A snp molecular marker related to body weight of chickens at multiple ages and application thereof

Abstract

The application discloses a SNP molecular marker related to the body weight of chickens at multiple ages and application thereof, and particularly relates to a SNP site related to the body weight of chickens at two weeks, four weeks, six weeks, eight weeks, ten weeks and twelve weeks, wherein the SNP site chr1:170585684 is located in an intron region of RCBTB1, the body weight of individuals of a crossbreeding population of chickens at multiple ages is determined and recorded, 1164 chickens are sequenced by using resequencing technology, whole genome association analysis is carried out, a SNP site affecting the body weight at different ages is obtained, the SNP frequency of the SNP site in other low-weight chicken species and high-weight chicken species in resequencing is counted, and it is found that the SNP site has significant difference in the low-weight chicken species and the high-weight chicken species, T is the dominant allele in the high-weight chicken, and C is the dominant allele in the low-weight chicken, and in the population with low weight, the body weight of the breeding population can be improved by selecting individuals with the T allele of the site.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular biology, in particular to a SNP molecular marker related to the body weight of chickens at multiple ages and its application, and more particularly to a SNP molecular marker related to the body weight of chickens at two weeks, four weeks, six weeks, eight weeks, ten weeks and twelve weeks and its application. BACKGROUND

[0002] Chicken is one of the main meat varieties in China, which has the characteristics of high protein, low fat and low cholesterol. In recent years, the output of chicken in China has been increasing continuously, and improving muscle yield and quality has become the long-term exploration of breeding scientists. The classical breeding method has made a great contribution to the improvement of production traits of agricultural animals. With the continuous advancement of genome work and the extensive development of genetic markers, breeding scientists can select chickens with good yield and quality characteristics for breeding according to specific genetic markers. These genetic markers can help breeding scientists more accurately assess and select the genetic potential of chickens and accelerate the breeding process.

[0003] SNP (Single Nucleotide Polymorphism) is one of the common genetic variations in genetics. SNP has the advantages of large quantity, high frequency and low mutation rate, and plays an important role in genetic research and molecular selection breeding. However, there is still a lack of molecular markers with clear function and significant effect in the practice of broiler molecular breeding. Therefore, it is the current research focus to excavate molecular markers with large effect and accuracy. If a SNP molecular marker related to the target traits of chickens can be found and the molecular mechanism of the site is finally analyzed, it will greatly promote the genetic improvement of chickens and bring breakthrough progress to the field of poultry breeding. SUMMARY

[0004] In view of the deficiencies in the prior art, the present application aims to provide a SNP molecular marker related to the body weight of chickens at multiple ages and its application. The individuals of a cross population of 1164 chickens with different body weight records at different ages are sequenced by re-sequencing technology, GWAS analysis is performed, and a SNP site significantly related to the body weight of chickens at two, four, six, eight, ten and twelve weeks is obtained. The SNP is rs13971913 (chr1: 170585684) located in the genome version GRCg6a104. The polymorphism of the SNP molecular marker is C and T, and includes three genotypes of CC, TT and CT. The SNP frequency of the SNP in other low-weight chicken species and high-weight chicken species in the re-sequencing is counted, and it is found that there is a significant difference between the low-weight chicken species and the high-weight chicken species. In the high-weight chicken, the T allele is dominant, and in the low-weight chicken, the C allele is dominant. In the population with lower body weight, by selecting individuals with the T allele, the body weight of the chicken can be improved.

[0005] In order to solve the above technical problems, the technical solution provided by the present invention is:

[0006] A SNP molecular marker associated with chicken weight at multiple weeks of age,

[0007] The SNP molecular marker is located at chr1:170585684 of genome GRCg6a 104, and the alleles of the SNP site are T and C; including three genotypes: TT, TC and CC;

[0008] The economic traits are weight at two weeks of age, weight at four weeks of age, weight at six weeks of age, weight at eight weeks of age, weight at ten weeks of age, and weight at twelve weeks of age;

[0009] T is the dominant allele in high-weight chickens, and C is the dominant allele in low-weight chickens.

[0010] Preferably,

[0011] The SNP molecular marker is located at the 101st base in the nucleotide sequence shown in SEQ ID NO.1.

[0012] Application of the above-mentioned SNP molecular markers in the detection of weight traits of chickens at multiple weeks of age.

[0013] The above application includes the following steps:

[0014] (1) detecting the genotype of the sample chicken at the SNP site;

[0015] (2) Select sample chickens with T / T genotype for breeding of dominant strains.

[0016] Preferably,

[0017] The step (1) can be performed by direct sequencing, or by first amplifying the gene fragment containing the SNP molecular marker and then detecting it. For example, primers are designed to amplify the fragment containing the SNP molecular marker from the sequence shown in SEQ ID NO.1, and then the allele at the site is detected.

[0018] A primer pair for amplifying the SNP site fragment according to claim 1, wherein the sequences of the primer pair are shown in SEQ ID NO. 2 and SEQ ID NO. 3.

[0019] The application of the above-mentioned SNP molecular markers in marker-assisted selection breeding,

[0020] Select chickens with T / T genotype for breeding.

[0021] The beneficial effects of the present invention are:

[0022] The application provides a SNP molecular marker related to the body weight of chickens of multiple ages and application thereof, and genotypes 1164 chickens at a SNP site chr1:170585684, analyzes the SNP frequency of the site in low body weight chicken breeds and high body weight chicken breeds, finds that T is the dominant allele in high body weight chickens, and C is the dominant allele in low body weight chickens. In the population with lower body weight, the body weight of the population can be improved by selecting individuals with the allele T, the site is applied to the breeding of excellent chicken breeds as a SNP molecular marker, can early, quickly, low-cost and effectively predict whether the body weight is high or low, has a wide application prospect in chicken breed improvement, and can achieve excellent economic value. BRIEF DESCRIPTION OF DRAWINGS

[0023] The accompanying drawings are included to provide a further understanding of the application, and constitute a part of the specification, illustrate the application, and are used to explain the application together with the embodiments of the application, and do not constitute a limitation on the application. In the drawings:

[0024] FIG. 1A Manhattan plot of two-week-old body weight GWAS results

[0025] FIG. 1B Manhattan plot of four-week-old body weight GWAS results

[0026] FIG. 1C Manhattan plot of six-week-old body weight GWAS results

[0027] FIG. 1D Manhattan plot of eight-week-old body weight GWAS results

[0028] FIG. 1E Manhattan plot of ten-week-old body weight GWAS results

[0029] FIG. 1F Manhattan plot of twelve-week-old body weight GWAS results DETAILED DESCRIPTION

[0030] The preferred examples of the application are described below in combination with the drawings, and it should be understood that the following examples are given only for the purpose of illustration, and are not used to limit the scope of the application. Those skilled in the art can make various modifications and replacements to the application without departing from the purpose and spirit of the application.

[0031] The application provides a SNP molecular marker related to the body weight of chickens at multiple ages and an application thereof. The SNP molecular marker is located in an intron region of RCBTB1, the genome GRCg6a 104 chr1:170585684, and the SNP molecular marker is located at the 101th base in the nucleotide sequence shown in SEQ ID NO. 1. The alleles of the SNP site are C and T. The economic traits are the body weight of chickens at two weeks, four weeks, six weeks, eight weeks, ten weeks and twelve weeks, and in high-weight chickens, T is the dominant allele, and in low-weight chickens, C is the dominant allele. In the population with lower weight, by selecting individuals with the allele T, the body weight of the chickens can be improved.

[0032] SEQ ID NO. 1 (chr1:170585584-170585784)

[0033] caccgtaacaaggctacagtcccagtcacgacatgcattttcctttttattttcaataagaagctgagtcattagcacaacttaat

[0034] gaagccattcgctctggatgagacaccctaaaaaacccacctatattccagcaagacgcatacagaaataagaatgcaaag

[0035] gccccacggagtaaggctccaaagatttgttctc

[0036] Example 1: Whole genome association analysis of chicken body weight at different ages

[0037] 1. Test materials

[0038] The individuals of a chicken hybrid population are used as the research object, and the body weight of 1164 chicken individuals is measured at two weeks, four weeks, six weeks, eight weeks, ten weeks and twelve weeks, and the determination is strictly performed according to the internal specifications of the chicken farm.

[0039] 2. Test method

[0040] 2.1 Phenotype determination

[0041] When the chicken reaches the corresponding age, each chicken is placed on a weighing device, and the chicken is kept relatively quiet and balanced, then the displayed body weight value is recorded, and the gender is recorded.

[0042] 2.2 Chicken whole genome SNP typing method based on resequencing technology

[0043] The sequencing data was aligned to GRCg6a 104 reference genome using gtx align, SNP site detection was performed using Basevar, and STITCH was used to estimate the genotype probability of all individuals. For the SNP sites obtained by typing, high-quality sites were retained according to the filtering criteria of MAF < 0.05, site call rate < 0.95, and info score < 0.4, and a total of 7,901,521 SNPs were obtained.

[0044] The specific steps of amplification are as follows: the blood tissue of the hybrid population sample is used to extract DNA using the total DNA extraction kit of Beijing Tiangeng Biological Technology Co., Ltd., and the OD value of the extracted DNA is detected by spectrophotometer, i.e. OD 260 / OD 280 and OD 260 / OD 230 ratio to determine the concentration and purity of DNA, and agarose gel electrophoresis is used to detect the integrity of DNA. The genome of the hybrid population sample is used as a template, and the corresponding primers are designed for its sequence using Oligo7 software. The sequence amplification is performed using Novozyme 2xTaq Master Mix, and the reaction system is as follows: 95℃, pre-denaturation for 3min; 95℃, denaturation for 15s, 60℃, annealing for 15s, 72℃, extension for 15s, 30 cycles; 72℃, complete extension for 5min. Finally, agarose gel electrophoresis is used to detect the product fragment size.

[0045] The primer pair sequence for amplifying the fragment containing the above-mentioned SNP site is as follows:

[0046] The primer pair sequence is as follows:

[0047] F: CACCGTAACAAGGCTACAGT (SEQ ID NO. 2)

[0048] R: GAGAACAAATCTTTGGAGC (SEQ ID NO. 3)

[0049] 2.3 Whole genome association analysis

[0050] FastGWA was used to perform whole genome association analysis on the body weight phenotypes of 1164 chickens at two weeks, four weeks, six weeks, eight weeks, ten weeks and twelve weeks.

[0051] 2.4 SNP sites significantly related to body weight traits

[0052] The detection of significant sites at the genome level was performed according to FDR < 0.05 to identify significant sites.

[0053] 3. Results and analysis

[0054] The present application takes 1164 chickens of a crossbreeding population as the object, uses 7,901,521 SNPs obtained by resequencing technology to perform GWAS analysis on the body weight of chickens at different ages, and determines a SNP (chr1: 170585684) site significantly related to the body weight of chickens at different ages, as shown in Figure 1.

[0055] Example 2 Frequency distribution of SNP (chr1: 170585684) in different chicken breeds

[0056] 1. Test material

[0057] Low-weight chicken breeds: Mustache chicken (n=15), Beijing oil chicken (n=25), tea flower chicken (n=30), Daweishan miniature chicken (n=33), silk feather chicken (n=57) and Tibetan chicken (n=154).

[0058] High-weight chicken breeds: Lingnan yellow-feather broiler (n=16), white-feather broiler (n=20), Kobao chicken (n=33) and recessive white-feather chicken (n=113).

[0059] 2. Test method

[0060] 2.1 Data collection

[0061] The whole genome resequencing data of the above-mentioned from 6 low-weight chicken breeds and 4 high-weight chicken breeds were downloaded from the SRA database of NCBI (https: / / ncbi.nlm.nih.gov / sra).

[0062] 2.2 SNP typing using GATK

[0063] The gVCF of the above-mentioned resequencing samples was constructed based on the GRCg6a 104 reference genome using the GTX server gtx wgs command, and then the joint variant detection was performed on all gVCF samples using the gtx gi and gtxjoint commands, and the genotype VCF file was obtained.

[0064] 2.3 Filtering and quality control of SNPs

[0065] After the joint variant detection, the SelectVariants tool of the GATK software package was used to extract the SNP site, and then the VariantFiltration tool of the GATK software package was used to quality control the whole genome resequencing data according to the following hard filtering parameters: MQ<40.0, FS>60.0, SOR>3.0, MQRankSum<-12.5, ReadPosRankSum<-8.0, QUAL<30, and finally after the above quality control, a total of 44,272,587 resequencing SNP sites were obtained.

[0066] 2.4 Calculate the allele frequency of chr1: 170585684 in different chicken breeds

[0067] The allele frequency of chr1: 170585684 in different chicken breeds was calculated using vcftools--freq2.

[0068] 3. Results and analysis

[0069] The results of the SNP frequency distribution of SNP (chr1: 170585684) in different low-weight chicken breeds and high-weight chicken breeds are shown in Table 1. There is a significant difference between low-weight chicken breeds and high-weight chicken breeds. In high-weight chickens, T is the dominant allele, and in low-weight chickens, C is the dominant allele.

[0070] Table 1 SNP (chr1: 170585684) SNP frequency in different low-weight chicken breeds and high-weight chicken breeds

[0071]

[0072]

[0073] Analysis found a SNP molecular marker related to chicken weight at multiple ages, and in populations with lower weight, breeding individuals with allele T / T can improve the weight of the breeding population.

[0074] The contents not described in detail in the specification belong to the prior art known to those skilled in the art.

[0075] Finally, it should be noted that the above description is only a preferred example of the present application and does not limit the present application. Although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent replacements to some technical features. Any modification, equivalent replacement, improvement, etc. within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. Application of a SNP molecular marker related to chicken weight at multiple ages in detection of chicken weight at multiple ages, characterized in that the SNP molecular marker is located at chr1: 170585684 bp of the genome GRCg6a 104, the SNP site has alleles T and C, and contains three genotypes TT, TC and CC; the economic traits are chicken weight at two weeks, four weeks, six weeks, eight weeks, ten weeks and twelve weeks; T is the dominant allele in high weight chickens, and C is the dominant allele in low weight chickens.

2. The application of the SNP molecular marker related to chicken weight at multiple ages in detection of chicken weight at multiple ages according to claim 1, characterized in that the SNP molecular marker is located at the 101st base in the nucleotide sequence shown in SEQ ID NO.

1. comprising the following steps: (1) detecting the genotype of the sample chicken at the SNP site; 3. The use according to claim 1, characterized in that (2) selecting sample chickens with the T / T genotype for breeding of the dominant strain.

4. The application according to claim 3, characterized in that the step (1) can use direct sequencing, or first amplifies the gene fragment containing the SNP molecular marker and then detects.

5. The application of the SNP molecular marker related to chicken weight at multiple ages in detection of chicken weight at multiple ages according to claim 4, characterized in that the primer pair sequence for amplifying the SNP site fragment is shown in SEQ ID NO. 2 and SEQ ID NO.

3.

6. Application of a SNP molecular marker related to chicken weight at multiple ages in marker-assisted selection breeding, characterized in that the SNP molecular marker is located at chr1: 170585684 bp of the genome GRCg6a 104, the SNP site has alleles T and C, and contains three genotypes TT, TC and CC; the economic traits are chicken weight at two weeks, four weeks, six weeks, eight weeks, ten weeks and twelve weeks; T is the dominant allele in high weight chickens, and C is the dominant allele in low weight chickens; select chickens with the genotype T / T for breeding. ​ ​ ​ ​ ​

Images