAGCACCGTCCAGCGTC-BHQ1; TATTGCCGGTTTT / iSp18 / / iSp18 / CCGGCATA / iROXdT / AAGAAGTGTGAGAGGTGTGATGAGTCAGGAGCTGGAGC-BHQ2; BHQ1-TATTGCCCGGTTTT / iSp18 / / iSp18 / CCGGGCATA / i6FAMdT / AAACAGGTCAGAGTGAGGAGACAGCACCGTCCAGCGTC-BHQ1; BHQ1-TATTGCCGCGGTTTT / iSp18 / / iSp18 / CCGCGGCATA / i6FAMdT / AAACAGGTCAGAGTGAGGAGACAGCACCGTCCAGCGTC-BHQ1; BHQ1-TATTCCGGTTTT / iSp18 / / iSp18 / CCGGATA / i6FAMdT / AAACAGGTCAGAGTGAGGAGACAGCACCGTCCAGCGTC-BHQ1; BHQ2-TTGCCGGTTTT / iSp18 / / iSp18 / CCGGCA / iROXdT / AAGAAGTGTGAGAGGTGTGATGAGTCAGGAGCTGGAGC-BHQ2; BHQ2-TATGCCGGTTTT / iSp18 / / iSp18 / CCGGCAA / iROXdT / AAGAAGTGTGAGAGGTGTGATGAGTCAGGAGCTGGAGC-BHQ2; BHQ2-TTTTTTTTATTGCCGGTTTT / iSp18 / / iSp18 / CCGGCATAT / iROXdT / AAGAAGTGTGAGAGGTGTGATGAGTCAGGAGCTGGAGC-BHQ2; BHQ1-TATTGCCGCGGTTTT / iSp18 / / iSp18 / CCGCGGCATA / / iHEXdT / ACTGGGCAGGGACTCGGCTCGTCTCGGAGGGCAGCA-BHQ1; BHQ2-TATTGCCGCGGTTTT / iSp18 / / iSp18 / CCGCGGCATA / iROXdT / ACGCACGAC / iXNA_C / TCAGGAGACGACGGCAGGGTGGACGGCA-BHQ2; BHQ2-TATTGCCGCGGTTTT / iSp18 / / iSp18 / CCGCGGCATA / iCy5dT / GGAGGGACGGTCGTGGCAGGAGGAGCAGCTCAGTCGCA-BHQ2.

8. Use of the probe according to any one of claims 1 to 7 in nucleic acid detection for non-diagnostic purposes.

9. A nucleic acid detection kit, characterized in that: It comprises the probe according to any one of claims 1 to 7, and an intermediate probe.

Images