Primer pair for sex identification of snake moss, kit and sex identification method of snake moss

Abstract

The invention discloses a primer pair for sex identification of snake moss, a kit and a sex identification method of the snake moss. The primer pairs are a male specific amplification primer pair and a female specific amplification primer pair, the male specific amplification primer pair is CV234F and CV234R, and the female specific amplification primer pair is CU380F and CU380R. The nucleotide sequence of the primer CV234F is as shown in SEQ ID NO: 1, the nucleotide sequence of the primer CV234R is as shown in SEQ ID NO: 2, the nucleotide sequence of the primer CU380F is as shown in SEQ ID NO: 3, and the nucleotide sequence of the primer CU380R is as shown in SEQ ID NO: 4. The method comprises the following steps of: extracting a DNA (Deoxyribose Nucleic Acid) sample by taking leaves in a propagation and growth stage of the snake moss, carrying out PCR (Polymerase Chain Reaction) amplification on the DNA sample, and carrying out electrophoresis to identify female and male plants of the snake moss. The identification method using the primer pair is high in accuracy and simple and easy to operate, time and labor cost are saved, economic benefits are increased, and reliable technical and molecular theoretical support is provided for conservation and genetic research of snake moss.

Description

Technical Field

[0001] The invention relates to the field of agricultural production, in particular to a primer pair and a kit for sex identification of snake moss and a sex identification method thereof. Background Art

[0002] Bryophytes are the earliest existing embryophytes and pioneer plants. They represent an important branch of land plants and have important ecological and economic value. Bryophytes include three major branches: liverworts (~7,300 species), mosses (~13,000 species), and hornworts (~250 species). Among land plants, vascular plants are dominated by the sporophyte generation, while bryophytes are dominated by the gametophyte generation, and the sporophyte generation parasitizes on the gametophyte. About 60% of bryophytes are dioecious. After spore germination, after the vegetative growth stage, they reach the reproductive stage. The female plant develops an archegonium, and the male plant develops a spermatophore and releases sperm. The sperm swims to the archegonium to complete fertilization. The fertilized egg develops into a sporophyte, and the sporophyte parasitizes on the gametophyte until it matures and releases spores. Mosses are short and it is difficult to distinguish between male and female plants during the vegetative growth stage. Even in the reproductive growth stage, due to the extremely small sexual organs of mosses, it is still difficult to distinguish between male and female plants. This affects the research on the utilization and conservation genetics of mosses.

[0003] In order to quickly and accurately identify the sex of bryophytes, it is very important to develop molecular markers for sex identification of bryophytes. Snake moss (Conocephalum conicum (L.) Dumort.), as a plant of the order Liverwortes, not only occupies a place in biodiversity and ecological balance, but also shows its unique value in medicine and landscape. Snake moss has broad, ribbon-shaped, leathery, dark green, slightly shiny thallus, 5-10 cm long, about 1-2 cm wide, and the pattern is very similar to the skin of a snake. Snake moss is widely distributed in the world and plays an important role in the biological soil crust, helping to reduce soil erosion, improve water infiltration, and participate in carbon assimilation and nitrogen fixation processes, and has high ecological value. Snake moss is also widely used in different types of park configuration design and has important ecological and economic value.

[0004] Snake moss is a dioecious plant, and its male and female plants are highly similar in the vegetative growth stage and cannot be distinguished, which hinders its effective cultivation and planting. In order to solve this problem, the present invention uses omics technology to assemble the genome of snake moss, and through comparison analysis, successfully designs a pair of primers for identifying male plants and a pair of primers for identifying female plants. These two pairs of primers have high amplification efficiency, stable amplification results, good identification effect, and are suitable for sex identification of snake moss at any growth and development stage. These primers can efficiently identify the sex status of snake moss and promote the conservation, utilization and research of this group of species. Summary of the invention

[0005] The purpose of the present invention is to provide a primer pair, a kit and a sex identification method for snake moss. The method can efficiently identify the sex of snake moss by successfully designing a pair of primers for identifying male plants and a pair of primers for identifying female plants, thereby promoting the conservation, utilization and research of snake moss.

[0006] The technical solution of the present invention is a primer pair for identifying the sex of snake moss, wherein the primer pair is a male-specific amplification primer pair and a female-specific amplification primer pair, wherein the male-specific amplification primer pair is CV234F and CV234R, and the female-specific amplification primer pair is CU380F and CU380R.

[0007] The nucleotide sequence of the aforementioned primer CV234F is shown as SEQ ID NO:1, the nucleotide sequence of the aforementioned primer CV234R is shown as SEQ ID NO:2, the nucleotide sequence of the aforementioned primer CU380F is shown as SEQ ID NO:3, and the nucleotide sequence of the aforementioned primer CU380R is shown as SEQ ID NO:4.

[0008] The use of the aforementioned primer pair for snake moss sex identification in the preparation of a kit for snake moss sex identification.

[0009] A kit contains the aforementioned primer pair for rapid sex identification of snake moss.

[0010] A method for identifying the sex of snake moss, the identification method is carried out according to the following steps:

[0011] (1) Take leaves of snake moss in the reproductive growth stage and extract DNA samples using the CTAB method;

[0012] (2) using a male-specific amplification primer pair to perform PCR amplification on the DNA sample of step (1) to obtain a male PCR product, wherein the nucleotide sequence of the male-specific amplification primer pair is as shown in SEQ ID NO: 1 and

[0013] As shown in SEQ ID NO:2;

[0014] (3) performing PCR amplification on the DNA sample of step (1) using a female-specific amplification primer pair to obtain a female PCR product, wherein the nucleotide sequence of the female-specific amplification primer pair is as shown in SEQ ID NO: 3 and

[0015] As shown in SEQ ID NO:4;

[0016] (4) Take 5uL of the male PCR product of step (2) and the female PCR product of step (3) and load them on 1% agarose gel respectively, perform electrophoresis for 20 minutes, take pictures under UV light of BIO-RAD gel imaging system, and determine the male and female plants of snake moss based on the electrophoresis results.

[0017] In the above step (2), the PCR reaction system is: PCR premix 12.5uL, DNA sample 1uL, deionized water 9.5uL, CV234F primer pair 1uL and CV234R primer pair 1uL.

[0018] In the above step (3), the PCR reaction system is: 12.5uL of PCR premix, 1uL of DNA sample, 9.5uL of deionized water, 1uL of CU380F primer pair and 1uL of CU380R primer pair.

[0019] In the aforementioned step (2), the PCR amplification cycle was set as: 95°C pre-denaturation for 3 minutes, 95°C denaturation for 1 minute, 55°C annealing for 1 minute, 72°C extension for 45 seconds, and after 35 reaction cycles, further extension at 72°C for 10 minutes.

[0020] In the aforementioned step (3), the PCR amplification cycle was set as: 95°C pre-denaturation for 3 minutes, 95°C denaturation for 1 minute, 55°C annealing for 1 minute, 72°C extension for 45 seconds, and after 35 reaction cycles, further extension at 72°C for 10 minutes.

[0021] In the above step (4), the electrophoresis conditions are: current 80A, voltage 120V, electrophoresis buffer 1×

[0022] TAE.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] The present invention obtains the genome information of male and female plants of the species by sequencing the genomes at the chromosome level of the female and male plants of snake moss, obtains the genes on the sex chromosomes specific to the male and female plants by annotation, comparison and comparative analysis, and designs primers therefor to obtain a pair of primers for identifying male plants and a pair of primers for identifying female plants, thereby solving the problem of identifying male and female plants of snake moss. The two pairs of primers of the present invention can be used to efficiently identify the female and male plants of snake moss, and the identification method using the primer pairs of the present invention has high accuracy, is simple and easy to operate, not only saves time and labor costs, but also expands economic benefits, and also provides reliable technical and molecular theoretical support for the conservation and genetic research of snake moss. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1: Electrophoresis results of female- and male-specific amplification products of two pairs of sex identification primers (20 samples per row of the electrophoresis gel, 10 female (F1-F10) and 10 male samples (M1-M10). L represents DNA Ladder).

[0026] In order to enable those skilled in the art to better understand and implement the technical solution of the present invention, the present invention is further described below in conjunction with specific embodiments, but the embodiments are not intended to limit the present invention. DETAILED DESCRIPTION

[0027] Example 1

[0028] Snake moss sex identification method:

[0029] (1) Take leaves of snake moss in the reproductive growth stage and extract DNA samples using the CTAB method;

[0030] (2) performing PCR amplification on the DNA sample of step (1) using a male-specific amplification primer pair (CV234F and CV234R) and a female-specific amplification primer pair (CU380F and CU380R) to obtain a PCR product, wherein the nucleotide sequence of the male-specific amplification primer pair is shown in SEQ ID NO:1 and SEQ ID NO:2, and the nucleotide sequence of the female-specific amplification primer pair is shown in SEQ ID NO:3 and SEQ ID NO:4;

[0031] Primer CV234F:

[0032] SEQ ID NO: 1: CAGGGTGGTTCACGTTGACTCC;

[0033] Primer CV234R:

[0034] SEQ ID NO:2: GCAGCAGTGTTATAGGTGGG;

[0035] Primer CU380F:

[0036] SEQ ID NO:3: GGAAGGGGGTACATGGAGATCA;

[0037] Primer CU380R:

[0038] SEQ ID NO: 4: ACGTGCCAGTGGAAGAGTTC;

[0039] The male PCR reaction system is: PCR premix 12.5uL, DNA sample 1uL, deionized water 9.5uL, CV234F primer pair 1uL and CV234R primer pair 1uL;

[0040] The PCR reaction system for females was: PCR premix 12.5uL, DNA sample 1uL, deionized water 9.5uL, CU380F primer pair 1uL, and CU380R primer pair 1uL;

[0041] The cycle settings for PCR amplification were: pre-denaturation at 95°C for 3 minutes, denaturation at 95°C for 1 minute, annealing at 55°C for 1 minute, extension at 72°C for 45 seconds, and further extension at 72°C for 10 minutes after 35 reaction cycles.

[0042] (3) Take 5uL of male PCR product and female PCR product and load them on 1% agarose gel respectively, perform electrophoresis for 20 minutes, take pictures under UV light of BIO-RAD gel imaging system, and determine the male and female plants of snake moss according to the electrophoresis results;

[0043] The electrophoresis conditions were as follows: current 80 A, voltage 120 V, and electrophoresis buffer 1×TAE.

[0044] Judgment criteria: The bands amplified by the female-specific amplification primer pair (CU380F and CU380R) are female snake mosses, and the bands amplified by the male-specific amplification primer pair (CV234F and CV234R) are male snake mosses.

[0045] The present invention has done a lot of analysis and verification experiments. The following is the design process of the primer pair and the experimental research process and results of using the primer pair to identify the female and male plants of snake moss:

[0046] 1 Primer design

[0047] S1 Collection of male and female snake moss samples and material preparation

[0048] Through long-term observation of the snake moss population in Tianquan County, Sichuan, and field collection of the species during its reproductive growth stage, a large number of snake moss materials with significant male and female differentiation were obtained. The samples were brought back to the laboratory in plastic fresh-keeping boxes, and the samples were morphologically dissected and identified. The female and male samples were separated under a dissecting microscope. The ones with spore capsules were female plants, and the ones with spermatophores were male plants. After rinsing the two materials with sterile water several times, they were examined again under a dissecting microscope to eliminate contamination. Some fresh female and male samples were selected and the C values ​​were measured by flow cytometry, with three replicates for each sample to obtain their genome size information; at the same time, Hi-C library construction and illumina second-generation high-throughput sequencing were performed on them. Each sample had 100Gb of data off the machine, which was used to assemble the genome sequence and mount the chromosome.

[0049] In this step, it is crucial to have professionals identify and separate the female and male samples of snake moss under microscopic examination. Mixed sample sequencing caused by inaccurate identification will increase the difficulty of subsequent assembly and analysis.

[0050] S2 DNA and RNA extraction, library construction and transcriptome sequencing:

[0051] The clean samples obtained in step S1 were subjected to DNA and RNA extraction, library construction and high-throughput sequencing to obtain the third-generation Nanopore data with a genome length of more than 60X, which was used for genome assembly; the second-generation whole genome sequencing data with short read length (sequencing depth ~100X) was obtained for genome size estimation and base correction of assembled genomes; and the transcriptome data was obtained for auxiliary gene annotation. The specific operations are as follows:

[0052] The clean female and male plants of the snake moss obtained in step S1 were placed in liquid nitrogen for quick freezing and ground into powder. The total DNA and RNA of the two samples were extracted by the CTAB method and sent to the Wuhan Future Group. The DNA of the two samples were subjected to Nanopore third-generation library construction and sequencing to obtain 60Gb / sample of long-length data, and illumina second-generation high-throughput library construction and sequencing to obtain 50Gb / sample of second-generation data. The RNA was subjected to transcriptome sequencing to obtain 12Gb / sample of transcriptome data.

[0053] In this step, DNA and RNA extraction, library construction, and high-throughput sequencing use standard procedures commonly used in the field. The key to this step is that the amount of sequencing data needs to reach a certain genome coverage, that is, sequencing depth. In this project, the third-generation sequencing reached a sequencing depth of ~60X, and the second-generation sequencing reached a sequencing depth of ~100X.

[0054] Assembly of the S3 genome:

[0055] The second-generation data obtained in step S2 were quality controlled using fastQC and Trimmomatic. Combined with the estimated genome size, Nextdenovo was used to complete the genome assembly of the third-generation sequencing data to obtain the preliminary genome assembly results. The specific operations are as follows:

[0056] The raw sequencing data obtained in step S2 were assembled using NextDenovo v2.4.0 software on the Xianhu Botanical Garden supercomputing platform. The main parameter used is "seed_cutoff", that is, reads with a length greater than this value will be used as seed sequences for initial error correction. The size of this value depends on two factors: the estimated genome size G and the specified seed depth d. Reads with a data volume of G×d are taken in order from long to short, which is the seed sequence, and the length of the last read (that is, the shortest read) is the value of "seed_cutoff". The estimated genome size G is determined by the genome survey described above, and the depth d can be manually specified. The value used is 45 to balance the assembly continuity and the consumed computing resources. At the same time, the configuration file enables NextDenovo to recognize the SGE (sun grid engine) cluster environment and automatically deliver to maximize the use of cluster computing resources.

[0057] This step requires flow cytometry to determine the genome size in advance. The C value of snake moss plants has been determined in the early stage, and the estimated genome size is ~300Mb; in addition, the sequencing depth should be guaranteed to be at least 50X or more.

[0058] S4 genome assembly result correction:

[0059] The preliminary genome assembly result obtained in step S3 is subjected to three rounds of iterative error correction using the third-generation data and the second-generation data, respectively, using Racon and pilon to obtain the corrected assembly result. The specific operations are as follows:

[0060] Correct the original assembly results obtained in step S3. The first step is to use the third-generation self-correction software Racon for correction, which is mainly used to correct structural variations (SVs) and insertions (indels) in the genome. The input files of Racon are the SAM files generated by aligning the third-generation raw reads to the genome using minimap2 and the genome sequence file itself. The minimap2 alignment uses the "-ax map-ont" mode suitable for nanopore data, and other parameters use the recommended default values. The self-correction process of minimap2+Racon is iterated for 3 rounds to obtain the best correction effect. The second step of correction is to use the second-generation reads with higher accuracy for error correction. First, use the BWA tool to align the second-generation reads after quality control to the genome sequence output by Racon above. The alignment algorithm selects "MEM" suitable for short reads to generate a BAM file. Then use Pilon to read the BAM file and the genome file, and select the "--fix snps,indels" suitable for short reads in the operation mode to correct SNPs and indels. The error correction process of BWA+Pilon was also iterated for 3 rounds to obtain higher assembly quality. After 3 rounds of iterative error correction by Racon and 3 rounds of Pilon, a high-accuracy preliminary genome assembly was obtained.

[0061] This step requires the use of the second-generation reads obtained from the previous sequencing of the short fragment library, and the sequencing depth should be 50-100X.

[0062] Hi-C assembly of S5 genome:

[0063] The corrected assembly results obtained in step S4 were aligned with the moss organelle database using BLASTN of the NCBI BLAST toolkit. After filtering out the organelle sequences, HIC splicing was performed using the 3D-DNA process to obtain the chromosome-level genome. The highly heterogeneous sex chromosomes U and V in the female and male plants were preliminarily identified based on the HIC heat map. The specific operations are as follows:

[0064] For the corrected assembly results obtained in step S4, the organelle sequences were filtered out by BLASTN alignment of the moss organelle sequence database of the NCBI BLAST toolkit, and then HIC splicing was performed to obtain the genome at the chromosome level. FastQC and Trimmomatic were used to filter the offline data of the HIC library with default parameters. After obtaining high-quality data without adapter sequences, the commonly used Juicer process was used to extract the read pairs containing valid data in the PEreads pair, i.e., valid pairs. The output of Juicer is the screened PEreads pair, which contains the interaction information of chromatin DNA, as the input of the 3D-DNA pipeline. Since the quality of the preliminary assembly is good and the continuity is strong, such as the scaffold N50 reaching 37Mb, the visualize module of 3D-DNA was first used to visualize the input genome to evaluate the Hi-C interactions between each contig / scaffold and within the contig / scaffold. The output of this module is the ".hic" and ".assembly" files that match the genome. At this time, it is used as the input file, starting directly from the original assembly, using Juicebox, a desktop software developed by Aiden Lab that can manually adjust the Hi-C heat map, to splice, turn and cut contigs / scaffolds according to the Hi-C interactive heat map. After saving the new ".assembly" file, import it into the review module of 3D-DNA to generate the manually adjusted chromosome-level genome sequence. The male and female genomes of snake moss are mounted on 9 chromosomes respectively, with a genome size of ~287Mb, which is very close to the estimated 300Mb, and the scaffold N50 reaches 37Mb, there is no gap in the chromosome, and the assembly continuity is excellent.

[0065] S6 repeat sequence annotation and gene prediction:

[0066] The chromosome-level genome assembly results obtained in step S5 were annotated with RepeatMasker for repetitive sequences, predicted with the BRAKER2 process for protein-coding genes, annotated with Eggnog-mapper for protein functions, and evaluated for the completeness of the protein set with BUSCO. The specific operations are as follows:

[0067] Repetitive sequences in the genome refer to DNA fragments with similar base sequences or symmetry located in different regions of the genome. Similar base sequences include similar fragments in the same genome as well as similar fragments in the genomes of different species. Repetitive sequences exist in the genomes of almost all eukaryotic organisms, accounting for about 50% of the human genome, and generally account for a higher proportion in plant genomes. In order to accurately annotate the gene structure later, the repetitive sequences in the genome need to be identified and masked first. In this study, RepeatMasker software (https: / / www.repeatmasker.org / ) was used to identify repetitive sequences in the moss genome using RepBase as the repetitive sequence database, and the search engine used was set to RMblast of the NCBI BLAST toolkit to obtain faster search speed and higher accuracy.

[0068] The repetitive sequences in the genome were masked according to the repetitive sequence loci information in the repetitive sequence annotation file, and then the BRAKER2 process was used to annotate the genome for protein genes. BRAKER2 calls the ab initio annotation tool Genemark (http: / / exon.gatech.edu / GeneMark / ) for ab initio prediction, and only needs to specify the operation mode as eukaryotic ("--ES"), and combines homologous protein evidence and transcriptome evidence. The specific parameters for BRAKER2 operation are "--etpmode--prot_seq=prot.fa--bam=accepted_hits.bam--softmasking--gff3", where "--etpmode" specifies the operation mode as eukaryotic, transcriptome support and homologous protein support; "prot.fa" is the homologous protein sequence file used; "accepted_hits.bam" is the BAM file output by Tophat2, representing the transcriptome evidence; "--softmasking" indicates that the input genome sequence has been soft-masked; "--gff3" specifies that the additional output is in GFF3 format for subsequent processing.

[0069] After obtaining the gene annotation results, the genome integrity assessment tool BUSCO was run in protein mode to evaluate the completeness of the protein set; at the same time, the online tool EGGNOG-mapper (http: / / eggnog-mapper.embl.de / ) was used to perform functional annotation on the protein set.

[0070] The annotation of repeated sequences, gene annotation, gene function prediction and gene set completeness assessment in this step are standard operating procedures in the field of genomics. This step annotated 30,223 and 30,932 genes for the female and male genomes, respectively.

[0071] Identification of S7 U / V chromosomes and female / male specific genes:

[0072] According to the assembly result of step S5, the gene on the sex chromosome of liverwort is used to search the protein set of snake moss, and it is found that the gene on the chromosome UV of liverwort is concentrated on the chromosome 9 that matches the assembly result of snake moss, thereby confirming that chromosome 9 is a sex chromosome. Then, by comparing the genome sequence of female / male plants of snake moss with global collinearity, it is found that the 8 autosomes (chr1-chr8) of female and male plants of snake moss have extremely high collinearity, while the sex chromosome (U / V) has almost no collinearity at all, so the sex chromosomes of male and female plants can be further determined and their chromosome numbers can be obtained. Then, the protein set of female / male plants is compared in pairs with BLASTP of NCBI BLAST toolkit, and the e-value threshold is set to 1e-5 to obtain the comparison file. Combined with the numbering of sex chromosomes, the genes specific to the sex chromosomes of female and male plants, i.e., male-female specific genes, are determined.

[0073] In this step, the U and V sex chromosomes of the female and male plant assembly results are determined by blastp and global comparison evidence of the known sex-determining genes of liverwort. The unique gene numbers on the female and male chromosomes are obtained by comparing the files. The U chromosome is 1.30Mb long and encodes 28 genes, of which 5 genes are female-specific; the V chromosome is 4.95Mb long and encodes 32 genes, of which 9 genes are male-specific.

[0074] Primer design for S8 female / male specific gene fragment:

[0075] The female / male specific gene number identified by step S7 is projected onto the gene sequence of the sex chromosome U / V of the female / male snake moss, and the conservative exon region is selected, and the primer design is performed inside the exon region. In order to improve the amplification efficiency, the principle of primer design is: the target fragment length of the amplification is 200-500bp. At the same time, the primer length is 18-25bp, the primer GC content is 40%-60%, the 3′ end of the primer should avoid the third position of the codon, the 3′ end of the primer cannot select A, the bases should be randomly distributed, and there should be no complementary sequence between the primers themselves and between the primers, and the single strand of the amplified product cannot form a secondary structure. The naming of the primer adopts C (the first letter of the English letter of snake moss Conocephalum) + U / V (the sex chromosome where the specific fragment is located) + the target fragment size obtained by primer amplification, for example, CV234 represents a primer pair with a target amplification length of 234bp on the V chromosome. After the primers are designed, Jin Weizhi Company is commissioned to synthesize the primers, and they are dissolved and diluted to a working concentration of 10uM.

[0076] In this step, since sex chromosomes contain extremely high repetitive sequences, it is safer to design primers within the exon region of the female / male specific gene to ensure the specificity and accuracy of amplification. Initially, a total of 4 pairs of primers were designed. After preliminary experiments, 2 pairs of primers can produce male-female specific amplification products for the identification of male / female snake moss. The 2 pairs of primers are 1 pair of female specific amplification primers (CU380F and CU380R) and 1 pair of male specific amplification primers (CV234F and CV234R).

[0077] The sequences of the two pairs of primers are as follows:

[0078] Primer sequence, from 5' to 3'

[0079] Primer CV234F:

[0080] SEQ ID NO:1:CAGGGTGGTTCACGTTGACTCC

[0081] Primer CV234R:

[0082] SEQ ID NO:2: GCAGCAGTGTTATAGGTGGG

[0083] Primer CU380F:

[0084] SEQ ID NO:3: GGAAGGGGGTACATGGAGATCA

[0085] Primer CU380R:

[0086] SEQ ID NO:4:ACGTGCCAGTGGAAGAGTTC

[0087] 2. Practical application of primers for identifying the sex of snake moss:

[0088] Eleven female and male samples with significant differentiation in the reproductive growth stage of snake moss were selected, and a small amount of leaves were taken from each sample, and the DNA of the samples was extracted by the CTAB method. The two pairs of primers obtained in step S8 were used to perform PCR amplification on the female / male DNA samples. The PCR reaction system was 25uL, including 12.5uL PCR premix (2x Vazyme Lamp Master Mix, DyePlus, catalog number: Norway P312-01), 1uL DNA template, 9.5uL deionized water, 1uL forward primer and 1uL reverse primer. The cycle setting of PCR amplification was 95°C pre-denaturation for 3 minutes, 95°C denaturation for 1 minute, 55°C annealing for 1 minute, 72°C extension for 45 seconds, and 72°C extension for 10 minutes after 35 reaction cycles.

[0089] Take 5uL of PCR product and load it on 1% agarose gel. The electrophoresis conditions are: current 80A, voltage 120V, electrophoresis buffer 1×TAE. After 20 minutes of electrophoresis, take a picture under the UV light of BIO-RAD gel imaging system. The results are shown in Figure 1 There are 2 rows in the electrophoresis, which are the amplification results of 2 pairs of primers: the bands amplified by the female-specific amplification primer pair (CU380F and CU380R) are female snake mosses, and the bands amplified by the male-specific amplification primer pair (CV234F and CV234R) are male snake mosses.

[0090] Conclusion: The designed male and female identification primers CV234 and CU380 have strong specificity, high efficiency and good amplification effect in male and female samples of snake moss, and can be used to quickly and accurately identify male and female plants of snake moss.

Claims

1. A primer pair for sex identification of snake moss, characterized in that: The primer pair is a male-specific amplification primer pair and a female-specific amplification primer pair, the male-specific amplification primer pair is CV234F and CV234R, and the female-specific amplification primer pair is CU380F and CU380R.

2. The primer pair for sex identification of snake moss as claimed in claim 1, characterized in that: The nucleotide sequence of the primer CV234F is shown in SEQ ID NO:1, the nucleotide sequence of the primer CV234R is shown in SEQ ID NO:2, the nucleotide sequence of the primer CU380F is shown in SEQ ID NO:3, and the nucleotide sequence of the primer CU380R is shown in SEQ ID NO:

4.

3. Use of the primer pair for sex identification of snake moss according to claim 1 or 2 in preparing a kit for sex identification of snake moss.

4. A kit, characterized in that: The kit contains the primer pair for rapid sex identification of snake moss according to claim 1 or 2.

5. A method for identifying the sex of snake moss, characterized in that: The identification method is carried out according to the following steps: (1) Take leaves of snake moss in the reproductive growth stage and extract DNA samples using the CTAB method; (2) performing PCR amplification on the DNA sample of step (1) using a male-specific amplification primer pair to obtain a male PCR product, wherein the nucleotide sequences of the male-specific amplification primer pair are shown in SEQ ID NO: 1 and SEQ ID NO: 2; (3) performing PCR amplification on the DNA sample of step (1) using a female-specific amplification primer pair to obtain a female PCR product, wherein the nucleotide sequence of the female-specific amplification primer pair is shown in SEQ ID NO: 3 and SEQ ID NO: 4; (4) Take 5uL of the male PCR product of step (2) and the female PCR product of step (3) and load them on 1% agarose gel respectively, perform electrophoresis for 20 minutes, take pictures under UV light of BIO-RAD gel imaging system, and determine the male and female plants of snake moss based on the electrophoresis results.

6. The method for identifying the sex of snake moss as claimed in claim 5, characterized in that: In the step (2), the PCR reaction system is: 12.5uL of PCR premix, 1uL of DNA sample, 9.5uL of deionized water, 1uL of CV234F primer pair, and 1uL of CV234R primer pair.

7. The method for identifying the sex of snake moss as claimed in claim 5, characterized in that: In the step (3), the PCR reaction system is: 12.5uL of PCR premix, 1uL of DNA sample, 9.5uL of deionized water, 1uL of CU380F primer pair and 1uL of CU380R primer pair.

8. The method for identifying the sex of snake moss as claimed in claim 5, characterized in that: In the step (2), the PCR amplification cycle is set as: 95°C pre-denaturation for 3 minutes, 95°C denaturation for 1 minute, 55°C annealing for 1 minute, 72°C extension for 45 seconds, and after 35 reaction cycles, further extension at 72°C for 10 minutes.

9. The method for identifying the sex of snake moss as claimed in claim 5, characterized in that: In the step (3), the PCR amplification cycle is set as: 95°C pre-denaturation for 3 minutes, 95°C denaturation for 1 minute, 55°C annealing for 1 minute, 72°C extension for 45 seconds, and after 35 reaction cycles, further extension at 72°C for 10 minutes.

10. The method for identifying the sex of snake moss as claimed in claim 5, characterized in that: In the step (4), the electrophoresis conditions are: current 80A, voltage 120V, and electrophoresis buffer 1×TAE.

Images