SNP (Single Nucleotide Polymorphism) molecular marker for identifying egg laying amount of female sturgeons and application of SNP molecular marker

Abstract

The invention discloses an SNP molecular marker for identifying the egg laying amount of female sturgeons and application of the SNP molecular marker, and belongs to the field of sturgeon genetic breeding and sturgeon molecular marker-assisted breeding. According to the specific scheme, the SNP molecular marker for identifying the egg laying amount of the female sturgeon is located at the 333bp position of a 17 beta-hsd2 gene nucleotide fragment, the polymorphic form of the SNP molecular marker is C / G, and the genotype of a base mutation site of the SNP molecular marker comprises CC, CG or GG. The female individuals with the genotype of GG belong to low-egg-laying-amount individuals, and the female individuals with the genotypes of CC and CG belong to high-egg-laying-amount individuals. The molecular marker provided by the invention can be used for early artificial breeding of female sturgeon egg laying quantity characters, and can be widely applied to various female sturgeon populations such as acipenser schrenckii, Huso dauricus, acipenser sibiricum and hybrid sturgeons, so that the breeding process of sturgeon varieties with high egg laying quantity is remarkably accelerated.

Description

Technical Field

[0001] The invention belongs to the field of sturgeon genetic breeding and sturgeon molecular marker assisted breeding, and specifically relates to a SNP molecular marker for identifying the egg-laying amount of female sturgeons and an application thereof. Background Art

[0002] Sturgeon meat is firm, nutritious and delicious. Sturgeon caviar prepared from its eggs has always been a traditional luxury food in Europe and the United States. It is known as "black gold" and is one of the world's three major delicacies along with truffles and foie gras. Therefore, the spawning amount of female sturgeons, as an important part of economic traits, is closely related to breeding benefits and production costs, and directly affects the economic development of the sturgeon industry. The most direct way to improve the economic benefits of female sturgeons is to increase their spawning amount. The spawning amount of high-yield individuals and low-yield individuals in the same parental source and breeding environment can differ by more than 10%. Therefore, studying how to artificially select female sturgeons with high spawning amount traits is of great significance to improving the production and reproduction benefits of sturgeons.

[0003] Single Nucleotide Polymorphism (SNP), first proposed by American scholar Lander in 1996, refers to DNA sequence polymorphism caused by the variation of a single base in the genomic DNA sequence, which is produced by the transversion, conversion, deletion and insertion of a single nucleotide, among which conversion and transversion account for the vast majority of mutations, and insertion and deletion mutations can be almost ignored. As the third-generation molecular marker, SNP sites have the characteristics of high density, low mutation rate, diallel polymorphism and strong representativeness. At present, they have been widely used in animal and plant variety identification, kinship analysis and new variety breeding. In recent years, SNP molecular marker technology has been widely used in aquatic animal molecular breeding research and plays an important role in the development and breeding of excellent varieties. Therefore, screening molecular markers related to economic traits and applying them to early seed selection is of great significance for shortening the generation interval and improving the efficiency and accuracy of aquatic animal breeding.

[0004] 17β-hydroxysteroid deaminase (17β-hsd) is the main enzyme involved in the synthesis of estrogen in organisms. Type I 17β-hydroxysteroid deaminase (17β-hsd1) converts estrone (E1) with weak biological activity into estradiol (E2) with strong biological activity, while type II 17β-hydroxysteroid deaminase (17β-hsd2) converts estradiol (E2) into estrone (E1), which is the key enzyme for estrogen inactivation. Studies have shown that decreased expression of 17β-hsd2 will lead to abnormal local estrogen levels, thereby affecting the gonadal development of aquatic animals. Exogenous estradiol can also promote the synthesis of sea urchin yolk protein, thereby promoting ovarian development and egg production. Progesterone and estradiol (E2) may have the effect of stimulating and regulating the ovarian development of Chinese shrimp. At present, there is evidence that E2 can increase the ovarian gonad index of Chinese mitten crab and promote the maturation of its oocytes when the ovaries develop to stage III-IV, and the diameter of the oocytes increases significantly. The above studies show that the 17β-hsd2 gene can participate in the recruitment and ovulation of primordial follicles in the ovaries of aquatic animals by regulating the synthesis of various estrogens, and ultimately affect the ovarian reserve. So far, there is no record of SNP molecular markers related to the spawning trait of sturgeon in the relevant regulatory region of the 17β-hsd2 gene. Summary of the invention

[0005] In order to facilitate the identification of the egg-laying amount of female sturgeons, the present invention provides a SNP molecular marker for identifying the egg-laying amount of female sturgeons and an application thereof.

[0006] The primer pair described in the present invention can detect the genotype of a specific SNP site of the 17β-hsd2 gene. This SNP site has a significant correlation with the reproductive traits of female sturgeons. Therefore, by screening the SNP site genotype possessed by individuals with high spawning capacity, early selection of high reproductive traits and genetic improvement of varieties of female sturgeons can be carried out.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions:

[0008] A SNP molecular marker for identifying the high and low egg production of female sturgeons. The SNP molecular marker for identifying the high and low egg production of female sturgeons is located at the 333rd bp of the 17β-hsd2 gene nucleotide fragment (SEQ ID NO: 1), its polymorphism form is C / G, and the genotype of its base mutation site includes CC, CG or GG.

[0009] The nucleotide sequence of the detection primer pair for detecting the above SNP molecular marker is:

[0010] Forward primer F: 5'-CCCTTCTGGTGAGAGACTCTGTAG-3', i.e. SEQ ID NO: 2,

[0011] Reverse primer R: 5'-TACTCATCCAAAAAAATGGACTCTT-3', i.e. SEQ ID NO:3.

[0012] An application of the SNP molecular marker or the detection primer in identifying the spawning amount of female sturgeons comprises the following steps:

[0013] Step 1, extracting genomic DNA from the fin tissue of the female sturgeon to be tested;

[0014] Step 2: using detection primers to perform PCR amplification on sturgeon genomic DNA to obtain 17β-hsd2 gene nucleotide fragments;

[0015] Step 3, detect the genotype at the 333bp of the PCR amplification product; among them, female individuals with genotype GG are low egg-laying individuals (egg weight / body weight <0.15), and female individuals with genotypes CC and CG are high egg-laying individuals (egg weight / body weight >0.2).

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The present invention provides a SNP molecular marker associated with the spawning quantity trait of female sturgeons, the SNP molecular marker is located at the 7824bp of the 17β-hsd2 gene of chromosome No. NC_081207.1 of sturgeons, that is, the 333bp of the nucleotide fragment of the 17β-hsd2 gene (SEQ ID NO: 1); there is a C / G base mutation at the SNP site, which has a significant correlation with the spawning quantity trait of female sturgeons. The spawning quantity trait of individuals with the GG genotype is significantly lower than that of the CC and CG genotypes, and the matching rate of the genotyping results of the SNP molecular marker and the actual spawning quantity trait is as high as 75.58%. The molecular marker provided by the present invention can be used for early artificial breeding of the spawning quantity trait of female sturgeons, and can be widely applied to a variety of female sturgeon populations such as Acipenser schrenckii, Acipenser dabryanus, Acipenser siberianus and hybrid sturgeon. The SNP site of the gene 17β-hsd2 related to the spawning quantity trait of sturgeons lays a theoretical foundation for the molecular marker-assisted breeding of female sturgeons with high fertility traits, thereby significantly accelerating the breeding process of high spawning quantity sturgeon variety breeding.

[0018] The present invention accelerates the genetic selection process of the spawning quantity trait of female sturgeons through the dominant allele genotype of SNP molecular markers, and at the same time significantly shortens the breeding cycle of sturgeon reproductive traits, thereby saving the cost of artificial breeding of sturgeons and effectively improving the economic benefits of sturgeon farming. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 These are the three genotype sequencing peak diagrams of the PCR amplification products in Example 1 of the present invention. DETAILED DESCRIPTION

[0020] The technical solution of the present invention will be clearly and completely described below in conjunction with the drawings and embodiments. Obviously, the described embodiments are only part of the embodiments of the invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0021] Embodiment 1:

[0022] Identification of polymorphic loci in the 17β-hsd2 gene of female sturgeon.

[0023] 1. Acquisition of high and low spawning female sturgeon test samples: The fish used in this experiment were all from Hangzhou Qiandao Lake Sturgeon Technology Co., Ltd. 86 female adult individuals with strong physique, no obvious damage on the body surface, and good vitality were selected, with a body length of 138.77±36.68cm and a weight of 26.47±6.28kg. After dissection, egg collection and weighing, 17 female fish with an spawning rate higher than 20% were selected as the high spawning rate group, and 69 female fish with an spawning rate lower than 15% were selected as the low spawning rate group. The fish fins were cut as experimental samples for extracting genomic DNA and stored at -20℃ for subsequent experiments.

[0024] 2. Extract genomic DNA from the fin tissue of the female sturgeon to be tested: Use a column-type animal tissue genomic DNA extraction kit to extract the fin genomic DNA. After extraction, use 1% agarose gel electrophoresis to detect the quality and integrity of the DNA; use NanoDrop2000 ultra-micro spectrophotometer to determine the DNA concentration. The genomic DNA samples that meet the concentration requirements and have good integrity are stored in a -20℃ refrigerator for future use.

[0025] 3. Amplify the nucleotide fragment containing the SNP site

[0026] 3.1 Primer design: The DNA sequence corresponding to the 17β-hsd2 gene (NCBI accession number: LOC117424683) was downloaded from the sturgeon genome database (https: / / www.ncbi.nlm.nih.gov / ), and primers were designed based on the partial DNA sequence of the 17β-hsd2 gene, including:

[0027] Forward Primer F: 5'-CCCTTCTGGTGAGAGACTCTGTAG-3' (SEQ ID NO: 2)

[0028] Reverse Primer R: 5'-TACTCATCCAAAAAAATGGACTCTT-3' (SEQ ID NO: 3).

[0029] The amplified region of the primer is 546 bp in length, and the amplified sequence is shown in SEQ ID NO: 1, which includes a molecular marker site with a C / G mutation at position 333 bp.

[0030] SEQ ID NO:1

[0031] GTGAAACGGATTTTAATATTTATTTAACGTTCTTTATGTAGGGTGGCACTTTGGTCTA

[0032] AATTAATCGATGAGACATTATTTAAATTAATCCAATTTCCTTTGCACTTGTTGGTTTT

[0033] GTTATTTCGATTAAATAAATAAGACAAAAATATGTTTTTGTTTTGTGATTTAATTTTTT

[0034] TAATGTATTTTTCTTTTGCAGCCAGGCCACGTGTTACTGCTCACAGACTGAATATCTTT

[0035] GCATGAGCATAGTCAAGACAAACAGCTACTGTCACAACAGGTTTCCAGGCATTGATCAAAATTATTATTTATTTCTTAGCAGACGCCCTTATCCAGGG[G / C]AACTTACAATTA TTACAAGATATCACATTATTTTTACATACAATGACATTATTTTTTTACATACAATTACCCATTTATACAGTTGGCTTTTTACTGGAGCAATCTAGGTAAAGTACCTTGCTCAAGGGTACAGCAGCAGTGTCCCCCCACCTGGGATTGAACCCACGACCCTCCAGTCAAGAGTCCATTTTTTGGGATGAGTAAAAATTGTAT

[0036] 3.2 PCR amplification: The PCR reaction system was 20 μL, including: 10 μL 2×TSINGKE MasterMix (Blue), 0.8 μL forward primer (10 μmol / L), 0.8 μL reverse primer (10 μmol / L), 1.0 μL template DNA (≥100 ng / μL) and 7.4 μL ddH2O. The PCR reaction conditions were: 95°C pre-denaturation for 5 min, [95°C denaturation for 30 s, 52°C annealing for 30 s, 72°C extension for 30 s] 35 amplification cycles, and finally 72°C extension for 10 min.

[0037] 4. Detect PCR amplified fragments and obtain SNP molecular markers: Perform Sanger single-end sequencing on the PCR product in step 3 based on the ABI 3730XL sequencing platform. The genotype at the 333 bp of the PCR amplified product is the genotype of the SNP site. The sequencing peaks of the three genotypes are shown in Figure 2. Figure 1 shown.

[0038] Embodiment 2:

[0039] The polymorphic loci of the 17β-hsd2 genome of 86 samples to be tested were analyzed in an expanded population. The association analysis between the SNP loci and the spawning quantity trait was performed on 86 female sturgeons in the high spawning quantity group and the low spawning quantity group using a general linear model (Table 1), which verified that the genotype of the SNP molecular marker at this location was significantly positively correlated with the spawning quantity trait of sturgeon (P<0.05), and the matching rate between the genotyping results of this SNP molecular marker and the actual spawning quantity trait was 75.58%.

[0040] Table 1 Genotype frequencies of SNP loci in high and low spawning groups of sturgeon

[0041]

[0042]

[0043] Note: * indicates significant difference (P<0.05), ** indicates extremely significant difference (P<0.01).

[0044] In the process of breeding sturgeon varieties with high spawning capacity, individuals with genotype GG can be selected and eliminated, while individuals with genotype CC and CG can be retained.

[0045] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A SNP molecular marker for identifying the amount of eggs laid by female sturgeons, characterized in that: The SNP molecular marker for identifying the high or low egg-laying amount of female sturgeons is located at the 333rd bp of the 17β-hsd2 gene nucleotide fragment SEQ ID NO: 1, and its polymorphism form is C / G, and the genotype of its base mutation site includes CC, CG or GG.

2. A detection primer for detecting the SNP molecular marker according to claim 1, characterized in that: The nucleotide sequence of the detection primer of the above SNP molecular marker is: Forward primer F: 5'-CCCTTCTGGTGAGAGACTCTGTAG-3', i.e. SEQ ID NO: 2, reverse primer R: 5'-TACTCATCCAAAAAAATGGACTCTT-3', i.e. SEQ ID NO:

3.

3. Use of the SNP molecular marker according to claim 1 or the detection primer according to claim 2 in identifying the amount of eggs laid by female sturgeons.

4. The use according to claim 3, characterized in that: The following steps are involved: Step 1, extracting genomic DNA from the fin rays of the sturgeon to be tested; Step 2: using detection primers to perform PCR amplification on the genomic DNA of sturgeon to obtain a nucleotide fragment of the 17β-hsd2 gene, namely, SEQ ID NO: 1; Step 3, detecting the genotype at the 333 bp position of the PCR amplification product; among them, female individuals with genotype GG are low egg-laying individuals, and female individuals with genotypes CC and CG are high egg-laying individuals.

Images