Primer group of molecular markers for distinguishing sparus latus and black sparus fry, kit and application of primer group

Abstract

The invention discloses a primer group of molecular markers for distinguishing sparus latus and black sparus fry, a kit and application of the primer group. The primer group of the molecular marker for distinguishing the sparus latus and the black sparus offspring seeds comprises F: ACTGATCCTGATGAACCCTA and R: GTGTCGTTAGGACAGGATAC. The primer group of the molecular marker for distinguishing the sparus latus offspring seeds and the black sparus offspring seeds comprises F: ACTGATCCTGATGAACCCTA. The sparus latus seedlings and the black sparus seedlings are very similar in form. Based on the molecular marker, the sparus latus and the black sparus can be accurately and rapidly distinguished, breeding enterprises are helped to purchase correct cultured fishes, and economic losses caused after fry are cultured are avoided.

Description

Technical Field

[0001] The invention belongs to the field of molecular marker development, and particularly relates to a primer set, a kit and applications thereof for distinguishing fry of yellowfin sea bream and blackfin sea bream. Background Art

[0002] Yellowfin snapper and blackfin snapper are important farmed fish of the family Sparidae in my country and have important economic value. At the seedling stage, the morphology of yellowfin snapper and blackfin snapper is extremely similar, and enterprises and farmers cannot distinguish them. The market price of yellowfin snapper is much higher than that of blackfin snapper. If blackfin snapper seedlings are mistaken for yellowfin snapper, by the time the seedlings grow up and are sold, irreparable economic losses have already occurred. Summary of the invention

[0003] The first object of the present invention is to provide a molecular marker for distinguishing yellowfin sea bream and blackfin sea bream fry and application thereof.

[0004] The primer set of molecular markers for distinguishing yellowfin sea bream and blackfin sea bream fry of the present invention comprises: F: ACTGATCCTGATGAACCCTA (SEQ ID NO. 1) and R: GTTGTCGTTAGGACAGGATAC (SEQ ID NO. 2).

[0005] The invention provides a kit for distinguishing yellowfin seabream and blackfin seabream fry, which comprises the primer set of molecular markers for distinguishing yellowfin seabream and blackfin seabream fry.

[0006] The present invention also provides the use of the primer set or the kit in distinguishing yellowfin sea bream and blackfin sea bream fry.

[0007] The present invention also provides a method for distinguishing yellowfin sea bream from blackfin sea bream, which comprises the following steps: The genomic DNA of the tested seedlings was extracted, amplified with the above primer set, and then subjected to capillary electrophoresis to analyze the experimental results. The amplified product in yellowfin sea bream was 524 bp long, and the amplified product in blackfin sea bream was 536 bp long. The fluorescent group FAM was added to the 5' end of the forward primer.

[0008] Preferably, the PCR reaction system is: 14.1 μL deionized water, 2 μL 10xEx buffer (20 mM, containing Mg 2+ ), 1.6μL dNTPMix (2.5mM), 0.8μL primer F (10mM), 0.8μL primer R (10mM), 0.2μL ExTaq enzyme (5U), 0.5μL DNA (50ng / µL).

[0009] Preferably, the PCR reaction procedure of the PCR is: 94°C for 5 min; 35 cycles of 94°C for 30 s; 50°C for 30 s; 72°C for 30 s; 72°C for 5 min. Amplification is performed using the above reagents and procedures to obtain PCR products.

[0010] The fry of yellowfin sea bream and the fry of blackfin sea bream are very similar in morphology. The present invention is based on molecular markers and can accurately and quickly distinguish yellowfin sea bream from blackfin sea bream, helping breeding companies to purchase the correct breeding fish and avoid economic losses caused by seedlings after growth. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 Is the result detection in yellowfin bream ; Figure 2 It is the result detection in blackfin sea bream. DETAILED DESCRIPTION

[0012] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0013] Embodiment 1: 1. Sample collection and storage The muscles and fin rays of yellowfin sea bream fry and blackfin sea bream fry were cut and placed in Eppendorf tubes. After freezing in liquid nitrogen, they were transferred to a -80°C refrigerator for storage.

[0014] 2. DNA Extraction Genomic DNA was extracted using a marine animal tissue genomic DNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.) and diluted to 50 ng / µL for later use.

[0015] 3. Sequence Alignment Compare the genome sequences of yellowfin sea bream and blackfin sea bream, obtain specific fragments, and design amplification primers as follows: F: ACTGATCCTGATGAACCCTA and R: GTTGTCGTTAGGACAGGATAC.

[0016] 4. PCR Amplification PCR amplification was performed with primers, and the PCR products were checked on agarose gel. Primers that could amplify a single target band in both yellowfin sea bream and blackfin sea bream were selected (F: ACTGATCCTGATGAACCCTA and R: GTGTCGTTAGGACAGGATAC). The fluorescent group FAM was added to the 5 end of the forward primer F. The PCR reaction system was: 14.1 μL deionized water, 2 μL 10xEx buffer (20 mM, containing Mg 2+), 1.6μL dNTPMix (2.5mM), 0.8μL primer F (10mM), 0.8μL primer R (10mM), 0.2μL ExTaq enzyme (5U), 0.5μL DNA (50ng / µL).

[0017] The PCR reaction program was: 94°C for 5 min; 35 cycles of 94°C for 30 s; 50°C for 30 s; 72°C for 30 s; 72°C for 5 min. The PCR product was obtained by amplification using the above reagents and program.

[0018] 5. Capillary electrophoresis detection The PCR product obtained in step 4 was subjected to capillary electrophoresis using an automatic sequencer (ABI3730XL) with LIZ1200 as the internal standard. The experimental results were analyzed using GeneMapperSoftware5.

[0019] 6. Results The amplified product in yellowfin sea bream was 524 bp long, and the amplified product in blackfin sea bream was 536 bp long, with a difference of 12 bp between the two, which is consistent with the results of sequence alignment.

[0020] Experimental example 1. Collect 10 yellowfin snappers and 10 blackfin snappers, cut the muscle tissue of each individual, place them in cryopreservation tubes in turn, freeze them with liquid nitrogen, and store them in a -80℃ refrigerator.

[0021] 2. The genomic DNA of all individuals was extracted using a marine animal tissue genomic DNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.).

[0022] 3. Synthesize F and R primers (F: ACTGATCCTGATGAACCCTA and R: GTGTCGTTAGGACAGGATAC), and add fluorescent FAM to the 5 end of the F primer.

[0023] 4. According to the PCR reaction procedure and system described above, PCR amplification was performed using the individual DNA of yellowfin sea bream and blackfin sea bream as templates.

[0024] 5. The PCR products were subjected to capillary electrophoresis on an automatic sequencer (ABI3730XL), and the experimental results were analyzed using GeneMapperSoftware.

[0025] like Figure 1 and Figure 2 As shown, stable typing results were obtained when the method was verified in 10 yellowfin sea bream and 10 blackfin sea bream individuals.

Claims

1. A primer set for molecular markers for distinguishing yellowfin sea bream and blackfin sea bream fry, characterized in that: include: F: ACTGATCCTGATGAACCCTA and R: GTTGTCGTTAGGACAGGATAC.

2. A kit for distinguishing yellowfin sea bream and blackfin sea bream seedlings, characterized in that: The present invention comprises the primer set of molecular markers for distinguishing yellowfin sea bream and blackfin sea bream fry as described in claim 1.

3. Use of the primer set described in claim 1 or the kit described in claim 2 in distinguishing yellowfin sea bream and blackfin sea bream fry.

4. A method for distinguishing yellowfin sea bream from blackfin sea bream, characterized in that: The following steps are involved: The genomic DNA of the seedlings to be tested is extracted, amplified with the primer set described in claim 1, and then subjected to capillary electrophoresis to analyze the experimental results. The amplified product in yellowfin sea bream is 524 bp long, and the amplified product in blackfin sea bream is 536 bp long. The fluorescent group FAM is added to the 5' end of the forward primer.

5. The method according to claim 4, characterized in that The PCR reaction system is as follows: 14.1 μL deionized water, 2 μL 10xEx buffer containing Mg 2+ 20mM, 1.6μL dNTPMix2.5mM, 0.8μL 10mM, 0.8μL 10mM, 0.2μL ExTaq enzyme 5U, 0.5μL DNA 50ng / μL.

6. The method according to claim 4, characterized in that The PCR reaction procedure is: 94°C for 5 min; 35 cycles of 94°C for 30 s; 50°C for 30 s; 72°C for 30 s; 72°C for 5 min. The PCR product is obtained by amplification using the above reagents and procedures.

Images