Application of SNP (Single Nucleotide Polymorphism) genetic marker related to freezing tolerance of pig sperms in PPP3CA gene in pig genetic breeding

Abstract

The invention provides an application of an SNP (Single Nucleotide Polymorphism) genetic marker related to the freezing tolerance of a pig sperm in a PPP3CA gene in pig genetic breeding, and belongs to the technical field of pig genetic marker detection, and the SNP genetic marker related to the freezing tolerance of the pig sperm in the PPP3CA gene is named as g.119750378Agt; c is located at the nucleotide site 119750378bp of the pig chromosome 8 of the reference sequence of the international pig genome version 11.1, the basic group of the site is A or C, and the g.119750378Agt is located at the nucleotide site 119750378bp of the pig chromosome 8 of the reference sequence of the international pig genome version 11.1; c is located in an intron region of the PPP3CA gene and corresponds to the 174bp position in the nucleotide sequence as shown in SEQ ID NO: 1. The boar individuals with the dominant genotype AA have better frozen sperm quality, so that the boar individuals with the dominant genotype AA have the advantages that the frozen sperm quality of g.119750378Agt is improved; c is applied to genetic breeding of boars, and the frozen semen quality of the breeding boars can be improved in an auxiliary manner from the gene level.

Description

Technical Field

[0001] The invention belongs to the technical field of pig genetic marker detection, and particularly relates to the application of a SNP genetic marker related to pig sperm freezing resistance in the PPP3CA gene in pig genetic breeding. Background Art

[0002] The pig semen cryopreservation technology is of great significance in promoting cross-regional exchanges of excellent boars, coping with seasonal semen shortages, ensuring biosafety prevention and control, and improving the economic benefits of breeding enterprises. It also provides a guarantee for the long-term preservation of genetic resources of local pig breeds in my country. For boars with excellent economic traits, the use of semen cryopreservation technology to preserve their semen can make artificial insemination no longer restricted by time and space, improve the utilization efficiency of excellent boars, achieve greater genetic progress, and reduce the risk of disease transmission. During the process of semen cryopreservation, temperature changes cause chemical and physical damage to sperm, resulting in poor quality of semen after thawing, which is manifested as a decrease in sperm motility, fertilization ability and sow litter size after thawing, which seriously affects the application of pig frozen semen and the sales of frozen semen products, and restricts the industrialization development of frozen semen in pig farms and breeding progress.

[0003] The quality of frozen semen of pigs is affected by many factors such as age, nutrition and cryopreservation process. At present, most studies on improving the quality of frozen semen focus on sperm cryotolerance-related proteins and metabolites. At the protein level, heat shock protein HSP90AA1, redox proteins (GSTM3, PRDX5 and ALB) and spermatogenic proteins (HSPA5, MFGE8 and DNAH1) were found to be related to sperm cryotolerance. At the metabolite level, lipids such as phosphatidylcholine, linoleic acid and docosahexaenoic acid were found to affect the quality of frozen semen. In addition, in cryoprotectants, adding polysaccharides, nanoparticles and other substances has also been shown to improve the quality of frozen semen to a certain extent. However, such methods are limited to maintaining the quality of frozen semen at a level comparable to that of fresh semen, and cannot fundamentally improve the quality of frozen semen of boars. Therefore, from the perspective of individual genetics of boars, exploring and identifying genes and markers that affect the cryotolerance of pig sperm at the molecular level, and using SNP genetic markers to screen excellent boars with high sperm cryotolerance will essentially improve the quality of frozen semen of boars.

[0004] The existing technologies are basically developed for SNP genetic markers associated with the vitality of fresh semen of boars, such as: (1) SNP in the third exon of CATSPER4 gene as a genetic marker for pig semen quality traits (application publication number: CN109837347 A), the invention relates to the association between SNP in the third exon of CATSPER4 gene and pig sperm density, sperm vitality, and sperm deformity rate; (2) Molecular genetic markers associated with boar sperm deformity rate and their application and acquisition methods (application publication number: CN 110144414 A), the boar sperm deformity rate-related molecular genetic markers involved in the invention are located at the 8647231bp position of chromosome 3 of pigs, and the T>C mutation is associated with the pig sperm deformity rate; (3) Molecular genetic markers associated with boar sperm linear motion and their application and acquisition methods (application publication number: CN 110195115 A) A), the invention relates to molecular markers related to the linear motion of boar spermatozoa, including the T>C mutation at position 136112947bp of chromosome 15, the A>G mutation at position 18505448bp of chromosome 3, and the C>T mutation at position 63272581bp of chromosome 11; (4) SNP markers related to the effective sperm count of boars, and methods for obtaining and using the same (application publication number: CN 110273007 A), the invention relates to 5 molecular markers related to the effective sperm count of boars, including ASGA0105629, H3GA0010032, ALGA0024878, WU_10.2_8_31060162 and WU_10.2_9_11535520; (5) A SNP genetic marker associated with semen quality traits of pigs and its application (application publication number: CN 113215277A), the invention relates to the association of SNP genetic markers in the 7th exon of SPAG6 gene with pig semen volume, sperm density, sperm motility and sperm deformity rate; (6) C7H15orf39 gene SNP molecular markers associated with pig semen quality traits and their applications (application publication number: CN 113930521 A), the invention relates to the Taq I-RFLP polymorphism caused by a base substitution of G>T at the 281st base of the C7H15orf39 gene fragment, which shows that the sperm motility trait of individuals with TT genotype is optimal; (7) A molecular marker method related to the trait of boar sperm deformity rate (application publication number: CN 115831220A), the invention uses the molecular marker of A / G mutation at 163993991bp of chromosome 6 of pig for marker-assisted selection, which can greatly accelerate the genetic improvement of sperm deformity rate of Duroc breeding pigs; (8) SNP molecular markers, primer pairs and their applications related to boar semen quality traits in ATP11A gene (application publication number: CN 116790764 A), the invention discloses a SNP molecular marker, primer pairs and their applications related to boar semen volume, sperm density and sperm motility traits in ATP11A gene.

[0005] At present, most inventions focus on technical method research on SNP genetic markers associated with the vitality of fresh semen of boars, including the density, vitality, linear motion rate, deformity rate, etc. of sperm in fresh semen. However, there are few related invention technologies on developing SNPs associated with the freezing resistance of boar sperm and improving the quality of frozen semen of boars. Summary of the invention

[0006] In order to solve the problem of poor quality of frozen semen of boars, the present invention provides an application of a SNP genetic marker related to the freezing resistance of pig sperm in the PPP3CA gene in pig genetic breeding. The SNP genetic marker related to the freezing resistance of pig sperm in the PPP3CA gene is g.119750378A>C, which is located in the intron region of the PPP3CA gene. Boar individuals with its dominant genotype AA have better frozen semen quality. Therefore, applying g.119750378A>C to pig genetic breeding can help improve the quality of frozen semen of boars from a genetic level.

[0007] The present invention is achieved through the following technical solutions:

[0008] The present invention provides an application of a SNP genetic marker related to the freezing resistance of pig sperm in the PPP3CA gene in pig genetic breeding. The SNP genetic marker related to the freezing resistance of pig sperm in the PPP3CA gene is named g.119750378A>C, which is located at the 119750378bp nucleotide site of pig chromosome 8 in the international pig genome version 11.1 reference sequence, and the base of the site is A or C. The g.119750378A>C is located in the intron region of the PPP3CA gene, corresponding to the 174bp position in the nucleotide sequence shown in SEQ ID NO:1;

[0009] The pig genetic breeding is the genetic breeding of pigs regarding sperm freezing resistance;

[0010] Among them, the freezing resistance of sperm of AA genotype individuals of g.119750378A>C is higher than that of AC genotype individuals; the freezing resistance of sperm of AC genotype individuals of g.119750378A>C is higher than that of CC genotype individuals;

[0011] The pig breed includes at least one of Duroc pig, Landrace pig and Large White pig.

[0012] Based on the same inventive concept, the present invention provides an early selection method for the freezing resistance trait of pig sperm, the early selection method comprising performing early selection on the freezing resistance trait of pig sperm based on the genotype of the SNP genetic marker g.119750378A>C;

[0013] The g.119750378A>C is located at the 119750378bp nucleotide position of the pig chromosome 8 in the international pig genome version 11.1 reference sequence, and the base of the position is A or C. The g.119750378A>C is located in the intron region of the PPP3CA gene, corresponding to the 174bp position in the nucleotide sequence shown in SEQ ID NO:1;

[0014] Among them, the freezing resistance of sperm of AA genotype individuals of g.119750378A>C is higher than that of AC genotype individuals; the freezing resistance of sperm of AC genotype individuals of g.119750378A>C is higher than that of CC genotype individuals;

[0015] The pig breed includes at least one of Duroc pig, Landrace pig and Large White pig.

[0016] Furthermore, the early selection method specifically includes:

[0017] Detect the genotype of the SNP genetic marker g.119750378A>C in the pig genome to be tested;

[0018] Based on the genotype of g.119750378A>C, early selection was performed on the sperm freeze-resistance trait of the tested pigs.

[0019] Further, the genotype of the SNP genetic marker g.119750378A>C in the pig genome to be tested is specifically detected, including:

[0020] The genomic DNA of the pig to be tested was amplified by PCR using forward primer F1 and reverse primer R1 as primers;

[0021] The PCR amplification product was sequenced to obtain the genotype of the 119750378 bp nucleotide site of the pig chromosome 8 to be tested;

[0022] The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO.2; the nucleotide sequence of the reverse primer R1 is shown in SEQ ID NO.3.

[0023] Based on the same inventive concept, the present invention provides an application of a primer for detecting a SNP genetic marker g.119750378A>C in pig genetic breeding, wherein the g.119750378A>C is located at the 119750378bp nucleotide site of the reference sequence of the international pig genome version 11.1 on chromosome 8 of pig, the base of which is A or C, and the g.119750378A>C is located in the intron region of the PPP3CA gene, corresponding to the 174bp position in the nucleotide sequence shown in SEQ ID NO:1;

[0024] The primers for detecting the SNP genetic marker g.119750378A>C include a forward primer F1 and a reverse primer R1, the nucleotide sequence of the forward primer F1 is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer R1 is shown in SEQ ID NO.3;

[0025] The pig genetic breeding is the genetic breeding of pigs regarding sperm freezing resistance;

[0026] Among them, the freezing resistance of sperm of AA genotype individuals of g.119750378A>C is higher than that of AC genotype individuals; the freezing resistance of sperm of AC genotype individuals of g.119750378A>C is higher than that of CC genotype individuals;

[0027] The pig breed includes at least one of Duroc pig, Landrace pig and Large White pig.

[0028] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0029] The invention discloses an application of a SNP genetic marker related to the freezing resistance of pig sperm in the PPP3CA gene in pig genetic breeding. The SNP genetic marker related to the freezing resistance of pig sperm in the PPP3CA gene is g.119750378A>C, which is located in the intron region of the PPP3CA gene. Boar individuals with its dominant genotype AA have better frozen sperm quality. Therefore, applying the SNP genetic marker g.119750378A>C to the genetic breeding of boars can assist in screening boar individuals with higher sperm freezing resistance, thereby substantially improving the quality of frozen semen obtained from boars, increasing the utilization rate of high-quality boars, and thereby maximizing the economic benefits of pig farming enterprises. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0031] Figure 1 This is an agarose gel electrophoresis detection diagram of the PCR amplification product in step S2 of Example 4 of the present invention: DL2000 is a marker, lanes 1-3 are amplified fragments in pigs, and the fragment size is 492 bp respectively.

[0032] Figure 2 This is the sequencing map of the g.119750378A>C site of the PPP3CA gene in step S3 of Example 4 of the present invention. DETAILED DESCRIPTION

[0033] The present invention will be described in detail below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.

[0034] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. In the event of a conflict, the present specification takes precedence.

[0035] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0036] The overall idea of ​​the present invention is as follows:

[0037] The present invention aims to solve the technical problem of poor quality of frozen semen of boars in the prior art, and aims to use biological detection technology to provide PPP3CA gene SNP genetic markers associated with pig sperm freezing resistance and their applications, so as to improve the quality of frozen semen of boars and provide new marker resources for auxiliary selection of boars.

[0038] In the early stage, 25 boars with high sperm freezing resistance (frozen sperm motility ≥ 0.6) and 25 boars with low sperm freezing resistance (frozen sperm motility ≤ 0.4) were resequenced. The genetic differentiation index (Fst) was calculated using bioinformatics analysis methods. The A / C mutation of 119750378bp on chromosome 8 was found, which is located in the intron region of the PPP3CA gene. The genetic differentiation between the high and low sperm freezing resistance groups is large, and the Fst is 0.40. Protein phosphatase 3 catalytic subunit α (PPP3CA) is a subtype of calcineurin catalytic subunit A (CNA), which is involved in many important biological processes such as immune response, nervous system development, and spermatogenesis. During spermatogenesis, PPP3CA affects spermatogenesis by regulating the function of dynamin 2 (DNM2) in the sperm acrosome. Abnormal function of this gene can lead to symptoms such as testicular retardation and reduced sperm count, suggesting that this gene plays an important role in livestock reproductive traits. At present, there has been no report on whether the g.119750378A>C site of the PPP3CA gene is related to sperm freezing resistance and whether it can improve the quality of frozen semen of boars.

[0039] The present invention mines SNP genetic markers based on genome resequencing data of 50 individual boars with high and low sperm freezing resistance, and further verifies it in a group of nearly 400 boars, thereby increasing the accuracy and reliability of the PPP3CA gene g.119750378A>C genetic marker associated with pig sperm freezing resistance and its application in the present invention, and can realize biological detection of the frozen semen quality of boars at the molecular level, provide new genetic markers for assisted selection breeding of boars, screen boars with high sperm freezing resistance, essentially improve the quality of frozen semen of boars, and increase the utilization rate of high-quality boars, thereby maximizing the economic benefits of pig farming enterprises.

[0040] The following will describe in detail the application of the SNP genetic marker related to the freezing resistance of pig sperm in the PPP3CA gene of the present application in pig genetic breeding in combination with the examples and experimental data.

[0041] Example 1

[0042] Obtaining the g.119750378A>C site of the PPP3CA gene, a SNP genetic marker for pig sperm freezing resistance.

[0043] 1. Collecting boar semen and extracting genomic DNA

[0044] The boars were aged 1-3 years old, with a strong physique and good reproductive performance. Before semen collection, the semen collection cup, gloves, and semen collection bags were disinfected, and the area around the penis was disinfected and cleaned with a low-concentration potassium permanganate solution. The hair around the penis was trimmed, and the semen was collected by hand. When collecting semen, the colloidal semen at the beginning of ejaculation should be discarded. When the semen is milky white, it is filtered with sterile film filter paper and collected in the semen collection cup with a semen collection bag. The boar genomic DNA was extracted using the animal tissue genomic DNA extraction kit (PureLinkTMPro96Genomic DNA Purification Kit, K182104A) produced by Invitrogen. The extracted DNA was tested for concentration and quality and stored at -20°C for future use. A total of 395 semen samples were collected and their genomic DNA was extracted.

[0045] 2. Collect sperm cryotolerance phenotypic data

[0046] (1) Fresh sperm vitality detection and semen cryopreservation

[0047] The beakers and glass rods used for semen dilution are disinfected in advance, and the glass slides and coverslips are placed on the heating table of the CASA sperm assisted analyzer (Fuzhou Hongshiyi) in advance for preheating at 37°C. The diluent is prepared in advance and placed in a water bath for preheating at 37°C. After collecting fresh semen, use an electronic thermometer to measure the temperature of the semen and the frozen diluent. When the temperature is consistent, 0.1mL of fresh semen is drawn and added to 0.9ml of preheated diluent for a 1:9 dilution. After gently inverting and mixing, 5μL is drawn and dropped on the glass slide, covered with a coverslip, and the above-mentioned CASA sperm analyzer is used to detect sperm density and motility. This is the sperm motility data of fresh pig semen, and records are kept. If the microscopic examination is qualified, the remaining semen is added to the frozen diluent preheated at 37°C in a ratio of 1:1, gently mixed, and left to stand at room temperature at 25°C for about 1h.

[0048] After the standing period, the semen was gently shaken to prevent sperm from being suspended. Then the semen was placed in a program cooling instrument (Beijing Tianyuan Aorui), and the cooling program was set to slowly cool the temperature to 17°C within 1-2 hours. After the cooling was completed, the supernatant was removed by centrifugation at 800g / min for 10-15min at 17°C, and the sperm was resuspended with frozen basic solution I (Beijing Tianyuan Aorui) pre-cooled at 17°C to make the sperm density reach 2 billion / mL. Then the semen was placed in a program cooling instrument (Beijing Tianyuan Aorui) for cooling and balancing. The semen was slowly cooled to 4°C in 2.5-3.0 hours and balanced at 4°C for 0.5-1.0 hours. After balancing, frozen basic solution II (Beijing Tianyuan Aorui) was added, mixed and immediately placed in a low temperature operation cabinet (Germany Min itube) was used to can the semen tubes using a semen canning machine (Minitube, Germany); then, according to the technical requirements of a program freezer (Beijing Tianyuan Aorui), the freezer was started to cool the chamber to 4-5°C, and then the canned semen tubes were put in, and the semen tube freezing reference program was called for cooling. The specific program was: 4°C, constant temperature precooling; 1°C, cooling for 1.5 minutes, rate -2°C / min; -26°C, cooling for 2.4 minutes, rate -30°C / min; -140°C, cooling for 6.2 minutes, rate -30°C / min; -140°C, constant temperature for 21.2 minutes; then put into a liquid nitrogen tank.

[0049] (2) Thawing of semen and detection of frozen semen motility

[0050] Thaw the frozen straw in a 50℃ water bath for 16s, cut off both ends of the straw, transfer the semen into a 15mL centrifuge tube, and dilute it with 37℃ preheated thawing solution at a ratio of 1:8; after recovering at 37℃ for 15-20min, test the sperm motility under a CASA microscope. Thaw at least 3 straws for each individual, and perform at least 3 motility tests on each straw.

[0051] (3) Screening for individuals with extreme sperm freezing resistance

[0052] According to the above steps, the activity of fresh semen and frozen semen of boars was tested, and the frozen semen recovery rate was used to reflect the sperm freezing resistance phenotype. The formula is as follows:

[0053]

[0054] Among them, x i is the frozen sperm recovery rate of the i-th individual, Y i is the frozen sperm vitality of the ith individual, X i is the freshness and vitality of the ith individual.

[0055] In order to eliminate the influence of different test batches on the sperm motility test results, the Z-score method was used to standardize the sperm motility. The formula is as follows:

[0056]

[0057] Among them, Z i represents the standardized score of the i-th individual's frozen sperm recovery rate, x i represents the frozen semen recovery rate of the i-th individual, μ represents the mean of the frozen semen recovery rates of all individuals in each batch, and σ represents the standard deviation of the frozen semen recovery rates of all individuals in each batch. The σ formula is as follows:

[0058]

[0059] Among them, σ represents the standard deviation of the recovery rate of all individuals’ frozen sperm, N is the number of individuals, and x i is the recovery rate of the i-th individual frozen semen, and μ represents the mean recovery rate of all individual frozen semen in each batch.

[0060] The 395 individuals were sorted according to their Z values, and the first 25 individuals with high Z values ​​were selected, indicating a high sperm recovery rate, as the sperm freeze-resistant group. The last 25 individuals with low Z values ​​were selected, indicating a low sperm recovery rate, as the sperm freeze-intolerant group.

[0061] 3. Mining molecular markers related to sperm freezing tolerance based on genome resequencing

[0062] (1) Genome resequencing

[0063] According to the standard library construction process of Illumina's TruSeq DNA PCR-free prep kit reagent, the genomic DNA of 50 pigs in the sperm cryoresistant group and sperm intolerant group was used to construct the genome resequencing library, and 10× deep resequencing was performed on the Novasek-PE150 platform to obtain the raw sequencing data.

[0064] (2) Raw data processing

[0065] The fastp (v0.20.0) program was used to filter the raw data under the following conditions: remove the contamination of the 3' end adapter; use the sliding window method for quality filtering, the window size is set to 5bp, and the step size is set to 1bp. Each time a base is moved forward, 5 bases are taken to calculate the average Q value of the window. If the Q value of the last base is ≤2, only the bases before this position are retained; if the average Q value of the window is ≤20, only the penultimate base and the previous bases of the window are retained; if the length of any read in the double-end is ≤50bp, the double-end read is removed. The results showed that a total of 3.2 billion high-quality reads were obtained from 20 individuals, which were aligned to the Sus Scrofa11.1 reference genome using BWA software, with an average alignment rate of 99.31% and an average sequencing coverage depth of 7.13 (6.45-7.90).

[0066] (3) Analysis of genomic variation and calculation of genetic differentiation index between sperm cryoresistant and cryoresistant groups

[0067] For the genome resequencing data of 50 pigs, SNP mining was performed using samtools software, and a total of 26,323,490 high-quality SNPs were obtained. In order to obtain molecular markers related to sperm freezing resistance, the degree of population genetic differentiation Fst was analyzed based on SNP genotype information. Fst represents the degree of genetic differentiation between subpopulations within a population, and the Fst value is generally between 0 and 1. The smaller the Fst value, the smaller the genetic differentiation between subpopulations. When the value is 0, it means that all individuals in the two subpopulations can mate freely with each other, and the degree of genetic differentiation is the lowest; the larger the Fst value, the greater the genetic differentiation between subpopulations. When the value is 1, it means that the two subpopulations do not share any genetic diversity.

[0068] The distribution of θπ (θπ, freeze-tolerant group / freeze-intolerant group) and Fst values ​​was used to detect regions in the genome that were significantly selectively cleared. Regions with extremely low or high θπ ratios (1% left tail and 1% right tail) and significantly high Fst values ​​(i.e., Fst accounted for the top 1%) were selected as regions that were strongly selectively cleared.

[0069] (4) Screening for sperm freezing resistance PPP3CA gene g.119750378A>C genetic marker

[0070] Based on the above analysis, a total of 150,217 SNPs were found and annotated to 5,632 genes. In order to further screen molecular markers related to sperm freezing resistance, the above genes were subjected to the following functional analysis and filtering: by comparing with the International Mouse Phenotype Consortium (IMPC) database, 709 genes that may be related to sperm function were screened, of which 209 genes were common genes in two or three breeds. GO analysis results showed that these genes were mainly enriched in pathways such as sperm production and sperm development; through literature indexing and gene haplotype analysis, it was finally determined that the PPP3CA gene g.119750378A>C genetic marker was associated with sperm freezing resistance.

[0071] Example 2

[0072] Detection of polymorphism distribution of PPP3CA gene g.119750378A>C genetic marker in pigs.

[0073] In this example, the polymorphism distribution pattern of the g.119750378A>C genetic marker of the PPP3CA gene was detected in 395 boars. The detection results are shown in Table 1.

[0074] Table 1 Genotype frequency and gene frequency of PPP3CA gene g.119750378A>C site

[0075]

[0076] From the results in Table 1, we can see that the g.119750378A>C site of the PPP3CA gene in boars showed three genotypes: AA, AC and CC. Among them, the AA genotype individuals were more numerous, and the frequency of the A allele was 87%.

[0077] Example 3

[0078] Association analysis between the genetic marker g.119750378A>C of PPP3CA gene and boar sperm freezing resistance.

[0079] This example aims to determine the association between the g.119750378A>C site of the PPP3CA gene and the freezing resistance of boar sperm, perform polymorphism detection in 395 boar populations, and analyze the correlation between different genotypes of this polymorphic site and the frozen sperm recovery rate. SPSS statistical analysis software (IBM SPSS Statistics 26) GLM program was used to perform variance analysis of different SNP genotype combinations and perform significance tests. The model used was:

[0080] y=μ+G+B+T+e

[0081] ijkl ijk ijkl

[0082] Among them, yijkl is the recovery rate, μ represents the population mean, G i represents the genotype effect, B j represents the variety effect, T k represents the batch effect, e ijkl represents random effects.

[0083] The correlation analysis between different genotypes and boar frozen semen recovery rate was conducted in boars. The statistical analysis results are shown in Table 2:

[0084] Table 2 Correlation analysis between the PPP3CA gene g.119750378A>C locus and boar frozen semen recovery rate

[0085]

[0086]

[0087] Among them: The mean values ​​of traits in Table 2 are all mean ± standard error, and different letters on the shoulders indicate significant differences (P<0.05)

[0088] From the results in Table 2, it can be seen that the frozen semen recovery rate of individuals with AA genotype at the g.119750378A>C site of the PPP3CA gene in boars was significantly higher than that of individuals with CC genotype (P<0.05).

[0089] Example 4

[0090] The application of the PPP3CA gene g.119750378A>C genetic marker in the selection of sperm freezing resistance boars includes the following steps:

[0091] Step S1: Collect ear edge tissue samples from individual boars to be tested, perform DNA extraction and quality testing;

[0092] Step S2: Use forward primer F1 and reverse primer R1 to perform PCR amplification to obtain PCR amplification products and purify them; the PCR reaction system is 40 μL, and the components in the system are: 1 μL of genomic DNA, 20 μL of PCR mix, 2 μL of upstream primer and downstream primer respectively, and add ddH2O to make up the total volume to 40 μL; the PCR operation program is: 98℃ pre-denaturation for 2 minutes; 98℃ denaturation for 10 seconds, 60℃ annealing for 10 seconds, 72℃ extension for 15 seconds, 35 cycles; 72℃ extension for 2 minutes; 4℃ storage. The agarose gel electrophoresis detection of PCR amplification products is shown in the figure below. Figure 1 shown.

[0093] Step S3: Take part of the PCR purified product for sequencing and analyze the genotype at the 174 bp of the sequence. The sequencing map of the g.119750378A>C site is as follows Figure 2As shown, individuals with AA genotype are preferentially retained, individuals with CC genotype are preferentially eliminated, and individuals with AC genotype are selected to be retained.

[0094] In summary, the PPP3CA gene g.119750378A>C genetic marker is significantly correlated with boar reproductive traits, especially boar frozen semen recovery rate, and the AA genotype is the dominant genotype. Therefore, in the process of boar breeding, the SNP genetic marker can be used to assist in the selection of AA individuals with good reproductive performance according to the operations of step S1, step S2 and step S3 of Example 4, which is beneficial to improve the production performance of the group, improve the utilization rate of high-quality boars, and maximize the economic benefits of pig farming enterprises.

[0095] In the present invention, the specific sequences of SEQ ID NO: 1 to 3 are as follows:

[0096] The nucleotide sequence shown in SEQ ID NO:1:

[0097] GCATTGTTCTCCCCGGATTTTGAATTTCTATGCTCCCACCCTATTGGCTTTTAAAATCTCAAACAACTTAAAAAAGAGATTCCTCTTTACGATTTCGATTCATACAATGGCTTCATCAGTTATGATGCCAAACTTTTTATAGTCATTAACTTGTGACGAAATGATGGTCAC A GTAGTTTAGAAATCAATCGAGTACTACTTTCATCCCTCGAAAATCATGGAGTTAGTTTTTAGGGTGGGTGCTCCTTAGACAGGTCTATTATTTTGCGATTTATGACTGAATTAGAGAAGAATTAAGAAGCTTTGCTTTGGGCCTTGGTCTTCCCTTTCCCCCATCTTCTTCCTCTCATAGTTGACTAATCACCATGATGCTAACCTTTTAAA ATGCAGAGGGGGAACCAACTGTTTCTCGTCGTTTAATGAGTTTGGAATCAACTGTGTCTACCTTTGAAGAACCTCATCCATACTAATGAAAGGCACTGCGCATTTG;

[0098] Forward primer F1 shown in SEQ ID NO: 2: GCCATTGTTCTCCCCGGATT;

[0099] Reverse primer R1 shown in SEQ ID NO:3: CAAATGCGCAGTGCCTTTCA.

[0100] In SEQ ID NO: 1, the bold and underlined site is the g.119750378A>C site of the present invention.

[0101] Finally, it should be noted that the terms "comprises," "includes," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements that are inherent to such process, method, article, or apparatus.

[0102] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0103] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. Application of SNP genetic markers related to pig sperm freezing resistance in PPP3CA gene in pig genetic breeding, characterized in that: The SNP genetic marker related to the freezing resistance of pig sperm in the PPP3CA gene is named g.119750378A>C, which is located at the 119750378bp nucleotide position of chromosome 8 of the international pig genome version 11.1 reference sequence, and the base of the position is A or C. The g.119750378A>C is located in the intron region of the PPP3CA gene, corresponding to the 174bp position in the nucleotide sequence shown in SEQ ID NO:1; The pig genetic breeding is the genetic breeding of pigs regarding sperm freezing resistance; Among them, the freezing resistance of sperm of AA genotype individuals of g.119750378A>C is higher than that of AC genotype individuals; the freezing resistance of sperm of AC genotype individuals of g.119750378A>C is higher than that of CC genotype individuals; The pig breed includes at least one of Duroc pig, Landrace pig and Large White pig.

2. A method for early selection of the freezing resistance trait of pig sperm, characterized in that: The early selection method comprises performing early selection on the freezing resistance trait of pig sperm based on the genotype of the SNP genetic marker g.119750378A>C; The g.119750378A>C is located at the 119750378bp nucleotide position of the pig chromosome 8 in the international pig genome version 11.1 reference sequence, and the base of the position is A or C. The g.119750378A>C is located in the intron region of the PPP3CA gene, corresponding to the 174bp position in the nucleotide sequence shown in SEQ ID NO:1; Among them, the freezing resistance of sperm of AA genotype individuals of g.119750378A>C is higher than that of AC genotype individuals; the freezing resistance of sperm of AC genotype individuals of g.119750378A>C is higher than that of CC genotype individuals; The pig breed includes at least one of Duroc pig, Landrace pig and Large White pig.

3. The early selection method for the freezing resistance trait of pig sperm according to claim 2, characterized in that: The early selection method specifically includes: Detect the genotype of the SNP genetic marker g.119750378A>C in the pig genome to be tested; Based on the genotype of g.119750378A>C, early selection was performed on the sperm freeze-resistance trait of the tested pigs.

4. The early selection method for the freezing resistance trait of pig sperm according to claim 3, characterized in that: The detecting of the genotype of the SNP genetic marker g.119750378A>C in the pig genome to be tested specifically includes: The genomic DNA of the pig to be tested was amplified by PCR using forward primer F1 and reverse primer R1 as primers; The PCR amplification product was sequenced to obtain the genotype of the 119750378 bp nucleotide site of the pig chromosome 8 to be tested; The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO.2; the nucleotide sequence of the reverse primer R1 is shown in SEQ ID NO.

3.

5. Application of primers for detecting SNP genetic marker g.119750378A>C in pig genetic breeding, characterized in that: The g.119750378A>C is located at the 119750378bp nucleotide position of the pig chromosome 8 in the international pig genome version 11.1 reference sequence, and the base of the position is A or C. The g.119750378A>C is located in the intron region of the PPP3CA gene, corresponding to the 174bp position in the nucleotide sequence shown in SEQ ID NO:1; The primers for detecting the SNP genetic marker g.119750378A>C include a forward primer F1 and a reverse primer R1, the nucleotide sequence of the forward primer F1 is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer R1 is shown in SEQ ID NO.3; The pig genetic breeding is the genetic breeding of pigs regarding sperm freezing resistance; Among them, the freezing resistance of sperm of AA genotype individuals of g.119750378A>C is higher than that of AC genotype individuals; the freezing resistance of sperm of AC genotype individuals of g.119750378A>C is higher than that of CC genotype individuals; The pig breed includes at least one of Duroc pig, Landrace pig and Large White pig.

Images