A snp molecular marker related to 8-week-old weight of chicken and application thereof

Abstract

The application discloses a SNP molecular marker related to the weight of 8-week-old chickens and an application thereof, and belongs to the field of molecular biology. The SNP site is located at the 10,617,483th nucleotide of chromosome 3 in a genome, and the SNP name is rs315282035. GWAS results show that the SNP site presents G / A polymorphism, and G has a positive effect on the weight of 8-week-old chickens. For the site, genotype statistical analysis is carried out in other high-weight and low-weight chicken populations, and the GG genotype is the dominant genotype of high-weight chickens. Therefore, chickens with the GG genotype of the site can be selected, and early selection of high-weight chickens is expected, so that the genetic breeding of chickens can be accelerated.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of molecular biology, and particularly relates to a SNP molecular marker related to the body weight of 8-week-old chickens and application thereof. BACKGROUND

[0002] In the meat consumption of Chinese residents, the consumption of chicken is second only to pork, ranking second in the meat consumption list. In recent years, with the change of consumption concept of Chinese residents, the per capita consumption of chicken is also increasing. China's broiler breeding industry has experienced years of development and has become one of the largest broiler producing countries in the world. Broiler breeding plays an important role in China's agriculture, not only meeting the consumption demand of the domestic market, but also occupying a certain share in the international market. With the upgrading of domestic consumption structure and the improvement of residents' living standards, the demand for high-quality broilers is growing, further promoting the development of the broiler breeding industry.

[0003] With the rapid growth of demand, improving yield and improving quality have become the focus of breeding in the breeding field. The traditional breeding method of screening excellent chicken breeds has large workload, complicated process and low efficiency. With the progress of genomics research and the development of genetic marker technology, breeding scientists can select genotypes with excellent traits for breeding, thereby further improving the yield and quality of chicken.

[0004] SNP (single nucleotide polymorphism) is an important genetic variation form, which has the characteristics of rich quantity, wide distribution and high stability, and is widely used in molecular breeding and genetic research. However, in the practice of molecular breeding of broilers, markers that can clearly function and significantly affect traits are still scarce. Therefore, in-depth mining of molecular markers with strong effect and high application has become a research hotspot. In particular, if the key SNP related to the target trait can be accurately located and the underlying molecular mechanism is elucidated, it will provide new ideas for genetic improvement of chickens and promote major breakthroughs in poultry breeding.

[0005] As a core trait, the week-old weight of chickens, mining SNP molecular markers significantly related to the week-old weight of chickens, by selecting chickens with fast growth and large weight, can significantly improve the production efficiency of the population. SUMMARY

[0006] The technical problem to be solved by the present application is to provide a SNP molecular marker related to the body weight of chickens and application thereof.

[0007] The technical scheme of the present application is: a method for breeding high weight trait chickens, extracting genomic DNA of chicken samples, detecting the genotype of the chicken sample at the position 10,617,483 of chromosome 3, and selecting individuals with the GG genotype at the site to have a higher weight trait than other genotypes, and the reference genome version is GRCg6a.

[0008] The application of the substance for detecting SNP site polymorphism or genotype in the assisted breeding of high weight trait chickens, the SNP site is located at the position 10,617,483 of chicken chromosome 3, has G / A polymorphism, and individuals with the GG genotype at the site have a higher weight trait than other genotypes, and the reference genome version is GRCg6a.

[0009] Further, the substance is a primer pair, and the nucleotide sequences of the primer pair are shown in SEQ ID No. 1 and SEQ ID No. 2.

[0010] The application of the substance for detecting SNP site polymorphism or genotype in the preparation of a kit for the assisted breeding of high weight trait chickens, the SNP site is located at the position 436 of the nucleotide sequence shown in SEQ ID No. 3.

[0011] Further, the substance is a primer pair, and the nucleotide sequences of the primer pair are shown in SEQ ID No. 1 and SEQ ID No. 2.

[0012] A kit contains a primer pair shown in SEQ ID No. 1 and SEQ ID No. 2.

[0013] Compared with the prior art, the present application has the following beneficial effects:

[0014] The SNP molecular marker of the present application is significantly related to the weight of 8-week-old chickens, the GG genotype is the dominant genotype of high weight chickens, and the proportion of the GG genotype in high weight chickens is significantly higher than that in low weight chickens. Therefore, chickens with the GG genotype at the site can be preferred, and early selection of high weight chickens is expected, thereby accelerating the genetic breeding of chickens. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 Association of SNP on chromosome 3 with the weight of 8-week-old chickens;

[0016] Figure 2 Genotype distribution of different breeds of chickens;

[0017] Figure 3 Proportion of different genotypes in high weight and low weight chickens. DETAILED DESCRIPTION

[0018] The experimental methods in the following examples are all conventional methods unless otherwise specified. The experimental materials used in the following examples are all purchased from commercial channels unless otherwise specified.

[0019] Example 1 Mining of SNP molecular markers

[0020] Using resequencing technology to sequence individuals of a cross population of chickens, and performing quality control filtering on the identified SNPs, a SNP site (rs315282035) significantly related to the body weight of 8-week-old chickens is selected. Figure 1 ) from the SNPs.

[0021] The SNP is located at position 10,617,483 of chromosome 3 of the genome version GRCg6a (https: / / ftp.ensembl.org / pub / release-106 / fasta / gallus_gallus / dna / Gallus_gallus.GRCg6a.dna.chromosome.1.fa.gz) (SNP name: rs315282035). The SNP is detected in 1155 chicken individuals, and the allele frequency, effect value and significance P value are shown in Table 1. The G allele shows a strong positive correlation with body weight (BETA = 23.5741), and therefore the G allele is dominant in high body weight chicken breeds.

[0022] Table 1 Allele frequency and effect value

[0023]

[0024] Example 2 Verification of SNP molecular markers

[0025] 1. Experimental materials

[0026] High body weight chicken breeds: Luxi fighting chicken (n = 9), Nanjiang fighting chicken (n = 8), Cornish chicken (n = 1), Langshan chicken (n = 10), Plymouth Rock chicken (n = 1), Guangxi chicken (n = 6), Miyi chicken (n = 5), Yuanbao chicken (n = 24).

[0027] Low body weight chicken breeds: Daweishan small chicken (n = 8), Jiangxi silk feather chicken (n = 20), Tibetan chicken (n = 1), Tibetan chicken (Abah, n = 6), Tibetan chicken (Haiyan, n = 6), Tibetan chicken (Lhasa, n = 27), Tibetan chicken (Rikaze, n = 35), Tibetan chicken (Shannan, n = 26).

[0028] 2. Test method

[0029] Genotype data of 928 chickens were downloaded from Galbase (http: / / animal.omics.pro / code / index.php / ChickenVar), and the genotypes of rs315282035 locus in 64 high weight chicken breeds and 129 low weight chicken breeds were extracted by self-written scripts, and the genotype distribution of each chicken breed was counted. Figure 2 ).

[0030] 3. Result analysis

[0031] The frequency of allele G of chr3:10,617,483 in the high weight chicken population was 0.73, and the frequency in the low weight population was 0.45, which had a significant difference, with a P value of 7.95x10 -08 Therefore, the G genotype is the dominant allele of high weight chickens. Genotype analysis found that the proportion of GG genotype of high weight chickens was 0.64, and the proportion of GG genotype of low weight chickens was 0.26. The frequency of GG genotype of high weight chickens was 2.46 times that of low weight chickens, which had statistical significance, with a P value of 3.87x10 -07 ( Figure 3 ). Therefore, by comparing the SNP frequency and genotype distribution of high weight and low weight chicken populations, the SNP molecular marker was confirmed. By selecting individuals with allele GG at this site, the weight of the breeding population can be improved.

[0032] Example 3 Detection of SNP molecular marker

[0033] (1) Based on the upstream and downstream sequence information of the SNP molecular marker, primers for amplifying the fragment containing the SNP site were designed;

[0034] Forward primer F: CTGGGCAAAAGGAGACTTGA (SEQ ID No. 1)

[0035] Reverse primer R: AGGAACAAGGCTGCACAGAT (SEQ ID No. 2)

[0036] (2) Extract the genomic DNA of the chicken sample to be detected as a template, and use the primer pair designed in (1) for PCR amplification to obtain an amplification product containing the SNP site with a size of 861 bp, the sequence is shown as SEQ ID No. 3, and the SNP site is located at position 436 of the sequence shown in SEQ ID No. 3.

[0037] (3) The amplification product was subjected to sanger sequencing to obtain the genotype of the SNP site.

Claims

1. A method for breeding high-weight chickens, characterized in that: Genomic DNA was extracted from chicken samples, and the genotype of position 10,617,483 of chromosome 3 of the chicken samples was tested. Individuals with the genotype of GG at this site were selected to have a higher weight trait than other genotypes. The reference genome version was GRCg6a.

2. Application of substances for detecting SNP site polymorphism or genotype in assisting breeding for high weight traits in chickens. The SNP site is located at position 10,617,483 of chicken chromosome 3 and has a G / A polymorphism. Individuals with the GG genotype at this site have a higher weight trait than other genotypes. The reference genome version is GRCg6a.

3. The use according to claim 2, characterized in that The substance is a primer pair, and the nucleotide sequences of the primer pair are shown as SEQ ID No.1 and SEQ ID No.

2.

4. Use of a substance for detecting SNP polymorphism or genotype in the preparation of a kit for assisting selection of chickens for high weight trait, wherein the SNP site is located at position 436 of the nucleotide sequence shown in SEQ ID No. 3, and individuals with the GG genotype at this site are selected to have a higher weight trait than those with other genotypes.

5. The use according to claim 4, characterized in that The substance is a primer pair, and the nucleotide sequences of the primer pair are shown as SEQ ID No.1 and SEQ ID No.2.

Images